Abstract
Background:
The avian pathogen Salmonella Gallinarum causes avian typhosis in laying hens, leading to high mortality rates among adult birds, which poses a significant problem in the poultry industry. Various products, such as vaccines, antibiotics, probiotics, and disinfectants, are commonly used to prevent and control the disease on farms. An alternative to these products is the use of bacteriophages, which may effectively prevent the colonization of S. Gallinarum.
Materials and Methods:
This study evaluated the safety of SalmoFree®, a bacteriophage cocktail, administered to 276 laying hens from the first week of age until the 28th week. The hens were divided into two groups: a control group (138 birds) and a treatment group (138 birds). Over the 28-week period, eight doses of SalmoFree® (∼1010 UFP per bird) were administered via drinking water in a controlled environment.
Results:
The results indicate that the consumption of SalmoFree® has no adverse effects on bird health or zootechnical parameters. Additionally, there is a trend toward improving weight homogeneity (up to 19%), feed conversion (up to 68%), and egg weight (up to 2.7%). The detection of phages by PCR in cloacal swabs suggests that they persist in birds for 2 to 8 weeks post-ingestion. Furthermore, phages were detected in organs and eggshells, indicating that they provide protection beyond the gut.
Conclusion:
The study demonstrates that SalmoFree® is safe for use in laying hens and may offer additional benefits, such as improved zootechnical parameters and extended protection against S. Gallinarum through the persistence of bacteriophages in the birds.
Introduction
Two main groups of Salmonella are recognized in poultry, the non-host-specific and poultry-host-specific Salmonella serovars. The non-host-specific ones are mainly S. Enteritidis, S. Typhimurium, S. Infantis, and S. Heidelberg. 1 In poultry, these serovars are commensal and can persist in the gastrointestinal tract. They can be asymptomatic, but they have also been associated with diarrhea in young birds. 1 Furthermore, as Salmonella can be found in poultry products such as meat and eggs, they represent a major public health risk as they fall under the category of foodborne diseases. Salmonella is estimated to cause 93.8 million human infections and 155,000 deaths per year worldwide. 2
Poultry-host-specific serovars correspond to Salmonella Gallinarum biov Pullorum and Salmonella Gallinarum biov Gallinarum. These bacteria cause pullorosis and avian typhosis, respectively. Poultry pullorosis can cause up to 100% mortality in the first 3 weeks of age, as well as poor growth and feathering, respiratory distress, among other symptoms.3–6 On the contrary, avian typhosis causes mortality between 10% and 80% and alters birds’ production parameters, reducing egg production, bird fertility, and chick quality 7 ; it can also cause a decrease in feed consumption, respiratory distress, diarrhea, among other symptoms. Adult laying hens are more likely to suffer from avian typhoid than other types of birds. 8 Although these diseases have been eradicated in many developed countries, they continue to cause economic losses in developing countries.
In the poultry industry, both poultry-host-specific serovars and nonspecific ones are of great importance due to their high prevalence, rapid spread, horizontal and vertical transmission, large economic losses, and the emergence of antibiotic-resistant strains of Salmonella.4,5 Therefore, from a production perspective, salmonellosis causes a decrease in poultry productivity in addition to the risk of contamination of poultry products, which represents a major health risk for consumers. 9
A common practice in the management of salmonellosis in poultry has been the use of antibiotics. However, various products are also constantly under evaluation to prevent or control the disease. Among the most used Salmonella control strategies include the use of chemical compounds such as organic acids and chlorine, together with the use of prebiotics, probiotics, vaccines, and others.10,11 Nevertheless, Salmonella control in the poultry industry has not been achieved and remains a challenge nowadays because of the indiscriminate use of antibiotics, emergence of resistance, inadequate immunization, and other limitations.12,13 Consequently, finding new alternatives useful to prevent the appearance of salmonellosis in farms is necessary. One alternative is the use of bacteriophages.
