Sage Journals: Discover world-class research

Abstract

Stress is the leading precipitating factor for migraine attacks but the underlying mechanism is currently unknown. Nitric oxide (NO) has been implicated in migraine pathogenesis based on the ability of NO donors to induce migraine attacks. In the present study, we investigated in Wistar rats the effect of air stress on nitric oxide synthase (NOS) mRNA and protein expression in dura and pia mater using real-time polymerase chain reaction and Western blotting, respectively. Endothelial (e)NOS protein expression was significantly increased in dura and pia mater after air stress. Significantly augmented neuronal (n)NOS protein expression was detected in pia mater after air stress but not in dura mater. Inducible NOS mRNA and protein expression levels in dura and pia mater were unaffected by stress. The increased expression of eNOS in dura mater and eNOS and nNOS in pia mater seen after stress could not be antagonized by treatment with the migraine drug sumatriptan. These findings point towards the involvement of increased NO concentrations in dura and pia mater in response to air stress. However, the role of these findings in relation to migraine pathophysiology remains unclear.

Keywords

Cerebral vessels meninges nitric oxide synthase rat stress

Introduction

Despite stress being one of the leading precipitating factors for migraine attacks, the physiological mechanisms and biochemical pathways initiating the headaches are largely unknown (1, 2). Prospective studies, where migraineurs kept a diary, showed that 1–4 days preceding a migraine attack appear more stressful to the migraineur than other days (3–6). The free radical gas nitric oxide (NO) is believed to play a key role in the pathogenesis of migraine (7). Endogenous NO is formed from the amino acid L-arginine by nitric oxide synthases (NOS), namely endothelial NOS (eNOS), neuronal NOS (nNOS) and inducible NOS (iNOS). eNOS and nNOS are constitutively expressed, but their expression is the object of regulation at the transcriptional, translational and post-translational levels (8). Although the expression of iNOS is detected primarily during inflammatory reactions, low basal levels of constitutive iNOS mRNA and protein have been found in human tissues (9, 10).

Migraine patients have an increased sensitivity towards the exogenous NO donor glyceryl trinitrate (GTN) when compared with non-migraineurs. During intravenous infusion of low doses of GTN, more migraine patients develop headache than healthy controls and at high doses the headache experienced by migraine patients is more severe (11). Furthermore, NO is able to act as an experimental migraine trigger, as infusion of GTN leads to the development of a delayed migraine attack in eight out of 10 migraine patients at an average of 5.5 h following termination of the infusion (12).

Vessels within the meninges are among the few intracranial structures that are able to generate nociceptive signals. When large cerebral vessels and vessels in the dura and pia mater are stimulated experimentally during brain surgery, patients experience a throbbing unilateral migraine-like pain (13), indicating that these structures are involved in migraine pain. In rats, eNOS protein expression has been demonstrated in the craniovascular system, including the endothelium of dural middle meningeal artery and pial vessels (14, 15). nNOS immunoreactivity has been detected within the endothelium of rat pial vessels and in rat pial perivascular nerve fibres (15–17). In the cerebral circulation of the rat, nNOS is primarily found in nerves belonging to the parasympathetic nervous system and, to a minor degree, in trigeminal nerves (18). Under physiologically normal circumstances, iNOS is rarely detected within rat CNS (19).

In relation to stress, immobilizing rats for 6 h increases the protein expression and enzyme activity of iNOS in rat brain cortex (20). Likewise, immobilization stress (6 h) causes up-regulation of nNOS mRNA expression and enzyme activity in the pituitary and hypothalamus (21). Furthermore, rats stressed for 1 h every day for 4, 9 or 14 days have a significantly increased NOS activity and an accumulation of NO metabolites in their hippocampus after 4 and 9 days of stress (22).

The aim of the present study was to investigate the hypothesis that stress increases the formation of NO in the pain-sensitive tissues dura and pia mater by increasing the expression of NOS. We examined the expression of eNOS, nNOS and iNOS in rat dura and pia mater after non-traumatic air stress at the mRNA and protein levels using reverse transcription real-time polymerase chain reaction (PCR) and Western blotting.

Methods

Animals

Animal experiments were performed on 114 male Wistar rats weighing 200–300 g, which were purchased from Taconic M&B, Denmark. The rats had a 12-h light/dark cycle with lights on at 06.00 h and had free access to food and drinking water. The rats were allowed to acclimatize for at least 7 days prior to the experiments. The experimental protocol was approved by the Danish committee for experiments on animals.

Air stress protocol

The rats were stressed between 09.00 h and 13.00 h in a laboratory adjacent to the animal housing room and afterwards they were returned to the animal housing facility. The control rats remained in the animal housing room during the procedure. The rats were air-stressed by placing them in a box of 10 × 25 × 10 cm and exposing them to an air flow through two tubes attached to holes in the box. The rats were stressed for 1 h/day for three successive days. On the third day the animals were sacrificed during an overdose of pentobarbital 30 min (only for mRNA analysis), 1, 2, 3 and 4 h after the air stress exposure and perfused transcardially with 100 ml of a cold 0.9% NaCl solution. The dura and pia mater were dissected out and frozen in 2-methylbutane at − 40°C. The samples were placed on dry ice and later homogenized.

