Sage Journals: Discover world-class research

Abstract

Risk assessments of genetically modified animals include evaluating animal health and whether food products are safe and nutritious. We gathered empirical data on the health, growth, and nutritional composition of animal products from six offspring of a genome-edited (GnEd) bull homozygous for the dominant P_C POLLED allele. These offspring did not differ in their growth, health, or development compared with controls. All nutrient values in the meat from control and GnEd offspring fell within the range found in beef databases. Milk composition varied within controls, between control and GnEd offspring, and over time; however, all values except sulfur percentage were within peer-reviewed literature ranges. Both meat and milk composition are influenced by breed, nutrition, parity, and days in milk. These data suggest that regulatory product composition studies should be hypothesis driven, risk based, and be prompted by novel product hazards hypothesized to result from any biochemical pathways targeted by the intended alteration.

Introduction

Horns on cattle are a safety concern to both animals and their human handlers,¹ but current high-producing dairy breeds consist of livestock that are nearly all horned. Disbudding dairy cows at birth is a routine procedure that also has animal welfare concerns,¹ but introducing the dominant polled (hornless) trait into the dairy population by crossbreeding would also introduce nonproductive traits by linkage drag.² The fastest and most effective way to introduce the POLLED allele would be by genome editing (GnEd) elite dairy bulls.²

However, without acceptance of the milk and meat from these animals into the human food chain, this approach will not be feasible. We hypothesized that the offspring of a dairy bull that was GnEd to be homozygous POLLED would be healthy and produce milk and meat products that would be safe to eat, and nutritionally comparable with analogous products derived from conventional cattle sold and eaten every day.

The Codex Guideline for the conduct of food safety assessment of foods derived from recombinant-deoxyribonucleic acid (DNA) animals³ recommends evaluations of food product composition and animal health as essential components of the overall approach to ensure the safety of food derived from recombinant-DNA (rDNA) animals. A “recombinant-DNA animal” is defined as “an animal in which the genetic material has been changed through in vitro nucleic acid techniques, including recombinant deoxyribonucleic acid (DNA) and direct injection of nucleic acid into cells or organelles.”

In undertaking these evaluations, it is important to compare the health status of the rDNA animal with the health status of the appropriate conventional counterpart. This means animals with a known history of safe use as food grown under equivalent, or as close as possible, husbandry conditions including gender, parity, and lactation stage as the rDNA animals.⁴ Ideally, these conventional comparators should be of a similar genetic background to the progenitors of the rDNA animals.

In addition, it is important to know the range or variation in key nutritional components of the food product produced by the rDNA animal to provide an appropriate context to determine the significance of any differences between conventional comparators and rDNA animals. Unlike the International Life Sciences Institute Crop Composition Database that contains data obtained from studies conducted over a number of years at worldwide locations,^5–7 there is no analogous database for animal source food composition.

Moreover, plant sources of food can contain endogenous components and antinutrients that, when present in high concentrations, can be toxic to humans and animals,⁸ whereas animal products do not typically contain such compounds and are, therefore, not routinely subjected to extensive compositional analyses.⁴ Health status has proven to be a reliable indicator of animal product safety, and is used in combination with other ante- and postmortem inspections to determine that healthy food from animals produced through conventional breeding is safe to eat.

The overall goal of this project was to provide empirical data on the development, health, and nutritional composition of animal products derived from the six offspring of a GnEd dairy bull homozygous for the dominant P_C Celtic POLLED allele,⁹ as a companion article to our earlier study on the genomic and polled phenotypic analyses of these calves.¹⁰ In addition to comparing the nutritional composition of milk and meat from these offspring with contemporary conventional comparators, we also compiled compositional data on selected raw beef cuts (shoulder and rump) from global databases to document the range of naturally occurring nutritional variation in these muscles.

As previously reported,¹⁰ four of the six calves carried an integrated copy of the pCR™2.1 plasmid (Invitrogen, Waltham, MA) backbone in the P_C allele they inherited from their GnEd sire. We also examined whether the prokaryote promoter that drives the expression of the bacterial gene for ampicillin resistance (bla) and kanamycin/neomycin resistance (neo) in pCR2.1 resulted in the expression of these genes in the muscle of cattle. Finally, in the absence of an identified safety hazard, we examined the rationale and value of requiring compositional data of food derived from rDNA animals and contemporary comparator controls to satisfy regulatory agency standards.

Results

Growth

Cattle that inherited a POLLED allele from the GnEd bull (n = 6) showed no differences in their overall growth when compared with contemporary controls (n = 3–10; Fig. 1).

FIG. 1.

Weights of heterozygous hornless offspring of a genome-edited (GnEd) bull (RC; n = 5–6) compared with contemporary horned Hereford (HH) and Hereford × Holstein (HO1) controls (n = 3–10). Data are the weights of each animal with means ± SD. ^a,b,c,dDifferent letters indicate significant differences (p < 0.0001). Images of a control (HO1.calf1) bull, and an offspring of the GnEd bull (RC.calf2), captured just before slaughter.