Bacteriophages are biological entities capable of controlling bacterial populations, which have been widely documented as alternatives to antimicrobial use in agriculture industries.14–22 SalmoFree® is a suspension of six bacteriophages effective against a broad spectrum of Salmonella sp. Serovars. 23 This bioproduct is an organic, noninvasive feed additive for poultry that has been previously evaluated in batteries and a commercial setting of broilers. Both studies indicated that the use of the bioproduct is safe for broilers, as no negative effect was observed in the zootechnical parameters measured when comparing the treatment groups with the control groups. In batteries, chickens treated with the cocktail had greater weight homogeneity, and, although not significant, there was better weight gain and feed conversion in the treated group. In the commercial setting, a 70–100% reduction in the presence of Salmonella sp. was demonstrated. 20 Moreover, the introduction of the phage cocktail did not impact the overall microbiota’s structure but did reduce Campylobacter sp. while increasing beneficial bacteria such as Butyricimonas and Rikenellaceae. 24
The present study aims to assess the safety of SalmoFree® bioproduct in laying hens. This marks the first report on the safety evaluation of a phage cocktail administered to laying hens for 28 weeks within a controlled environment, at different stages of the production cycle. The assay included monitoring of production parameters, phage detection, microbiological analysis, as well as serological and histopathological examinations. In summary, this research contributes to the current understanding of the safety and harmlessness of phages. As a result, it contributes to clearing the way for its potential use in poultry production to control salmonellosis. Analyses of this research focus on avian typhosis, which, as previously described, is a disease caused by S. Gallinarum that can result in high mortality in laying hens.
Materials and Methods
Animals
This study was approved by the Research Ethics Committee of Universidad de los Andes, minutes No. 1465 (November 16, 2021) within the framework of Colombian legislation, resolutions 008430/1993 and 105 2378/2008. The study was carried out in a controlled environment at the Agricultural Biotechnology Center (CBA)—SENA, Mosquera, Colombia. A total of 282 one-day-old hens of the Babcock Brown genetic line were purchased from San Marino Poultry Company and evaluated for 28 weeks. During the first week of life, birds were kept together in a conditioning phase to ensure their survival. To this end, they were housed in a 2.5 m × 2.5 m cage with light, wood shavings, drinkers, and feeders. At the end of the conditioning week, the birds were divided into 12 wire cages (23 birds per cage) and placed in 1.40 m × 0.8 m cubicles, where each cage remained until week 6 with access to light, wood shavings, drinkers, and food. Then, in week 7, the cages were enlarged to 1.4 m × 1.4 m and equipped with one bell-type feeder and one bell-type drinker. In week 13, each cubicle was equipped with 6–10 nest boxes of 45 × 50 × 45 cm for egg laying. In all cases, the areas were thoroughly disinfected with a solution of 0.3% iodine and hydrated lime weekly. General breeding conditions and vaccination schedule are described in the supplementary material (Supplementary Tables S1 and S2).
A weekly care and feeding regimen were established to safeguard the overall health of the birds. Routine maintenance included weekly disinfection of the experimental units and daily sanitization of the drinkers using a 0.5% iodine solution. In addition, the water supply tank underwent thorough cleaning every 5 days, with the addition of chlorine (at a final concentration of 0.01%) and acidification with LYNEACID (LYEN, Colombia) at a final concentration of 0.005%. The birds were fed at 8:30 am and 3:00 pm daily, and access to water was provided ad libitum.
Experimental design
Six of the 282 birds were randomly selected for microbiological and histopathological analysis at the end of the first week of the experiment, before the intervention with SalmoFree® phage cocktail. The remaining 276 birds, aged 1 week, were divided into 2 experimental groups with 6 replicates. Each replicate consisted of 23 birds, giving a total of 138 birds in each group. The experimental groups included a phage group where hens received the administration of bacteriophages and a control group where hens did not receive phages. The evaluation of the birds was carried out from the first week until the 28th week of age of the hens, considering zootechnical parameters that are described below, histopathological and serological analyses together with the detection of Salmonella sp. and the bacteriophages that composed the SalmoFree® cocktail (Fig. 1).