Air stress combined with sumatriptan treatment

Rats stressed for 1 h per day for three consecutive days received an i.p. injection of 0.5 ml containing either the migraine drug sumatriptan (300 µg/kg Imigran^®; GlaxoSmithKline, Uxbridge, UK) or vehicle (0.9% NaCl) immediately after the end of air stress on the last day. All animals were killed during an overdose of pentobarbital 2 h after the end of air stress and were transcardially perfused with 100 ml of ice-cold saline. The dura and pia mater were dissected out and frozen in 2-methylbutane at − 40°C. The samples were placed on dry ice and later homogenized.

Homogenization

For real-time PCR analysis, the frozen tissue samples were homogenized by sonication in 1 ml of TRIzol (Invitrogen, Carlsbad, CA, USA) using a Vibra Cell ultrasonic processor (Sonics and Material Inc., Newtown, CT, USA) and stored at − 70°C until further use. For Western blotting, the frozen tissue samples were sonicated in 250 µl of homogenization buffer containing 10 m m HEPES pH 7.6, 4 m m KCl, 5 m m MgCl₂, 1 m m EDTA (ethylenediaminetetraacetic acid), 1 m m EGTA (ethyleneglycoltetraacetic acid), 1 m m DTT (dithiothreitol), 1 m m PMSF (phenylmethylsulphonyl fluoride), 1% SDS (sodium dodecyl sulphate) (all chemicals were purchased from Sigma-Aldrich, St Louis, MO, USA) and a protease inhibitor cocktail (one tablet diluted in 6 ml water; Roche, Basel, Switzerland) diluted 1 : 1.5 with the aforementioned solution. Following sonication, the samples were centrifuged at 20 000 g for 20 min and the supernatants were stored at − 70°C until the day of analysis.

Western blot analysis

The protein content of the samples was determined using a Bio-Rad DC protein assay (Bio-Rad, Hercules, CA, USA). The protein samples were diluted 1 : 1 with loading buffer and heated to 95°C for 5 min. Sample protein (12.5 µg) was loaded in each lane. Subsequently, the proteins were separated by electrophoresis on a 4–12% gradient polyacrylamide Tris-glycine gel (BioWhittaker Molecular Applications, Walkersville, ME, USA), which had a separation range from 25 to 250 kDa. Positive controls were a human endothelial cell lysate (eNOS) (BD Transduction Laboratories, San Jose, CA, USA), purified rat nNOS (Alexis Biochemicals, Lausen, Switzerland) and a liver sample from a lipopolysaccharide (LPS) (5 mg/kg i.p.; Sigma-Aldrich)-treated rat (iNOS). The separated proteins were transferred to nitrocellulose membranes (Pierce, Rockford, IL, USA) during wet transfer using a Novex XCell II blotting apparatus (Invitrogen). The blots were blocked for 1 h with a 5% non-fat dry milk solution in Tris-buffered saline with 0.05% Tween-20 (TBS–T). Blots were cut in half and the upper half was incubated overnight in TBS–T containing 3% skim milk and either a monoclonal mouse anti-eNOS antibody (1 : 1000, 610297; BD Transduction Laboratories), a monoclonal mouse anti-nNOS antibody (1 : 1000, 610309; BD Transduction Laboratories) or a polyclonal rabbit anti-iNOS antibody (1 : 1000, sc-650; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The lower halves of the blots were incubated with a loading control polyclonal rabbit antibody against β-actin (1 : 1000, A5060; Sigma-Aldrich). The following day, the eNOS, nNOS and β-actin blots were incubated for 1 h with goat anti-mouse or anti-rabbit secondary antibody linked to alkaline phosphatase (1 : 15 000; Amersham Biosciences, Little Chalfont, UK). The iNOS signal was amplified using an antirabbit Vectastain^® ABC alkaline phosphatase kit (avidin–biotin kit) according to the manufacturer's instructions (Vector Laboratories, Burlingame, CA, USA). An enhanced chemifluorescence system (Amersham Biosciences) was used for visualization of the protein bands, while the membranes were scanned on a Storm scanner (Amersham Biosciences). Optical density measurements were performed using the ImageQuaNT software (Amersham Biosciences). To compensate for any differences in the amount of loaded protein, the intensity of the NOS bands were divided by the intensity of the β-actin bands for each sample. The iNOS antibody was specific, as preabsorption with the immunizing peptide eliminated the iNOS band. The antibodies against eNOS, nNOS, iNOS and β-actin gave rise to bands of the expected size (Fig. 1).