Blood chemistry and hematology

The blood chemistry (Table 1) and hematology (Table 2) values were within normal reference intervals for the age of the cattle for both control and offspring of the GnEd bull except creatine kinase in both groups at ∼12 months of age. There were effects of age on 12 of the hematology and 14 of the blood chemistry measurements, effects of genotype on 6 of the hematology and 2 of the blood chemistry measurements, and interactions between age and genotype on 6 of the hematology and 6 of the blood chemistry measurements (p < 0.05; Tables 1 and 2).

Table 1.

Blood chemistry for control and offspring of the genome-edited bull in blood drawn at three time points

	∼1 week old			∼8 months old			∼12 months old			Age, p	GEN, p	Age × GEN, p	Cow, pe	Within literature range?
	CON, mean (SD)	GnEd, mean (SD)	Literature range	CON, mean (SD)	GnEd, mean (SD)	Literature range	CON, mean (SD)	GnEd, mean (SD)	Literature range	Age, p	GEN, p	Age × GEN, p	Cow, pe	Within literature range?
Age (days)	11 (9)	9 (2)		263 (14)	250 (2)		387 (57)	377 (2)
AG (mmol/L)	21.0 (1.6)	19.2 (1.2)	13–26	22.0 (2.0)	20.8 (1.2)	13–26	23.5 (1.0)	25.0 (3.2)	13–26	^****	NS	^*	NS	Yes
Na (mmol/L)	140.2 (3.4)	142.2 (1.7)	132–153	140.5 (1.9)	141.7 (1.2)	134–146	142.4 (2.0)	141.5 (1.9)	134–146	NS	NS	NS	NS	Yes
K (mmol/L)	5.6 (0.4)	5.6 (0.3)	3.67–6.2	4.8 (0.3)	4.6 (0.4)	3.8–5.9	4.5 (0.4)	4.9 (0.3)	3.8–5.9	^****	NS	^*	NS	Yes
Cl (mmol/L)	96.3 (2.6)	97.5 (1.0)	91–106	97.8 (2.7)	97.8 (1.3)	92–109	97.0 (2.1)	97.0 (2.1)	92–109	NS	NS	NS	NS	Yes
Bicarb (mmol/L)	28.7 (1.8)	31.0 (1.5)^*	23.9–38.7	25.6 (1.5)	27.7 (1.4)	22–32	26.5 (1.7)	24.5 (2.5)	22–32	^****	NS	^**	NS	Yes
P (mg/dL)	8.8 (1.1)	8.9 (0.9)	6.1–12.7	8.1 (0.6)	7.9 (0.9)	4.1–8.1	8.0 (1.7)	7.9 (0.6)	4.1–8.4	^*	NS	NS	NS	Yes
Ca (mg/dL)	11.0 (0.5)	11.2 (0.5)	4.4–14.3	9.9 (0.4)	10.2 (0.2)	8.9–11.2	9.8 (0.4)	9.7 (0.3)	8.9–10.9	^****	NS	NS	NS	Yes
BUN (mg/dL)	7.1 (2.4)	8.3 (3.7)	6.3–33	12.7 (7.5)	6.0 (1.4)^*	3.6–19	15.8 (3.3)	8.0 (1.8)^***	7–19	^*	^**	^*	NS	Yes
CR (mg/dL)	1.0 (0.1)	0.8 (0.1)	0.4–2.1	1.0 (0.3)	1.2 (0.1)	0.4–1.6	1.0 (0.2)	1.0 (0.1)	0.4–1.8	^**	NS	^*	NS	Yes
GLU (mg/dL)	108.8 (9.1)	107.7 (11.6)	54–234	82.0 (11.5)	82.2 (7.7)	40–119	84.9 (11.8)	51.0 (9.4)^****	56–105 (down to 25 at 10 months)	^****	^**	^****	NS	Yes
TP (g/dL)	6.3 (1.0)	5.8 (0.6)	3.8–7.4	6.6 (0.4)	6.8 (0.3)	6.2–7.4	6.9 (0.4)	6.8 (0.2)	6.4–8.8	^**	NS	NS	NS	Yes
ALB (g/dL)	2.9 (0.4)	2.8 (0.2)	2.5–3.5	3.6 (0.2)	3.6 (0.1)	2.9–4.1	3.6 (0.2)	3.3 (0.2)^*	3.1–4.4	^****	NS	NS	NS	Yes
GLOB (g/dL)	3.4 (1.2)	3.0 (0.7)	0.3–4.1	3.1 (0.4)	3.2 (0.3)	2.8–5.4	3.3 (0.3)	3.5 (0.3)	2.8–5.4	NS	NS	NS	NS	Yes
AST (IU/L)	47.5 (13.2)	42.2 (6.2)	0–134	72.4 (9.8)	69.0 (14.4)	50–160	74.4 (15.1)	86.2 (44.1)	50–173	^****	NS	NS	NS	Yes
CK (IU/L)	279 (411)	126 (107)	25–591	278 (93)	394 (324)	66–292 (408 at 6 months and 508 at 10 months)	605 (668)	1,457 (2,984)	66–292	^**	NS	NS	NS	No-both high (12 months)
ALP (IU/L)	319 (147)	326 (129)	19–632.2	115 (25)	140 (32)	53–294	136.7 (43.1)	113 (23)	24–447	^****	NS	NS	^*	Yes
GGT (IU/L)	142 (170)	84 (54)	12–3,170	11.8 (3.3)	11.2 (1.7)	10–54	15.2 (5.4)	15.7 (1.0)	10–54	^****	NS	NS	^*	Yes
BIL (mg/dL)	0.2 (0.2)	0.1 (0.1)	0–2.5	0 (0)	0 (0)	0–0.2	0 (0.1)	0 (0)	0–0.6	NS	NS	NS	NS	Yes
SDH-37 (IU/L)	8.6 (3.5)	9.7 (3.4)	4–48	9.9 (4.4)	15.0 (10.0)	4–48	9.5 (4.2)	13.0 (4.1)	4–48	NS	NS	NS	^**	Yes