Experimental design and samples taken through the safety assessment. Six replicates, each consisting of 23 birds, were evaluated in both the control and phage groups. The grid at the top of the figure shows the production phases used for the analysis. The numbers in the boxes correspond to the bird’s age in weeks. The phage figures indicate the weeks when the phage cocktail was administered. X2 means that two doses of SalmoFree® were administered this week, with a 3-day gap between each one. The sampling moments are also marked with colored squares. The sampling point was 24 h before and/or after the dose.
The phage group was provided with 8 doses of SalmoFree®. Each dose corresponds to the addition of SalmoFree® in a 1:100 ratio of treatment: water, applied to 60% of the daily drinking water, with a final phage concentration of 108 PFU/mL, resulting in a dose of 1010 PFU per bird. The dosing time was ∼3 h. The drinking water supply was suspended 2 h previously to facilitate the uptake of the treatment due to the temporary lack of hydration. The eight doses were given as follows: (1st dose) one at week 2, (2nd dose) one at week 6, (3rd and 4th doses) two at week 14, (5th and 6th doses) two at week 19, and (7th and 8th doses) two at week 24. These double doses were administered with a 3-day interval between each dose (Fig. 1). For all doses, the phage cocktail was prepared in the drinking water on the same day. At each dose, the cocktail was mixed with the birds’ drinking water, according to the appropriate volume for the birds’ weekly water consumption [Babcock Brown Cage Production System guide San Mariano—Poultry Genetics (2009)], as shown in Table 1. The control group received the same amount of water but without bacteriophages.
Amount of SalmoFree® Phage Cocktail and Water Consumption per Bird in Each Dose. Each Replicate Had 23 Birds. Doses Were Delivered in the Drinking Water at a Final Concentration of 2 × 108 FPU/mL
Preparation of phage cocktail SalmoFree®
SalmoFree®, composed of six lytic phages, was prepared according to a standard liquid lysate procedure (Kutter and Sulakvelidze, 2004). The preparation was performed individually for each phage in nutrient broth (Sharlau, Spain), using a multiplicity of infection of 0.01. Each lysate was centrifuged at 4°C for 20 min at 13,000g and the supernatant was filtered through a 0.22 μm filter, yielding ∼500 mL of each phage. The phages were then mixed to form the cocktail, ensuring that each phage had the same concentration (∼2 × 1010 PFU/mL), and stored at 4°C. Before each dose was administered, the viral titer of the cocktail was checked and found to be above 2 × 1010 PFU/mL. In addition, a bacterial growth test was performed before each dose to verify the absence of viable bacteria in the cocktail.
Zootechnical parameters
Starting from the first week of life of the birds and for 28 consecutive weeks, zootechnical parameters were evaluated; (i) body weight was measured at the beginning of the trial and weekly, weighing all birds and calculating the average weight per replicate; (ii) daily feed consumption per bird was measured, weighing the amount of feed consumed by replicate and calculating the average per bird; (iii) feed conversion ratio, calculating the grams of feed consumed during the week divided by grams of weight gained per replicate; (iv) mortality, by counting the number of birds that died; (v) morbidity, counting only birds that were visibly sick; and (vi) the coefficient of variation or uniformity [(standard deviation/mean) × 100] was calculated. Once egg production started, the following parameters were evaluated: (i) number of eggs, (ii) egg weight (weighing all eggs and calculating the average weight per replicate), and (iii) shell thickness (measuring the shell thickness of 10 eggs per replicate). The zootechnical parameters of body weight and feed consumption were compared with the Babcock Brown Cage Production System guide San Mariano—Poultry Genetics. 25
Biological sample collection
Before the initial administration of SalmoFree®, six randomly selected 1-day-old birds were euthanized through the cervical dislocation process to collect various samples, including cloacal swabs, blood, and a pooled sample of spleen and liver organs. The collected samples were carefully placed in a sterile plastic bag (Nasco, Saugerties, NY, USA) and subsequently transported at 4°C for further processing. Microbiological analyses were performed on the collected samples at the Centro de Biotecnología Agropecuaria (CBA-SENA) in Mosquera. In addition, histopathological and serological analyses were conducted at Corpavet (CORPORACION PATOLOGIA VETERINARIA, Bogotá). These samples were stored at −20°C for subsequent processing. During the study, cloacal swabs were collected as follows, with a pool of 10 swabs per replicate in each experimental group: before the 1st, 2nd, 3rd, 5th, and 7th doses and 24 h after the 1st, 4th, and 8th doses for Salmonella and phage detection. Samples for phage detection were not collected after each dose, as previous results have shown that phage detection becomes positive within 24 h after phage consumption. 15 In addition, at weeks 23, 24, and 25, egg samples (pool of 5 eggs per experimental replicate) were collected for microbiological analysis. Finally, at week 26, organ samples (pool of spleen, liver, ovaries, and bone marrow) and blood were collected from 1 bird per replicate for microbiological, histopathological, and serological analyses. For histopathology and organ samples, the euthanasia procedure was carried out for each bird, ensuring bioethical and animal protection principles outlined in Chapter 7.5 (Slaughter of animals) of Terrestrial Animal of the World Organization for Animal Health.