Figure 1

Examples of the obtained endothelial nitric oxide synthase (eNOS), neuronal (n)NOS, inducible (i)NOS and β-actin Western blots. Besides a protein marker, the depicted eNOS blot shows from left to right control, 1-h and 2-h rat dura mater samples with the β-actin blot shown below. On the nNOS blot are shown the results from the analysis of control 1, control 2, 1-h and 2-h dura mater samples, while the iNOS blot depicts pial control, 1-h and 2-h samples. The NOS monomers display sizes corresponding to approximately 135 kDa, 160 kDa and 130 kDa for eNOS, nNOS and iNOS, respectively, while β-actin has a size of approximately 45 kDa. Note that the iNOS bands appear amplified.

cDNA synthesis

Total cellular RNA was extracted using the TRIzol (Invitrogen) extraction method following the manufacturer's instructions. The resulting RNA pellet was redissolved in 20 µl diethyl-pyrocarbonate treated water and the RNA concentration and purity was measured spectrophotometrically (GeneQuant; Amersham Biosciences). The total RNA was DNase-treated with DNase I (Sigma-Aldrich) according to the manufacturer's instructions and repurified using a RNeasy Mini Kit (Qiagen Inc., Valencia, CA, USA). cDNA was synthesized from 100 ng of DNase-treated RNA in a 20-µl reaction volume using reagents from Applied Biosystems (Foster City, CA, USA). The RNA was incubated at 70°C for 10 min with oligo-dT primers (16 bases; MWG Biotech, Ebersberg, Germany) and then placed on ice. Subsequently, the reaction mixture was added and the reaction was incubated at room temperature for 10 min with a final concentration of 1 unit RNase inhibitor, 0.5 m m dNTP, 2 µl 10 × PCR buffer, 2.5 µm oligo-dT primers and 2.5 m m MgCl₂. MuLV Reverse Transcriptase (2.5 U) was added, and the reaction incubated at 42°C for 1 h and at 70°C for 15 min.

Real-time PCR

Real-time PCR analysis of the relative eNOS and nNOS expression in the samples from the air stress experiments was performed using a GeneAmp 5700 Sequence Detection system (PerkinElmer, Wellesley, MA, USA). The growth of DNA product in the samples was monitored by adding GeneAmp SYBR^® Green to the reactions (Applied Biosystems). SYBR^® Green is a fluorescent dye that binds to double-stranded DNA and the GeneAmp 5700 Sequence Detection System thereby monitors the growth of DNA in real time with an optic and imaging system. Specific primers for rat eNOS, nNOS and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed as shown in Table 1. A mastermix of the following reaction components was prepared to the indicated end concentration: 15 µl H₂O, 3 µl forward primer (0.6 µm), 3 µl reverse primer (0.6 µm) and 25 µl GeneAmp SYBR^® Green. Matermix (46 µl) was filled in the microtitre plate wells with 4 µl cDNA (5 ng). For nNOS a final primer concentration of 1 µm was used. A reverse transcriptase (RT)-negative control for each sample, a calibrator sample and a H₂O control were included in all experiments. The real-time PCR was performed with the following profile: 50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min and subsequently a melting curve programme. A standard curve was made in which the crossing point (CP) values were plotted against log cDNA concentration (pooled rat pia mater samples) (Fig. 2). CP represents the fractional cycle number at which the amount of amplified target reaches a fixed threshold. The amplification efficiency (E) can be calculated from the slope of the standard curve (E = 10^−1/slope) with an ideal value of 2.0. The designed primer pairs gave rise to single PCR products and restriction enzyme digest of the products resulted in bands of the expected size when tested on an agarose gel. The amount of nNOS and eNOS product (target genes) was normalized to the amount of GAPDH product (reference gene) in the sample and then calculated relative to a calibrator sample, which was included in every real-time PCR run. The relative expression ratio (R) was calculated using the formula R = (E_target)^{ΔCP target (calibrator-sample)}/(E_ref)^{ΔCP ref (calibrator-sample)} (23). Real-time PCR of the relative iNOS mRNA expression was performed in a LightCycler detection system (Roche) with the use of a SYBR^® Green Taq ReadyMix kit (Sigma-Aldrich). The specific primer sequences for rat iNOS and GAPDH are listed in Table 1. A mastermix of the following reaction components was prepared to the indicated end concentration: 5.8 µl water, 0.6 µl forward primer (0.3 µm), 0.6 µl reverse primer (0.3 µm) and 10 µl SYBR^® Green Taq ReadyMix. Mastermix (17 µl) was filled in the LightCycler glass capillaries with 3 µl cDNA (15 ng). A calibrator sample, H₂O control and a RT-negative control for each sample were included in all experiments. The real-time PCR was performed with the following profile: 94°C for 30 s followed by 50 cycles with 94°C for 0 s, 60°C for 7 s and 72°C for 5 s and subsequently a melting curve programme. A standard curve was made in which the CP values were plotted against log to the cDNA concentration based on pooled rat dura mater samples (Fig. 3). The iNOS standard curve was performed on cDNA based on RNA extracted from the dura mater of an LPS-treated rat (5 mg/kg i.p.). Restriction enzyme digest of the iNOS and GAPDH PCR products resulted in bands of the expected size when run on an agarose gel. The amount of iNOS product was normalized to the amount of GAPDH product in the sample and then calculated relative to a calibrator sample, which was included in every real-time PCR run. This was performed by the LightCycler RelQuant software version 1.0 (Roche) giving the fold difference between sample and calibrator.

Figure 2

Crossing point (CP) vs. log pia mater cDNA concentration for the neuronal nitric oxide synthase (nNOS), endothelial (e)NOS and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer pairs performed on the GeneAmp 5700 Detection system (n = 2). The corresponding real-time PCR efficiencies were calculated according to the equation: E = 10⁽ ^−1/slope).