p < 0.05; ^**p < 0.01; ^***p < 0.001; ^****p < 0.0001.

AG, anion gap; ALB, albumin; ALP, alkaline phosphatase; AST, aspartate aminotransferase; Bicarb, bicarbonate; BIL, bilirubin total; BUN, blood urea nitrogen; CK, creatine kinase; CON, control; CR, creatinine; GEN, genotype; GGT, gamma-glutamyl transferase; GLOB, globulin; GLU, glucose; GnEd, genome-edited; NS, not significant; SDH-37, sorbitol dehydrogenase; TP, total protein.

Table 2.

Hematology values for control and offspring of the genome-edited bull in blood drawn at three time points

	∼1 week old			∼8 months old			∼12 months old			AGE, p	GEN, p	AGE × GEN, p	Cow, p	Within literature range?
	CON, mean (SD)	GnEd, mean (SD)	Literature range	CON, mean (SD)	GnEd, mean (SD)	Literature range	CON, mean (SD)	GnEd, mean (SD)	Literature range	AGE, p	GEN, p	AGE × GEN, p	Cow, p	Within literature range?
Age (days)	11 (9)	9 (2)		263 (14)	250 (2)		387 (57)	377 (2)
RBC (M/μL)	8.4 (1.1)	8.1 (0.7)	5.2–10.6	8.3 (1.0)	8.9 (0.3)	4.9–10	8.0 (0.9)	7.5 (0.9)^*	4.9–10	^*	NS	NS	^*	yes
HGB (g/dL)	10.4 (1.2)	10.2 (1.0)	5.7–13.6	11.1 (1.3)	11.5 (0.7)	8.4–14	11.9 (1.5)	10.3 (0.9)	8.4–14	^*	NS	^*	^*	yes
HCT (%)	31.3 (3.5)	30.8 (2.9)	17.0–39.8	30.2 (3.7)	30.9 (2.2)	21–38	32.0 (4.0)	28.2 (2.7)	21–38	NS	NS	NS	NS	yes
MCV (fL)	37.8 (4.2)	37.9 (1.4)	28.7–41.2	36.4 (2.4)	34.8 (2.8)	32.1–65	40.0 (2.3)	37.4 (2.0)	36–65	^***	NS	NS	^**	yes
MCH (pg)	12.6 (1.3)	12.6 (0.5)	10.1–14.2	13.4 (0.9)	13.0 (1.0)	11–19	14.9 (0.8)	13.7 (0.8)	11–19	^****	NS	NS	^***	yes
MCHC (g/dL)	33.4 (0.8)	33.2 (0.4)	30–38	36.8 (0.3)	37.3 (0.4)	31–39	37.1 (0.4)	36.6 (0.7)	31–39	^****	NS	^*	NS	yes
RDW (%)	21.8 (2.4)	20.1 (1.7)	19–28	20.7 (1.9)	19.6 (0.6)	15–21	20.5 (1.4)	19.4 (1.1)	15–21	NS	^*	NS	NS	yes
WBC, × 10⁻³/μL	7.1 (1.9)	9.0 (1.6)	3.8–19.6	10.3 (4.2)	11.2 (2.2)	4.9–14	9.7 (1.7)	11.7 (1.7)	4.9–14	^**	NS	NS	^**	yes
N, × 10⁻³/μL	2.9 (1.9)	3.7 (0.9)	0.8–14.4	2.3 (1.6)	3.1 (0.5)	1.0–7.2	2.4 (0.7)	3.7 (1.1)	1.0–7.2	NS	^*	NS	NS	yes
L, × 10⁻³/μL	3.5 (1.8)	3.8 (0.9)	1.4–8.2	7.6 (2.7)	7.4 (1.9)	1.6–8.1	6.7 (1.6)	7.2 (2.1)	1.6–8.1	^****	NS	NS	^*	yes
M/μL	370 (171)	1,065 (254)^*	10–1,250	171 (65)	282 (86)	0–900	267 (174)	226 (62)	0–900	^****	^****	^****	NS	yes
E/μL	51 (50)	15 (37)	0–1,190	109 (54)	206 (90)	0–1,300	269 (129)	397 (194)	0–1,300	^****	NS	^*	NS	yes
B/μL	70 (19)	170 (33)^*	10–220	104 (42)	130 (45)	0–300	97 (18)	113 (17)	0–300	NS	^***	^***	NS	yes
P, × 10⁻3/μL	779 (231)	884 (108)	214–1,251	623 (211)	423 (151)	160–800	459 (128)	615 (181)	160–800	^****	NS	^*	N/A	yes
MPV (fL)	6.2 (0.4)	5.9 (0.2)	5.4–11.6	6.6 (0.4)	7.5 (1.6)	4.5–8.0	6.8 (1.0)	7.9 (1.6)	4.5–8.0	^**	NS	NS	NS	yes
Plas prot (g/dL)	6.6 (0.8)	6.3 (0.5)	4.3–8.3	6.8 (0.4)	7.0 (0.3)	5.9–8.5	7.1 (0.3)	7.0 (0.2)	5.9–8.5	^*	NS	NS	NS	yes
Plas fibr (mg/dL)	370 (82)	483 (75)	300–700	430 (106)	433 (151)	100–700	430 (125)	467 (103)	100–700	NS	NS	NS	NS	yes