Histopathological and serological analysis
To evaluate the health status of the birds, a histopathological analysis of a pool of organs was conducted before starting the experiment and in week 24. No birds were assessed between the first and 24th weeks, as the number of sacrificed birds was kept to the minimum necessary, in accordance with ethical considerations. The necropsy procedure was performed, evaluating the macroscopic condition of the different systems and organs. The collected tissues were preserved in 10% buffered formalin. The tissue cuts were made according to the pools and sent for histotechnology. Histological sections were obtained and evaluated by white light microscopy.
With the purpose of establishing the exposure of birds to common diseases in poultry farming, serological analyses were conducted using the ELISA method. Blood samples were collected to extract serum. The INDEXX Ab test (INDEXX, USA) was employed for diseases such as Gumboro, Infectious Bronchitis, Newcastle, Mycoplasma gallisepticum, and Mycoplasma synoviae. In addition, to detect antibodies against Salmonella, the Salm Gp B/D test (BioCheck, USA) was utilized.
Salmonella detection
Salmonella isolation protocol was performed as recommended by USP (2021), OIE (2018), and BEIC (2013) for cloacal swabs, organs, and egg samples. For swab samples, the swab placed in 9 mL of peptone water was incubated at 37°C for 24 h for pre-enrichment. For organ samples, they were immediately transferred to 9 mL of peptone water (Scharlau, Spain) and incubated for 24 h at 37°C for pre-enrichment. In parallel, a portion of each organ was taken for direct plating on XLD (Scharlau, Spain) and MCK agar (Scharlau, Spain). For egg samples, eggshells from five eggs per replicate were macerated and pre-enriched in 100 mL of peptone water.
In all cases, 1 mL of the pre-enrichment was transferred to 9 mL of Rappaport broth (Scharlau, Spain) and incubated at 42°C for 24 h. After enrichment, ∼10 µL were plated on XLD agar (Scharlau, Spain) and MacConkey agar (Scharlau, Spain) and incubated at 37°C for 24–48 h. The presumptive motile and nonmotile Salmonella colonies were further examined for biochemical characterization: triple sugar iron (Scharlau, Spain), sulfide indole motility medium (Scharlau, Spain), urease broth, and L-lysine decarboxylation medium (Scharlau, Spain). Finally, an agglutination test with poly A-VI antiserum (BD BBL, USA) was performed on presumptive colonies.
Detection of SalmoFree® bacteriophages
To detect SalmoFree® bacteriophages from swabs, organs, and egg samples, a PCR technique was performed according to Clavijo et al. 15 First, 200 μL or 0.2 g samples were processed for DNA extraction using the DNeasy® Blood and Tissue Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. DNA was measured in a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA) to assess DNA quality. Following this, a fragment of a phage tail fiber protein gene, shared by three of the six phages that composed the cocktail, was amplified using specific primers, GrT/forward (GGATGGACTGGAACCACTTATG) and GrT/reverse (TACCCTGGATACCCTGAATACC). Cycling conditions were set as follows: initial denaturation at 95°C for 3 min, 34 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, followed by a final extension step at 72°C for 7 min. The PCR product was verified through 1.8% agarose gel, which was run for 50 min at 70 V. The presence of a 109 bp DNA band indicated the presence of bacteriophages in the swab, tissue, and eggshell samples.