Figure 3

Crossing point (CP) vs. log cDNA concentration for the inducible nitric oxide synthase (iNOS) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer pairs performed on the LightCycler Detection system (n = 4). The corresponding real-time PCR efficiencies were calculated according to the equation: E = 10⁽ ^−1/slope).

Table 1

Primers designed for detection of mRNA expression for endothelial nitric oxide synthase (eNOS), neuronal (n)NOS, inducible (i)NOS and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

NCBI GeneBank		Primers (5′−3′)		Amplified sequence
Gene	Acc. No	Forward	Reverse	Seq. No.	Size, bp
eNOS	XM_342615	CCGGCGCTACGAAGAATG	CAGTGCCACGGATGGAAATT	2688–2766	79
nNOS	X59949.1	TGGCAACAGCGACAATTTGA	CACCCGAAGACCAGAACCAT	4126–4196	71
iNOS	D44591	ACCCAAGGTCTACGTTCAAGACA	CACATCCCGAGCCATGC	3165–3285	120
GAPDH	M17701	GGCACAGTCAAGGCTGAGAAT	TCGCGCTCCTGGAAGATG	196–266	71

Each set of forward and reverse primers were designed from GeneBank extracted sequences corresponding to the shown accession numbers (Acc. No.). The primer sequences, the amplified part of the GeneBank sequence (Seq. No.) and the size of the amplified products are shown.

Corticosterone radioimmunoassay

Twenty-four rats were randomly assigned to one of four groups: control, 1 day, 2 days and three consecutive days with 1 h air stress per day. All rats were accustomed to handling prior to the experiment. To avoid circadian variability, all blood samples were collected between 09.00 h and 10.15 h. Control rats were brought from the animal room and killed by decapitation in less than 40 s. All air stress experiments were performed in a room adjacent to the animal housing facility. After air stress exposure, the rats were decapitated immediately and trunk blood was collected in tubes containing EDTA (1 mg/ml blood) and the protease inhibitor aprotinin (Sigma-Aldrich) (0.55 TIU/ml blood). The collected blood was cold-centrifuged and the plasma samples were stored at − 70 °C until the day of analysis. Plasma corticosterone concentrations were measured in triplicates using a ¹²⁵I-corticosterone radioimmunoassay kit (DPC, Los Angeles, CA, USA).

Data analysis

In order to limit the number of animals, the control and stress/vehicle rats from the sumatriptan study were added to the 2-h group in the time profiling Western blot study. Statistical analysis of the Western blot data was performed on optical density raw data using the SAS system for Windows V8 (SAS Institute, Cary, NC, USA). The comparisons between groups were performed using one-way anova with Dunnett's multiple comparisons test as post-test in cooperation with the Department of Biostatistics, Copenhagen University. In regard to other data sets, comparisons between groups were performed using one-way anova (GraphPad Prism 4.0; GraphPad Software, Inc., San Diego, CA, USA) with Dunnett's multiple comparisons test as post-test. The corticosterone data were not normally distributed and the non-parametric Kruskall–Wallis test was employed with Dunn's multiple comparisons test as post-test. Data in this manuscript are presented as mean values ± standard error of mean (SEM). Statistical significance is assumed when P < 0.05.

Results

NOS expression in dura mater after air stress

eNOS mRNA and protein expression in rat dura mater was investigated at different time points after air stress exposure. The expression of eNOS mRNA was significantly up-regulated by 1.9-fold 3 h after air stress (P < 0.05, n = 5) when compared with the control group (Fig. 4a). However, eNOS protein expression was significantly increased when compared with controls, 1 h after stress by 43 ± 20% (P < 0.05, n = 6), 2 h after stress by 58 ± 10% (P < 0.001, n = 12) and 3 h after stress by 33 ± 8% (P < 0.05, n = 6) (Fig. 4b). Neither dural nNOS mRNA nor protein was significantly altered after air stress (Fig. 4c,d). A 2.8 times increase in iNOS mRNA level was detected 30 min after the end of air stress, but this increase was found to be statistically non-significant (P = 0.07) (Fig. 4e). No iNOS protein expression could be detected using ordinary Western blot analysis, so an avidin–biotin amplification step was employed. Dural iNOS protein expression after stress did not differ significantly from the expression in control animals (Fig. 4f).

Figure 4

Nitric oxide synthase (NOS) mRNA and protein expression in rat dura mater at different time points after air stress. Endothelial (e)NOS (a), neuronal (n)NOS (c) and inducible (i)NOS (e) mRNA expression is presented as relative to a calibrator sample (mean ± SEM, n = 5–7). eNOS protein expression (b) (n = 6–12), nNOS protein expression (d) (n = 5–12) and iNOS protein expression (f) (n = 9 in the 2-h group and otherwise n = 3) data are presented as percentage of control animal NOS expression after being corrected for the density of the β-actin bands. This was performed for each experimental round. The NOS and corresponding β-actin bands from representative Western blots are shown. Note that an amplification step was applied in order to detect the iNOS bands. Significance of the differences at specific time points: ∗P < 0.05; ∗∗∗P < 0.001.