p < 0.05; ^**p < 0.01; ^***p < 0.001; ^****p < 0.0001.

B, basophils; E, eosinophils; fibr, fibrinogen; GEN, genotype; HCT, hematocrit; HGB, hemoglobin; L, lymphocytes; M, monocytes; MCH, mean corpuscular hemaglobin; MCHC, MCH concentration; MCV, mean corpuscular volume; MPV, mean platelet volume; N, neutrophils; N/A, unbalanced data set, could not do repeated measure analysis; NS, not significant; P, platelets; Plas, plasma; prot, protein; RBC, red blood cells; RDW, red cell distribution width; WBC, white blood cells.

There were also effects of cow-to-cow variation on six of the hematology and three of the blood chemistry measurements (p < 0.05; Tables 1 and 2). Comparing control with GnEd offspring within each time point, there were significant differences at a single time point for red blood cells, monocytes, basophils, bicarbonate, glucose, and albumin, and significant differences at two time points for blood urea nitrogen (GnEd lower at both ∼8 and ∼12 months) (p < 0.05; Table 1).

Breeding soundness

A breeding soundness examination was performed on the five male polled offspring (RC.calves2–6) and five control male offspring (HO1.calves1&3, HH.calves3–5). Four of the five polled bulls were satisfactory potential breeders. One produced semen with good motility (75%) and few abnormal sperm (10%), but his right testicle was undescended. Four of the five control bulls were rated satisfactory potential breeders. One had three attempts to produce satisfactory semen (ranging from 451 to 528 days of age) but each time had >60% abnormally shaped sperm, so a classification was deferred.

The female polled offspring of the GnEd bull (RC.calf1) produced a normal healthy male calf from natural mating with a horned Hereford bull. This offspring was a homozygous HORNED bull, or a null segregant, as determined by polymerase chain reaction (PCR) of his genomic DNA (gDNA) extracted from whole blood (data not shown). The calf died unexpectedly at 4 weeks of age that unfortunately resulted in agalactia in RC.calf1. A necropsy determined the cause of his death was sepsis.

Meat composition

All nutrient values for sirloin cap, chuck arm, and tri-tip collected from polled offspring of the GnEd bull, the GnEd bull itself, and control comparator offspring were within the range of values found in the literature for raw beef composition across 37 countries (Table 3). When we compared the various nutrient levels with those in the control comparator offspring (proximate analyses are in Fig. 2), only one, vitamin B₁₂, was lower (p < 0.05) in the meat from the offspring of the GnEd bull compared with controls, whereas 11 amino acids were found to be in higher (p < 0.05) concentration in the meat from the offspring of the GnEd bull compared with controls (Table 3).

FIG. 2.

Proximate analysis of sirloin cap and chuck arm from horned HerefordxHolstein controls (HO1.calves1–3; n = 6), sirloin cap and chuck arm from polled offspring of the genome-edited dairy bull (RC.calves1–6; n = 12) and tritip from the genome-edited bull (n = 1). (A) Ash, (B) protein, and (C) crude fat. Data are individual meat samples with means ± SD.

Table 3.

Nutrient analysis of sirloin cap and chuck arm from horned Hereford × Holstein controls (HO1.calves1–3; n = 4–6), sirloin cap and chuck arm from polled offspring of the genome-edited dairy bull (RC.calves1–6; n = 8–12) and tritip from the genome-edited bull (n = 1), and values from international nutrient databases (n = 148–350)