Permanence of phage in adult birds
To assess the permanence of phages in adult birds following the administration of a phage dose to animals without Salmonella infection, a total of 60 creole hens were evaluated from 18th to 20th week of age. Hens were located on a farm in Sesquilé, undinamarca, under commercial rearing conditions. Animals were divided into two experimental groups (30 birds per group) housed and in an 8 m × 17 m cage with access to light, wood shavings, drinkers, and food. Cages were equipped with three bell-type feeders, three bell-type drinkers, and nesting boxes. The experimental groups were separated by a distance of 8 m. During the study, the farm’s permanent staff carried out maintenance of the houses and animal care. The animals were provided with water and fed ad libitum.
The two experimental groups comprised a phage group where hens received the administration of bacteriophages and a control group where hens did not receive phages. The phage group was provided with one dose of SalmoFree® in the same conditions as it was supplied in the safety assessment. The evaluation during the study period includes the analysis of the detection of the bacteriophages composing the SalmoFree® cocktail from cloacal swab samples. Cloacal swabs were collected as follows: 5 individual swabs were taken randomly from 5 birds in each group 24 h, 1 week, and 2 weeks after phage administration. These samples were stored at 4°C in PBS for subsequent processing for phage detection as previously described.
Statistical analysis
To determine significant differences in the zootechnical parameters between experimental groups and production phases [prestart phase (weeks 1–4), start phase (weeks 5–9), rearing phase (weeks 10–16), prelaying phase (weeks 17–22), laying phase (weeks 23–28)], a Student’s t-test was used with a significance level of 95% (p < 0.05). To assess the significance in the homogeneity coefficients, Levene’s test was used with a significance level of 95% (p < 0.05). Statistical analyses were conducted using the R Project software R Core Team. 26
Results
The aim of this study was to determine the safety of the phage cocktail SalmoFree® in laying hens and its effects on zootechnical parameters. The birds received SalmoFree in their drinking water in 8 doses from the second to the 24th week of age (Fig. 1). For 28 weeks, body weight, feed consumption, coefficient of variation, mortality, morbidity, feed conversion ratio, egg production, and egg weight were recorded. Detection of Salmonella and phage was performed from cloacal swabs (pool of 10 swabs per replicate), organs (1 bird per replicate), and eggshells (pool of 20 eggs per replicate).
Zootechnical parameters
During the 28-week trial, no birds died or showed signs of illness. The body weight between the experimental groups, control, and phage group showed the same behavior (Fig. 2A), and no statistical differences were observed (p > 0.05). However, in the egg production phases (prelaying and laying), we observed a trend toward a lower coefficient of variation in body weight in the phage group (Fig. 2C). There were also no statistical differences in feed consumption (p > 0.05) (Fig. 2A). Nevertheless, lower feed consumption was observed in the phage group during some weeks of laying (Fig. 2A). The feed conversion ratio in the phage group was similar to that of the control group in all production phases (p > 0.05) (Fig. 2B), but again a trend toward a lower coefficient of variation in the phage group was observed in the feed conversion ratio during the egg production phases (Fig. 2C).

Zootechnical parameters.
Regarding egg production, no statistical differences (p > 0.05) were observed between groups for number of eggs, egg weight (Fig. 3A), or eggshell thickness (Fig. 3B) during weeks 23–28. However, after week 24, a tendency toward heavier eggs became evident in the phage group (Fig. 3A). Given that no differences in eggshell thickness were observed (Fig. 3B), the increase in egg weight could be attributed to a higher egg content.

Egg production parameters.
In summary, these results affirmed the safety of the phage cocktail, as its administration to laying hens demonstrated no adverse effects on the normal growth, behavior, or egg production of the animals.