NOS expression in pia mater after air stress

The eNOS mRNA level in pia mater was significantly increased by 1.4-fold 30 min after air stress (P < 0.05, n = 6) (Fig. 5a). eNOS protein expression was increased by 43 ± 7% 2 h after stress when compared with controls (P < 0.001, n = 12) and by 20 ± 6% 4 h after stress (P < 0.05, n = 7) (Fig. 5b). nNOS mRNA expression was significantly increased by 2.4-fold (P < 0.01, n = 6) 30 min after air stress (Fig. 5c), while protein expression was increased by 34 ± 8% 2 h after stress (P < 0.01, n = 15) (Fig. 5d). iNOS mRNA expression 30 min after the end of air stress was twice the average level detected in the control animals, but the increase was found to be statistically non-significant (P = 0.08, n = 7) (Fig. 5e). The iNOS proteins were not detectable using ordinary Western blotting, so an avidin–biotin amplification step was employed. Pial iNOS protein expression did not increase after stress (Fig. 5f).

Figure 5

Nitric oxide synthase (NOS) mRNA and protein expression in pia mater at different time points after air stress. Endothelial (e)NOS (a), neuronal (n)NOS (c) and inducible (i)NOS (e) mRNA expression is presented as relative to a calibrator sample (n = 5–7). eNOS protein expression (b) [n = 3 (3 h) to 12 (2 h)], nNOS protein expression (d) (n = 7–15) and iNOS protein expression (f) (n = 3–7) data are presented as percentage of control animal NOS expression after being corrected for the density of the β-actin bands. This was performed for each experimental round. The NOS and corresponding β-actin bands from representative Western blots are shown. Note that an amplification step was applied in order to detect the iNOS bands. Data are presented as mean ± SEM. Significance of the differences at specific time points: ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001.

Effects of air stress on plasma corticosterone concentrations

In order to verify that the rats were stressed from the air stress treatment, the plasma corticosterone levels elicited in control rats and rats exposed to 1 h/day of air stress for either 1, 2 or 3 days were determined (Fig. 6). The basal median corticosterone level measured in six control rats was 35 ng per ml plasma. A significant difference was revealed between the corticosterone level in control animals and animals exposed to 1 day of air stress, a median value of 506 ng per ml plasma (P < 0.01, n = 6). After 2 and 3 days of air stress median corticosterone levels were increased to 296 (P < 0.05, n = 6) and 390 ng per ml plasma (P < 0.05, n = 6), respectively. The results indicate that a gradual adaptation to the stress exposure had occurred. Interestingly, there may be low and high responders to stress exposure as the corticosterone measurements seemed to be divided into two groups.

Figure 6

Plasma corticosterone levels in plasma of control rats and rats exposed to 1 h/day of air stress for one, two or three consecutive days, n = 6. A line is placed at the median (∗∗∗P < 0.001; ∗∗P < 0.01; ∗P < 0.05).

NOS protein expression in dura and pia mater after air stress and sumatriptan treatment

It was investigated whether treatment with the migraine drug sumatriptan was able to antagonize the increased protein expression of eNOS and nNOS, seen 2 h after air stress exposure. In rat dura mater, no significant difference was detected between eNOS expression in stressed rats subjected to either vehicle (saline) or sumatriptan treatment. When compared with the controls, dural eNOS expression was increased by 64 ± 14% after air stress and vehicle (P < 0.01, n = 8) and 52 ± 14% after air stress and sumatriptan treatment (P < 0.05, n = 8). No significant difference in dural nNOS expression could be detected between the control group and the different treatments. Moreover, air stress had no significant impact on dural iNOS expression and treatment with sumatriptan did not cause any change in basal iNOS expression. No significant difference was found between pial eNOS expression in stressed rats receiving vehicle and stressed rats administered sumatriptan. The detected eNOS expression in pia mater was significantly increased, in rats receiving both vehicle (53 ± 12%, P < 0.01, n = 6) and sumatriptan treatment (42 ± 12%, P < 0.05, n = 6), when compared with expression in control animals. Similarly, no significant difference was found between pial nNOS expression in stressed rats administered vehicle and sumatriptan, respectively. When compared with the control group, expression of nNOS in pia mater was significantly increased 2 h after air stress in rats receiving vehicle (51 ± 14%, P < 0.05, n = 8) but not in rats receiving sumatriptan treatment (44 ± 14%, P > 0.05, n = 8). Air stress had no significant effect on iNOS protein expression in pia mater and treatment with sumatriptan did not alter iNOS expression.

Discussion

A wide range of naturally occurring and experimental migraine-triggering factors are known, but the underlying mechanisms for the initiation of a migraine attack remain unclear. That NO may be involved in the initiation of migraine attacks is emphasized by the ability of NO donors to induce a migraine attack in migraineurs occurring on average 5.5 h after the infusion (12). Applying this migraine model to the rat, a dural neurogenic inflammation including macrophagal iNOS protein expression 4, 6 and 10 h after the infusion was detected (24). Although stress is the most common trigger of migraine attacks, only limited insight into the link between stress and migraine has been acheived (1, 2). Consequently, the aim of the present study was to examine the relation between a mild non-traumatic stress and NOS expression in the migraine-relevant tissues dura mater and pia mater.