	Control, mean (SD)	GnEd, mean (SD)	GnEd/control	Literature mean	Literature range	Within literature range?
Proximate analysis
Ash (%)	1.03 (0.08)	1.05 (0.04)	1.02	1.02	0.1–2.62	Yes
Protein (%)	20.4 (1.05)	21.2 (0.77)	1.04	20.5	11.0–29.8	Yes
Crude fat (%)	3.31 (1.88)	2.88 (1.9)	0.87	8.64	0.5–42.5	Yes
Vitamins
Riboflavin (mg/100 g)	0.20 (0.04)	0.17 (0.04)	0.85	0.17	0.04–0.80	Yes
Niacin (mg/100 g)	5.34 (0.09)	5.94 (0.93)	1.11	4.71	0.91–7.5	Yes
Vitamin B₆ (mg/100 g)	0.26 (0.09)	0.37 (0.09)	1.42	0.38	0.010–0.73	Yes
Vitamin B₁₂ (mg/100 g)	3.67 (0.93)	2.32 (0.81)^a	0.63	2.22	0.19–7.0	Yes
Minerals
Iron (%)	0.0027 (0.008)	0.0022 (0.0003)	0.81	0.0021	0.0007–0.005	Yes
Phosphorus (%)	0.18 (0.013)	0.18 (0.009)	1.00	0.185	0.09–0.37	Yes
Zinc (ppm)	54.8 (10.3)	51.3 (12.2)	0.94	47.1	10–98.5	Yes
Amino acids
Alanine (%)	1.14 (0.08)	1.23 (0.04)	1.08	1.20	0.78–1.72	Yes
Arginine (%)	1.24 (0.05)	1.33 (0.05)^a	1.07	1.32	0.77–1.97	Yes
Aspartic acid (%)	1.79 (0.07)	1.94 (0.06)^a	1.08	1.85	1.3–2.66	Yes
Cystine (%)	0.23 (0.02)	0.25 (0.02)	1.09	0.23	0.12–0.40	Yes
Glutamic acid (%)	3.11 (0.06)	3.26 (0.13)^a	1.05	3.17	2.00–4.46	Yes
Glycine (%)	0.90 (0.12)	0.95 (0.08)	1.06	1.04	0.57–1.63	Yes
Histidine (%)	0.65 (0.09)	0.77 (0.07)	1.18	0.70	0.50–1.11	Yes
Isoleucine (%)	0.90 (0.05)	0.98 (0.04)^a	1.09	0.925	0.61–1.29	Yes
Leucine (%)	1.61 (0.05)	1.72 (0.06)^a	1.07	1.66	1.10–2.37	Yes
Lysine (%)	1.80 (0.10)	1.96 (0.09)^a	1.09	1.76	1.14–2.66	Yes
Methionine (%)	0.55 (0.05)	0.60 (0.04)	1.09	0.57	0.36–0.985	Yes
Phenylalanine (%)	0.79 (0.03)	0.85 (0.03)^a	1.08	0.81	0.54–1.17	Yes
Proline (%)	0.81 (0.08)	0.86 (0.07)	1.06	0.86	0.52–1.24	Yes
Serine (%)	0.76 (0.02)	0.81 (0.03)^a	1.07	0.805	0.53–1.12	Yes
Threonine (%)	0.89 (0.03)	0.96 (0.03)^a	1.08	0.88	0.60–1.28	Yes
Tryptophan (%)	0.26 (0.01)	0.28 (0.01)	1.08	0.22	0.12–0.31	Yes
Tyrosine (%)	0.69 (0.02)	0.72 (0.03)^a	1.04	0.71	0.44–1.03	Yes
Valine (%)	0.94 (0.06)	1.03 (0.04)^a	1.10	0.99	0.65–1.41	Yes

p < 0.05 compared with control cattle.

When the offspring of the GnEd bull and control comparator offspring nutrient levels were compared with the average of published values, the control meat was significantly different from published values in fat (p = 0.0071; Supplementary Fig. S2), iron (p = 0.0115; Supplementary Fig. S4), and vitamin B₁₂ (p = 0.0039; Supplementary Fig. S4), whereas the polled offspring of the GnEd bull meat was significantly different from published values in fat (p < 0.0001; Supplementary Fig. S2), tryptophan (p < 0.0001; Supplementary Fig. S3), and niacin (p = 0.009; Supplementary Fig. S4).

Milk composition

The nutrient values for milk collected from the single heifer offspring of the GnEd bull (RC.calf1) and four control cows (HH.calves1–2, HO1.calf2, #3113) were all within the range of values found in the literature for whole milk, except S (Table 4). When we compared the nutrient levels between RC.calf1 and the control comparators, there were significant differences for true protein %, casein %, Ca %, P %, Mg %, and S %, where RC.calf1 milk had higher levels of all of these nutrients.

Table 4.

Nutrient analysis of whole milk from four control cows (n = 69–81), and one offspring of the genome-edited bull (n = 16–19) with values from the literature

	Control, mean (SD)	GnEd offspring, mean (SD)	GnEd offspring/control	Literature range	Within literature range?
Proximate analysis
True protein (%)	3.33 (0.39)	4.29 (0.55)^****	1.29	1.83–4.95	Yes
Fat (%)	2.44 (1.86)	3.54 (2.1)	1.45	2.3–6.6	Yes
Lactose (%)	4.79 (0.37)	4.69 (0.40)	0.98	3.51–6.22	Yes
Casein (%)	2.63 (0.41)	3.52 (0.42)^****	1.34	1.53–4.15	Yes
Minerals
Calcium (%)	0.11 (0.03)	0.14 (0.01)^****	0.79	0.058–0.25	Yes
Phosphorus (%)	0.09 (0.01)	0.12 (0.02)^****	1.33	0.067–0.16	Yes
Magnesium (%)	0.010 (0.001)	0.012 (0.001)^****	1.20	0.002–0.027	Yes
Sodium (%)	0.061 (0.04)	0.054 (0.03)	0.89	0.012–0.09	Yes
Sulfur (%)	0.038 (0.004)	0.051 (0.006)^****	1.34	0.017–0.046^a	No-GnEd is high
Chloride (%)	0.12 (0.04)	0.12 (0.05)	1.00	0.067–0.15	Yes

%Sulfur values are from both the literature and calculated from the range of % true protein.