Histopathological and serological analysis
In the histopathological analysis carried out on 1-day-old birds, no microscopic lesions related to any condition or pathological entity were observed. At 26 weeks, no clinical changes suggestive of a health problem were detected in any birds of the phage group. However, in three of the six replicates of the control group, mild inflammatory changes were found in the liver tissue of some birds, together with mild enteritis and alterations associated with intestinal dysbacteriosis.
No seropositivity for Salmonella, Mycoplasma gallisepticum, and Mycoplasma synoviae was found in the serological analysis of 1-day-old and 26-week-old birds. The birds were positive for Gumboro, Infectious Bronchitis, and Newcastle at 1 day of age and 26 weeks of age (Supplementary Table S3).
Detection of Salmonella and SalmoFree® Bacteriophages
The detection of Salmonella was performed to ensure that the consumption of Salmonella bacteriophages did not result in bacterial contamination, thereby ensuring the safety conditions of the experiment. Salmonella spp. were not detected in any sample type (cloacal swab, organ, eggshell) in either the control or phage group throughout the experiment.
Regarding phage detection, there was no amplification of the phage tail gene in any wab or pool organ sample prior to the first dose of SalmoFree®, indicating no detection of the phages that compose SalmoFree®. The amplification product appeared 24 h after the first dose of SalmoFree® in all swabs and in two of the six organ pools tested in the phage group. Phages were also detected before the 3rd dose in both the control and phage groups, although more phage-positive samples were found in the treated group (Fig. 4). In the eggshell, all replicates were positive at weeks 23, 24, and 25 in the phage group, whereas in the control group, phage detection in the eggshell was positive only after week 25 (after 8th dose) (Fig. 4).

Heat map for phage detection in cloacal swabs, organ pool (liver, spleen, ovaries, and bone marrow), and eggshell. The phage figure indicates the week in which SalmoFree was administrated in the phage group. No phages were delivered to the animals in the control group. The intensity of the blue color shows the incidence of phage (number of replicates positive for phage detection by PCR method).
As we observed that in birds older than 18 weeks, the detection of phages in cloacal swabs decreased 5 weeks after the SalmoFree® dose, we evaluated the persistence of phages in cloacal swabs of 18-week-old birds after SalmoFree® consumption. SalmoFree® phages were detected 24 h, 1 week, and 2 weeks after phage administration (Table 2). Again, phages were detected in the control after the phage consumption in phage group. In this case, the control and phage groups were separated by a distance of 8 m.
Phage Detection by PCR in Cloacal Swabs of 18-Week-Old Birds After SalmoFree® Administration Number of Positive Samples Out of the Sample Size for Amplification of the Tail Fiber Protein Phage Gene at Each Time Point
Discussion
Safety studies for feed or feed supplements are conducted to evaluate the safety of a product and to ensure that what is fed to farm animals is safe and does not represent a risk to animal health. The objective of this study is to evaluate the safety of the phage-based product, SalmoFree®, in laying hens from the first weeks of life to 28th week. To the best of our knowledge, this is the first safety report conducted for such a long period. This product has already been evaluated in broilers. The patent for this product (Patent No. WO/2017/089947) mentions its safety in broilers as well as its ability to improve zootechnical parameters such as weight homogeneity and feed conversion ratio. Likewise, SalmoFree® has already been tested in commercial broiler farms. 20 The phage mixture was shown to be effective in reducing Salmonella spp. Load in poultry and, in turn, showed a positive modulation of the gut microbiota. 24
During the development of the safety study conducted in laying hens, no morbidity was observed in any of the birds, in either the control group or the phage-treated group. Mortality of two birds was observed in replicates of the control group. In addition, histopathological analyses confirmed the good health status of the birds prior to the start of phage administration and at 26 weeks of age at the end of treatments in agreement with the macroscopic and microscopic findings observed. Furthermore, the serological results (Supplementary Table S3) showed positivity only for Newcastle, Bronchitis, and Gumboro. This is consistent with expectations, considering that the birds did not exhibit any signs of disease and were vaccinated against these diseases. Altogether, it indicates that the administration of phages in the drinking water, initiated in the second week of life, has no adverse effect on the health of birds. Moreover, the negative result for Salmonella in serology suggests that the consumption of the phage cocktail in drinking water does not interfere with seropositivity, even though the phage suspension may contain bacterial cellular debris.