Contrary to our expectations, rat dural iNOS expression was not significantly altered by stress. Increased iNOS expression has been reported in rat cortex after 6 h of immobilization stress (20). Furthermore, during acute immobilization stress (30 min) dural mast cells are activated and release proinflammatory mediators (25). Equally, pial iNOS expression was not affected by air stress, implying that iNOS is not involved in the stress response in the investigated tissues.

Still, eNOS protein expression was significantly increased in rat dura mater (including the middle meningeal artery and its branches) 1, 2 and 3 h after air stress exposure, while the corresponding mRNA expression was not significantly increased until 3 h after air stress. It is possible that the transiently increased eNOS protein expression could be due to a translational regulation mechanism or a decrease in eNOS protein breakdown. A translational regulation of eNOS has been described previously, where a 70% increase in protein expression was found in endothelial cells 2 h after hypoxia, although the detected eNOS mRNA level remained unaltered (26). A decrease in eNOS protein degradation has been demonstrated in endothelial cells, where high-density lipoprotein increased the amount of eNOS protein by 250% solely by increasing the protein half-life from approximately 81 to 270 min (27). In rat pia mater, eNOS mRNA expression was significantly increased 30 min after air stress, followed by a significantly increased protein expression 2 and 4 h after stress. That the human organism's response to stress involves eNOS is demonstrated in a human study, where release of NO was found to be involved in the forearm vasodilator response to mental stress (28).

Air stress treatment had no significant effect on dural nNOS mRNA and protein expression. In rat pia mater, however, nNOS mRNA was significantly increased 30 min after air stress which preceded a significant increase in nNOS protein detected 2 h after stress. It has previously been demonstrated that nNOS expression can be affected by stress as an increased nNOS protein expression was detected in the rat pituitary and hypothalamus after 6 h of immobilization stress (21).

Measurements of plasma corticosterone levels showed a significant increase in air-stressed rats, indicating that the animals reacted to the treatment with an adequate stress response. A slight habituation to air stress occurred as the corticosterone response declined after the first day. Rats are known to adapt to repeated stress exposure, resulting in a decrease in measured plasma corticosterone levels after the first day (29). Since the corticosterone level was highest after 1 day of stress, it may seem to be the best day for examining NOS expression. This possibility was not tested in the present study. We tried to model the human situation, where stress has been reported to occur after one to four repeated days with increased incidence of daily hassles and, based on this information, 3 days of repeated mild stress seemed an appropriate animal stress model (3–6).

Interestingly, there seemed to be low responders and high responders to air stress. An individual difference between rats in the response to stress has been described previously (29). Male Sprague-Dawley rats (an outbred strain like the Wistar rats used in the present study) displayed individual differences towards exposure to immobilization stress (1 h). The increase in plasma corticotropin (ACTH) and corticosterone was significantly higher in the high-response group immediately after and also post stress when compared with the low-response group (29). It may be speculated whether the occurrence of low and high responders explains the somewhat high variation in NOS expression found after stress in the present study.

In our hands, treatment with the 5-HT_1B/D agonist sumatriptan did not attenuate the increased eNOS and nNOS protein expression in stressed rats. Triptans have been demonstrated to act at several migraine-relevant sites, but which of the several mechanisms is responsible for aborting migraine pain remains uncertain. Experiments have demonstrated that triptans act to constrict meningeal blood vessels via activation of 5-HT_1B receptors located on smooth muscle cells (30), inhibit the release of calcitonin gene-related peptide (CGRP) from trigeminovascular nerves (31), and in case of blood–brain barrier disruption, triptans could inhibit nociceptive transmission within the brain stem trigeminal nucleus caudalis (TNC) by preventing sensory neurotransmitter release (32, 33).

The sumatriptan dose used in the current study was 0.3 mg/kg i.p., a dose able completely to block CGRP release as well as dural neurogenic inflammation in rats (34). In a recent study, pretreatment with 0.6 mg/kg s.c. sumatriptan did not attenuate the increased nNOS expression seen in TNC 4 h after administration of high-dose GTN (10 mg/kg s.c.) (35). In a similar study, however, sumatriptan pretreatment (0.4 mg/kg i.v.) succeeded in attenuating the increased nNOS expression seen in the perivascular nerve fibres, trigeminal ganglia and TNC 1 h after infusion of high-dose GTN (10 mg/kg i.v.) to rats (36). These contradictory results indicate that timing and the manner of drug administration may influence the findings. In the present study, sumatriptan was administered after the stress exposure, which was based on acute migraine treatment, where sumatriptan has little efficacy if it is taken at the time of the aura, i.e. before the headache phase (37). Furthermore, in man, s.c. sumatriptan is effective within 1 h after administration (38, 39). Therefore, the 2 h between sumatriptan administration and sacrifice of the rats should be adequate for the drug to affect the increase in NOS expression. The lack of effect on the stress-induced increase in eNOS and nNOS expression indicates that the increase in expression of eNOS and nNOS is located upstream to the site of action of sumatriptan. Another possibility is that the increased expression is not directly linked to the pathway leading to migraine pain.