****

p < 0.0001.

There were also significant differences between individual cows (p < 0.0001; Fig. 3; Supplementary Fig. S5) for all nutrients measured (fat %, true protein %, lactose %, casein %, Ca %, P %, Mg %, Na %, S %, and Cl %). Nutrient levels also varied significantly from week to week (Fig. 4 and Supplementary Fig. S6) for % true protein (p < 0.0001), % fat (p < 0.05), % casein (p < 0.0001), % Ca (p < 0.05), % P (p < 0.002), % Mg (p < 0.0001), and % S (p < 0.01).

FIG. 3.

Milk composition analysis of individual quarter and/or pooled milk samples (n = 17–22/animal) from a heterozygous hornless heifer from a genome-edited bull (RC.calf1) compared with horned Hereford × Holstein (HO1), Hereford (HH), and polled Angus × Hereford (#3113) contemporary controls (n = 5) collected from weeks 1–7 of lactation. ^a,b,cLetters indicate significant differences between animals (p < 0.05).

FIG. 4.

Antibiotic residues in meat and milk

Four of the offspring (RC.calves1, 4, 5, 6) inherited an integrated copy of the pCR2.1 plasmid backbone from their GnEd sire. This plasmid backbone encodes a bacterial gene for ampicillin resistance (bla) and a bacterial gene for kanamycin/neomycin resistance (neo). We examined one of these animals (RC.calf1) and her contemporary control (HO1.calf2) for evidence of antibiotic residues in their meat and milk. The levels of aminoglycoside antibiotics (including kanamycin) and β-lactam antibiotics (including ampicillin) in the meat and milk of these two cows were below detection limits (as specified in the Materials and Methods section).

Antibiotic resistance gene expression in meat

We also examined whether the prokaryote promoter in pCR2.1 that is designed to express neo and bla genes in bacteria resulted in expression of these genes in the muscle of cattle carrying pCR2.1 in their genome. We extracted RNA from muscle tissue of the six polled offspring of the GnEd bull (RC.calves1–6) and three contemporary controls (HO1.calves1–3), DNase treated the RNA and used reverse transcription-PCR to detect expression product of the bacterial genes bla and neo. All muscle samples expressed a similar amount of EEF1A2 mRNA, a housekeeping gene (Supplementary Fig. S7).

We detected low levels of expression of bla mRNA in five of the nine meat samples, RC.calf1 and 5 (polled offspring with the plasmid), RC.calf3 (polled offspring without the plasmid), and HO1.calf1 and 2 (comparator controls) (Supplementary Fig. S7). Likewise neo mRNA expression was detected in meat from three animals, RC.calf1 and 4 (polled offspring with the plasmid), and HO1.calf1 (comparator control). We concluded that the low level of expression of bla and neo found in the muscle RNA was due to low level contamination with bacteria carrying common antibiotic resistance genes. Ninety-five percent (20/21) of the bla and neo cDNA (17/18 clones) and gDNA (3/3 PCR products) sequences differed by 1–7 bp from that of pCR2.1 (data not shown).

The rate of single nucleotide polymorphism (SNP) detection in cloned products was 33 SNPs/14,604 bp. We amplified and cloned bla and neo from RC.calf1 gDNA under the same PCR conditions and found that 6/10 clones each had at least 1 bp error, at a rate of 8 errors/8,015 bp. By extrapolation, we predict that 18/33 SNPs across 18 clones (14,604 bp) were accurate and 15/33 were due to GoTaq errors.

Discussion

Animal health evaluations

The Codex Guideline³ suggests that the health evaluation for rDNA animals should include general health and performance indicators, including behavior, growth and development, general anatomy, and reproductive function, if appropriate; and physiological measures including clinical and analytical parameters. In addition to phenotyping for the intended trait of hornlessness, we measured growth, blood chemistry and hematology, and reproductive function. Every calf underwent a complete physical examination at ∼1 week, 8 months, and 1 year of age.

Cattle that inherited a POLLED allele from a cloned GnEd bull, including the four (RC.calves1, 4, 5, 6) that inherited a copy of the pCR2.1 plasmid backbone in addition to the POLLED allele, had no differences in their growth, overall health, or fertility when compared with contemporary controls. The GnEd offspring and contemporary controls had blood chemistry measures that were within the normal literature range except creatine kinase in both groups at ∼12 months of age.

A few measures of blood chemistry and blood cell counts differed between the offspring of the GnEd bull and contemporary controls at different time points, but never consistently across all three time point measurements. Others have examined similar hematological parameters in the offspring of genetically modified cows that express human lactoferrin proteins in their mammary gland, and no differences were observed between six lactoferrin transgenic bulls and three wild-type comparator control bulls.¹¹

Food safety evaluations

For the food safety evaluation, the Codex Guideline³ suggests that analyses of concentrations of key components of the rDNA animal and, especially those typical of the food, should be compared with an equivalent analysis of a conventional counterpart grown and bred under the same husbandry conditions. The stated purpose of this comparison is to establish that substances that are nutritionally important, or that can affect the safety of the food, have not been altered in a manner that would have an adverse impact on human health.