Regarding the zootechnical parameters, no statistically significant differences were found among the experimental groups in parameters such as body weight, feed conversion ratio, and number of eggs produced. It is worth pointing out that greater homogeneity in body weight, feed conversion ratio (Fig. 2C), and egg weight (Fig. A) was observed in the phage-treated group during the productive stages of prelaying and laying hens. Thus, no negative dose–response pattern was observed during the 28-week follow-up in laying hens, and on the contrary, it was observed that the phage-treated group had more homogeneous zootechnical parameters in the egg production phases, with a trend toward higher egg weight (Fig. 3). Previous studies have evaluated the effect of phage consumption on egg production and egg quality. In 2012, Zhao and coworkers administered Salmonella phages in the diet of two hundred eighty-eight 36-week-old Hy-Line Brown hens for 6 weeks. In the results, they observed that groups treated with phages increased their egg production with statistical significance, although they did not observe changes in egg weight. It was also observed that the Haugh unit, which is a measure of egg protein quality based on egg white height, was higher at weeks 4 and 5 in the groups that consumed higher concentrations of phages. 27 On the contrary, Kim et al. 28 fed phages in the diet to 360 Hy-Line Brown birds at 32 weeks of age for 8 weeks, while Lee et al. 29 fed phages in the diet to 32 Hy-Line Brown layers (40-week-old) for 14 days. They did not find differences in egg quality or production. The reported studies as well as the results presented in this study demonstrate that experimental conditions, bird health, the phages used in the study, the route of administration, and the frequency of administration are factors that can influence the effect of phage consumption on zootechnical parameters. In our case, the phages were not fed every day, but in 5 different weeks (weeks 2, 6, 14, 19, 24) until the birds were 24 weeks old, as shown in Figure 1. With the dosing schedule used, a positive effect on zootechnical production parameters was observed, although it was not statistically significant.
Since SalmoFree® product is intended to prevent the colonization of Salmonella spp., the procedure was carried out to look for this bacterium, both motile and nonmotile serotypes, in all the samples. None of the samples isolated bacteria with morphologies associated with Salmonella, which is a good indicator of the health of the birds. The absence of Salmonella isolates is consistent with the histopathological and serological results (Supplementary Table S3), which showed no evidence of bacterial infection associated with Salmonella spp.
For phage detection in cloacal swabs, organs, and eggshells, results showed phage contamination in the control group despite biosecurity measures and physical barriers used to prevent contamination. Contamination of the control group was also evident in the assay performed by Clavijo et al. 20 Phages, as nanoparticles, are difficult to control and contain as they move between barns, as they can move through air particles, feathers, dust, and more. The differences observed in the zootechnical parameters between the experimental groups may be less marked due to the phage contamination in the control group. However, the conclusion on the safety of phages in laying hens supplied with phages from the first weeks of life to the laying phase is not affected. This is because neither the health nor the zootechnical parameters of the two experimental groups were negatively affected during the course of the study.
Results of bacteriophage detection (Fig. 4) also showed that phages can be detected in bird feces (cloacal swab samples) from 2 to 8 weeks after phage ingestion, depending on the age of the birds. Phages were detected in cloacal swab samples from the first dose in the treated group. Considering that Salmonella was not isolated during the study and that there was no evidence of symptoms related to avian salmonellosis, it can be concluded that the persistence of the phages in the bird’s organism is not related to the replication of the phages in the bird. Likewise, the persistence of the phages in the bird allows one to know the period of protection that the phages provide in the bird and thus to have an idea of how often doses should be given in a phage application scheme to prevent avian salmonellosis. In birds younger than 18 weeks, the persistence of phages is 4 or more weeks, but in birds older than 18 weeks, it is 2 weeks. This result is probably related to physiological changes in the birds prior to laying.