It has been reported that migraineurs have an increased basal NO production, as evidenced by the significantly increased nitrite and nitrate levels in the plasma of migraine patients outside of attacks (40, 41). It can be speculated whether the NO-cGMP hyperactivity predisposes migraineurs to attacks and thus the increased NOS expression seen as a response to stress may act to aggravate the abnormality. Migraineurs are known to be genetically predisposed towards migraine, meaning that their condition unfortunately cannot be mimicked in either rats or healthy volunteers. It is to be hoped that in future, the nature of these predisposing factors will be revealed and thus the link between these factors and migraine-triggering stimuli such as stress will be clarified.

In conclusion, we have for the first time shown that air stress causes an increase in eNOS expression in rat dura and pia mater. Furthermore, an increased level of nNOS was found in rat pia mater after air stress. In contrast, no change in iNOS expression could be observed. Treatment with the migraine drug sumatriptan had no influence on the stress-induced increase in NOS expression. Thus, the role of the present findings in relation to migraine pathophysiology remains unclear.

Footnotes

Acknowledgements

The authors are deeply indebted to Kenneth Beri Plough MSc for excellent technical assistance and to statistician Lene Theil Skovgaard for her assistance with the statistical analysis. This work is supported by the Danish Medical Research Council (grant no. 9902883), the Lundbeck Foundation and the Hede Nielsen Foundation.

References

Robbins

. Precipitating factors in migraine: a retrospective review of 494 patients. Headache 1994; 34: 214–6.

Spierings

Ranke

Honkoop

. Precipitating and aggravating factors of migraine versus tension-type headache. Headache 2001; 41: 554–8.

Levor

Cohen

Naliboff

McArthur

Heuser

. Psychosocial precursors and correlates of migraine headache. J Consult Clin Psychol 1986; 54: 347–53.

Spierings

Sorbi

Haimowitz

Tellegen

. Changes in daily hassles, mood, and sleep in the 2 days before a migraine headache. Clin J Pain 1996; 12: 38–42.

Sorbi

Maassen

Spierings

. A time series analysis of daily hassles and mood changes in the 3 days before the migraine attack. Behav Med 1996; 22: 103–13.

Kohler

Haimerl

. Daily stress as a trigger of migraine attacks: results of thirteen single-subject studies. J Consult Clin Psychol 1990; 58: 870–2.

Thomsen

Olesen

. Nitric oxide theory of migraine. Clin Neurosci 1998; 5: 28–33.

Forstermann

Boissel

Kleinert

. Expressional control of the ‘constitutive’ isoforms of nitric oxide synthase (NOS I and NOS III). FASEB J 1998; 12: 773–90.

Park

Krishna

. Constitutive expression and structural diversity of inducible isoform of nitric oxide synthase in human tissues. Life Sci 1996; 59: 219–25.

10.

Park

Krishna

Ahn

Kang

Chung

Kim

Differential and constitutive expression of neuronal, inducible, and endothelial nitric oxide synthase mRNAs and proteins in pathologically normal human tissues. Nitric Oxide 2000; 4: 459–71.

11.

Olesen

Iversen

Thomsen

. Nitric oxide supersensitivity: a possible molecular mechanism of migraine pain. Neuroreport 1993; 4: 1027–30.

12.

Thomsen

Kruuse

Iversen

Olesen

. A nitric oxide donor (nitroglycerin) triggers genuine migraine attacks. Eur J Neurol 1994; 1: 73–80.

13.

Ray

Wolff

. Experimental studies on headache. Arch Surg 1940; 41: 813–56.

14.

Nemade

Lewis

Zuccarello

Keller

. Immunohistochemical localization of endothelial nitric oxide synthase in vessels of the dura mater of the Sprague-Dawley rat. Neurosci Lett 1995; 197: 78–80.

15.

Seidel

Stanarius

Wolf

. Differential expression of neuronal and endothelial nitric oxide synthase in blood vessels of the rat brain. Neurosci Lett 1997; 239: 109–12.

16.

Nozaki

Moskowitz

Maynard

Koketsu

Dawson

Bredt

Possible origins and distribution of immunoreactive nitric oxide synthase-containing nerve fibers in cerebral arteries. J Cereb Blood Flow Metab 1993; 13: 70–9.

17.

Stanarius

Seidel

Wolf

. Neuronal nitric oxide synthase in the vasculature of the rat brain: an immunocytochemical study using the tyramide signal amplification technique. J Neurocytol 1998; 27: 731–6.

18.

Edvinsson

Elsas

Suzuki

Shimizu

Lee

. Origin and co-localization of nitric oxide synthase, CGRP, PACAP, and VIP in the cerebral circulation of the rat. Microsc Res Tech 2001; 53: 221–8.

19.

Ramos

Tagliaferro

Lopez-Costa

Lopez

Pecci

Brusco

. Neuronal and inducible nitric oxide synthase immunoreactivity following serotonin depletion. Brain Res 2002; 958: 112–21.

20.

Madrigal

Moro

Lizasoain

Lorenzo

Castrillo

Bosca

Inducible nitric oxide synthase expression in brain cortex after acute restraint stress is regulated by nuclear factor kappaB-mediated mechanisms. J Neurochem 2001; 76: 532–8.

21.