Key nutrients are defined as “those components in a particular food that may have a substantial impact in the overall diet. They may be major constituents (fats, proteins and carbohydrates as nutrients, or enzyme inhibitors as anti-nutrients) or minor compounds (minerals, vitamins).” The guidance states that “the statistical significance of any observed differences should be assessed in the context of the range of natural variations for that parameter to determine its biological significance.”

In discussions with the FDA regarding these GnEd animals, it was communicated that if GnEd animals were to enter the food supply, it would be necessary to provide a nutritional compositional analysis of edible muscle tissues of the investigational animals including key nutrients, and that this should be compared with equivalent analysis of a conventional counterpart. This analysis should focus on muscle, but, if available, could also include data on liver, kidney, and fat.

In addition, information regarding the composition of milk from the heifer was requested if there was an intent for the milk from lactating dairy cows to enter the food supply. Any additional available information that would help with a human food safety evaluation (e.g., any feeding studies performed) or information from the literature was additionally deemed useful, but that such information should be limited to animals edited at the P_C Celtic POLLED allele, and not be from animals produced through conventional breeding.

We performed a proximate analysis (moisture, protein, fat, carbohydrate, and ash) on the meat, milk component analysis on the milk (butterfat, true protein, lactose, total solids, freezing point depression, and casein), plus minerals (Fe, Zn in meat; P in meat and milk; Na, Cl, S, Ca, Mg in milk), vitamins B₂, B₃, B₆, and B₁₂ (in meat), and amino acids (in meat). We analyzed individual meat samples from all six offspring of the GnEd bull and conventional comparators and milk from the one female offspring and conventional comparator controls, and also collated milk and meat compositonal data from various sources to provide information regarding statistical significance of any observed differences related to natural variation.

Meat and milk compositional analyses

All nutrient values in the meat from controls and the offspring of the GnEd bull fell within the ranges for conventional beef as documented in the literature. Cattle that inherited a POLLED allele from the GnEd bull showed no differences in proximate analytes (Fig. 2) when compared with contemporary controls; however, there were minor differences in the concentration of vitamin B₁₂ and several amino acid concentrations when comparing the meat of the offspring of the GnEd bull with contemporary controls (Table 3).

As these values were well within the range of natural variation, they are unlikely to be biologically significant. Bovine meat and milk composition is known to be influenced by husbandry conditions, breed, gender, nutrition, parity, and days in milk, making it difficult to obtain appropriate comparators in experiments with a limited number of GnEd animals. The Codex Guideline³ recognizes this problem stating that “it should be acknowledged that, particularly in the case of certain animal species, the available number of samples may be limited and there is likely to be large variation between animals, even those bred and raised under the same husbandry conditions.”

We saw effects of both the individual cow and the stage of lactation on milk compositional analytes. The protein percentage in the milk produced by RC.calf1 was higher than that produced by the four control cows, whereas #3113 had multiple milk parameters that were significantly different from those of all other cows. Different breeds produce milk of different compositions and the milk composition also changes during lactation.¹² For example, Holsteins have >7% true protein at day 3 of lactation that drops to 2.82% at day 30 of lactation. This is a more extreme difference than changes in milk protein we measured in RC.calf1 from day 7 (4.44% true protein) to day 30 (3.47% true protein) of lactation.

The elevated percentages of casein, Ca, P, Mg, and S in the milk from the polled RC.calf1 heifer are at least partially explained by the higher protein levels seen in her milk. Casein makes up 76–78% of the total protein in milk,¹³ and the S content in milk is also determined by the amount of milk protein that includes the S amino acids methionine and cysteine. Similarly, the percentages of Ca, P, and Mg are all correlated with the protein content of milk.¹⁴ One of the issues with our milk data is that we only had a single GnEd female offspring of the GnEd bull (RC.calf1) to work with, and milk composition is known to vary considerably between individuals. In addition, we did not have a large number of appropriate comparator controls available.

The FDA's legal standard of identity of milk is “the lacteal secretion, practically free of colostrum, obtained by the complete milking of one or more healthy cows.” It is further stipulated that milk that is in final package form for beverage use must “contain not less than 8.25% milk solids, not fat and not less than 3.25% milkfat.” Similarly, for the Australian and New Zealand governments, a food that is sold as cow's milk must be milk from cows and contain no less than 32 g/kg of milkfat, and contain no less than 30 g/kg of true protein.¹⁵

By these standards, both the offspring of the GnEd bull and contemporary controls produced some milk samples that were nonsalable when analyzed on an individual quarter basis (Fig. 3), but in practice, the milk that is in final package form for beverage use is mixed together in bulk from a large number of animals and adjusted to meet these nutrient specifications. Similarly, the requirements for bovine meat being sold in Australia/New Zealand are that meat flesh consists of skeletal muscle and any attached animal ride, fat, connective tissue, nerve, blood, or blood vessels.¹⁶ Nutritionally, dried meat is required to be <15% water and ≥16% protein. All of our raw meat samples from GnEd animals contained at least 20% protein when fully hydrated (at least 68.8% moisture).