In addition, the detection of phages in organs indicates that these viruses can cross the intestinal mucosa and reach internal organs, whereas Salmonella Gallinarum normally causes infections and tissue damage in birds. Clavijo et al. in 2022 detected SalmoFree® phages in gastrointestinal organs such as the cecum. 20 Other researchers, such as Adhikari et al., 30 Hosseindoust et al., 31 Thanki et al., 32 and Lee et al., 29 when studying Salmonella spp.-infected birds, although they did not directly detect phages in internal organs, observed a significant reduction in the amount of Salmonella spp. after phage administration through the feed. This reduction was observed in organs such as the liver, ovary, and spleen. The reduction of Salmonella in internal organs was associated with the presence of phages in these organs. In the mentioned cases, the birds were infected with the pathogen, which facilitated the multiplication of the phages and increased the probability that they would pass through the intestinal mucosa and reach the internal organs. In the present study, the birds were not infected with the pathogen. In fact, no Salmonella spp. isolates were ever detected. However, phages were found in the organ pool, including ovaries, bone marrow, liver, and spleen. This finding demonstrates that even in the absence of the pathogen, phages can cross the intestinal barrier and reach internal organs, thus protecting birds from Salmonella spp. colonization beyond the intestine.
Finally, the presence of phages in eggshells suggests that ingestion of these viruses by birds may provide protection at the egg surface, preventing replication of Salmonella serovars that can cause disease in humans when eggs are consumed.
Conclusions
The data obtained from the evaluation and monitoring of the birds during the 28 weeks of the trial demonstrate the safety and innocuousness of SalmoFree® in laying hens. The results obtained in the evaluation of the production parameters during the 28 weeks show that the consumption of the bacteriophages that make up the cocktail does not have a negative effect on the health of the birds or the zootechnical parameters. On the contrary, there is a tendency to improve weight homogeneity, feed conversion, and egg weight.
The detection of phages in cloacal swabs indicates that the phages remain in the bird for 2–8 weeks after ingestion. In addition, phages can be detected in organs, providing protection in the bird not only at the gut level but also in other internal organs. Phages are also detected in the eggshell, which can help prevent Salmonella from replicating on the egg surface, resulting in a safer product for the consumer.
Footnotes
Acknowledgments
This work was supported by the Ministry of Science, Technology, and Innovation (MINCIENCIAS), Gobernación de Cundinamarca and Sistema General de Regalias (SGR), Colombia (grant number:
Authors’ Contributions
S.H.V.: Conceptualization, methodology, validation, formal analysis, investigation, data curation, writing—original draft preparation, visualization, supervision, project administration, and funding acquisition. J.A.B.: Methodology, validation, formal analysis, investigation, data curation, and writing—original draft preparation. Á.H.J.: Conceptualization, methodology, validation, formal analysis, investigation, and data curation. R.P.: Methodology and formal analysis. A.R.: Methodology and formal analysis. L.F.: Methodology. K.R.: Methodology. M.J.V.: Methodology, validation, formal analysis, writing—review and editing, and funding acquisition. P.B.: Methodology, validation, writing—review and editing, and funding acquisition. V.C.: Conceptualization, methodology, validation, formal analysis, writing—review and editing, supervision, project administration, and funding acquisition.
Author Disclosure Statement
V.C. serves as the CEO of Sciphage SAS, a biotechnology company specializing in bacteriophage-based products. Similarly, S.H.V. holds the position of CTO at Sciphage SAS, while M.J.V. serves as a cofounder of the company. Given their roles within Sciphage SAS, there exists a potential conflict of interest regarding the discussion of bacteriophage-related topics.
Funding Information
This work was supported by the Ministry of Science, Technology and Innovation (MINCIENCIAS), Gobernación de Cundinamarca and Sistema General de Regalias (SGR), Colombia [grant number: 2021000100317] and by the Facultad de Ciencias, Universidad de los Andes, INV-2022-136-2383 for funding the 18-week bird trial conducted in the municipality of Sesquilé.
References
Supplementary Material
Please find the following supplemental material available below.
For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.
For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.