Kishimoto

Tsuchiya

Emson

Nakayama

. Immobilization-induced stress activates neuronal nitric oxide synthase (nNOS) mRNA and protein in hypothalamic–pituitary–adrenal axis in rats. Brain Res 1996; 720: 159–71.

22.

Leza

Salas

Sawicki

Russell

Radomski

. The effects of stress on homeostasis in JCR-LA-cp rats: the role of nitric oxide. J Pharmacol Exp Ther 1998; 286: 1397–403.

23.

Pfaffl

. A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acids Res 2001; 29: e45.

24.

Reuter

Bolay

Jansen-Olesen

Chiarugi

del Rio

Letourneau

Delayed inflammation in rat meninges: implications for migraine pathophysiology. Brain 2001; 124: 2490–502.

25.

Theoharides

Spanos

Pang

Alferes

Ligris

Letourneau

Stress-induced intracranial mast cell degranulation: a corticotropin-releasing hormone-mediated effect. Endocrinology 1995; 136: 5745–50.

26.

Justice

Tanner

Myers

. Endothelial cell regulation of nitric oxide production during hypoxia in coronary microvessels and epicardial arteries. J Cell Physiol 2000; 182: 359–65.

27.

Ramet

Nickerson

Savolainen

Malzone

High-density lipoprotein increases the abundance of eNOS protein in human vascular endothelial cells by increasing its half-life. J Am Coll Cardiol 2003; 41: 2288–97.

28.

Cardillo

Kilcoyne

Quyyumi

Cannon

III Panza

. Role of nitric oxide in the vasodilator response to mental stress in normal subjects. Am J Cardiol 1997; 80: 1070–4.

29.

Marquez

Nadal

Armario

. The hypothalamic–pituitary–adrenal and glucose responses to daily repeated immobilisation stress in rats: individual differences. Neuroscience 2004; 123: 601–12.

30.

Razzaque

Heald

Pickard

Maskell

Beer

Hill

Vasoconstriction in human isolated middle meningeal arteries: determining the contribution of 5-HT1B and 5-HT1F receptor activation. Br J Clin Pharmacol 1999; 47: 75–82.

31.

Buzzi

Moskowitz

. Evidence for 5-HT1B/1D receptors mediating the antimigraine effect of sumatriptan and dihydroergotamine. Cephalalgia 1991; 11: 165–8.

32.

Kaube

Hoskin

Goadsby

. Inhibition by sumatriptan of central trigeminal neurones only after blood–brain barrier disruption. Br J Pharmacol 1993; 109: 788–92.

33.

Cumberbatch

Hill

Hargreaves

. Rizatriptan has central antinociceptive effects against durally evoked responses. Eur J Pharmacol 1997; 328: 37–40.

34.

Limmroth

Katsarava

Liedert

Guehring

Schmitz

Diener

An in vivo rat model to study calcitonin gene related peptide release following activation of the trigeminal vascular system. Pain 2001; 92: 101–6.

35.

Pardutz

Szatmari

Vecsei

Schoenen

. Nitroglycerin-induced nNOS increase in rat trigeminal nucleus caudalis is inhibited by systemic administration of lysine acetylsalicylate but not of sumatriptan. Cephalalgia 2004; 24: 439–45.

36.

Suwattanasophon

Phansuwan-Pujito

Srikiatkhachorn

. 5-HT(1B/1D) serotonin receptor agonist attenuates nitroglycerin-evoked nitric oxide synthase ex-pression in trigeminal pathway. Cephalalgia 2003; 23: 825–32.

37.

Banerjee

Findley

. Sumatriptan in the treatment of acute migraine with aura. Cephalalgia 1992; 12: 39–44.

38.

Cady

Wendt

Kirchner

Sargent

Rothrock

Skaggs

Jr .Treatment of acute migraine with subcutaneous sumatriptan. JAMA 1991; 265: 2831–5.

39.

Gobel

Heinze

Stolze

Heinze-Kuhn

Lindner

. Open-labeled long-term study of the efficacy, safety, and tolerability of subcutaneous sumatriptan in acute migraine treatment. Cephalalgia 1999; 19: 676–83.

40.

D’Amico

Ferraris

Leone

Catania

Carlin

Grazzi

Increased plasma nitrites in migraine and cluster headache patients in interictal period: basal hyperactivity of L-arginine–NO pathway?

Cephalalgia 2002; 22: 33–6.

41.

Martelletti

D’Alo

Stirparo

Rinaldi

Cifone

Giacovazzo

. Modulation of nitric oxide synthase by nitric oxide donor compounds in migraine. Int J Clin Lab Res 1998; 28: 135–9.

Increased Expression of Endothelial and Neuronal Nitric Oxide Synthase In Dura and Pia Mater After Air Stress

Abstract

Keywords

Introduction

Methods

Animals

Air stress protocol

Air stress combined with sumatriptan treatment

Homogenization

Western blot analysis

cDNA synthesis

Real-time PCR

Corticosterone radioimmunoassay

Data analysis

Results

NOS expression in dura mater after air stress

NOS expression in pia mater after air stress

Effects of air stress on plasma corticosterone concentrations

NOS protein expression in dura and pia mater after air stress and sumatriptan treatment

Discussion

Footnotes

Acknowledgements

References