Two genetically engineered (GE) animals have so far been approved for food use in the United States, the AquAdvantage GE salmon first reported in 1992,¹⁷ and GalSafe^® pigs first described in 2003.¹⁸ The compositional analysis for approval of the salmon included tissue samples from a total of 73 salmon analyzed for proximates, minerals, vitamins, amino acids, and fatty acid content. In those analyses, the average value for each analyte derived from 30 diploid and triploid GE (“treated,” TX) fish was compared with 33 Atlantic Salmon contemporary controls (“sponsor control,” SC) raised alongside the TX fish, and 10 non-GE diploid and triploid farmed Atlantic salmon (“farm control,” FC) from commercial farms in Maine and Canada.

It was determined that if the results were SC ≤ TX ≤ FC, the results for TX salmon were considered to be similar to “control salmon” (SC and FC salmon) results. If the mean for the TX salmon fell outside the range of either the SC or FC group, the minimum and maximum values (extreme values) for the TX salmon were compared with the range of values from the SC and FC salmon. If these extreme values from the TX salmon did not fall outside the range of values from the SC and FC salmon, the results for TX salmon were considered to be similar to “control salmon” results.

If TX salmon were not considered similar to “control salmon,” individual values were then compared, and if the individual values for the TX salmon were not more than 10% beyond the range of values for the individual “control salmon,” the values for the TX salmon were considered to be within normal biological variability and thus similar to the “control salmon.”¹⁹

Using an analogous rationale, all of the milk or meat compositional data we obtained from the six offspring of the GnEd hornless bull were within normal biological variability and thus similar to the control cattle data with the exception of milk S %, where some of the contemporary controls and many of the milk samples from the single polled female offspring had a higher S % than was observed in the literature. This may be methodological as very few actual calculations of milk S % are published and we had to calculate milk S % from published milk protein values. In our methods, we justify our calculated ratio of true protein–S to be 108.6 g/g.

Other publications have calculated ratio of true protein–S to be 129.9 g/g based on using different values both for nonprotein nitrogen in milk and for the methionine and cysteine composition of milk protein.²⁰ Our actual measurements found the true protein–S ratio to be exactly the same in the milk from both the contemporary control group (n = 70) and the milk from the polled offspring of a GnEd bull (n = 19): 84.0 g/g (SD 5.6) and 83.7 g/g (SD 3.9), respectively. So although the average S % we found for the polled offspring of a GnEd bull was marginally higher than the literature range, this can justifiably be considered to result from the elevated % true protein in the milk.

We calculate that there is actually 3.78 g methionine/100 g crude protein (CP) and 1.26 g cysteine/100 g CP in cow's milk, rather than 2.97 g/100 g CP and 0.94 g/100 g CP, respectively, as measured by Pieniaźek et al.,²¹ given that methionine is 21.8% S and cystine is 23.7% S, and the ratio of methionine to cystine in cow's milk is 3:1.²² Our finding of elevated milk S % compared with actual or calculated literature values does not raise any nutritional or other safety concerns regarding human consumption of this milk, and in fact almost certainly reflects an elevated protein concentration in these milk samples.

Recently, the FDA concluded that there was a reasonable certainty of no harm for human consumers of food from GalSafe pigs after nutrient analysis of a single pooled tenderloin sample per group. These pooled samples comprised meat from at least three litters of homozygous (n = 5) and hemizygous (n = 5) GalSafe pigs, along with conventional comparator contemporary control pigs. Samples were pooled by genotype and analyzed for 93 different analytes, including moisture, protein, fat, ash, calories, carbohydrates, dietary fiber, fatty acid profile, mineral profile, selenium, cholesterol, sugar profile, vitamin profile, and amino acid profile.

A freedom of information request summary available on the FDA website stated, “Most values fell within 20% of reference values for raw pork tenderloin from the National Nutrient Database for Standard Reference available from the USDA (USDA, FoodData Central). Of the 19 values reported to be >20% different from the USDA database, only three values (Total Trans Fat %, Saturated Fatty Acid [C12:0], and Niacin) had a >20% difference between GalSafe pigs and the comparator pigs. These values were 23.8%, 22.4%, and 23.3% different from the comparator control pigs, respectively, suggesting that the differences were due to either the small sample size, husbandry/feeding practices, or the processing of the samples. Additionally, the live weight for three of the five GalSafe pigs at slaughter was greater than the average live weight of typically marketed pigs, which may explain the higher fat/fatty acid content.”

Based on these data, it was determined that there were no toxicological or nutritional hazards to humans consuming the GalSafe edible tissues.²³ In the current experiment, some of our values differed by >20% from the comparator controls (Tables 3 and 4); however, this was not always statistically significant, and was within the range reported in the literature except for the milk S % as previously discussed.

An indiscriminate requirement to peform a nutritional compositional analysis of edible products including “key components of the recombinant-DNA animal and, especially those typical of the food” as outlined in the Codex Guideline³ for traits like polled that are not designed or expected to impact meat and milk composition provides little useful data to inform food safety assessments. In addition, in the absence of any criteria to determine which key components in animal products pose a human food safety hazard, and at what levels of increase or decrease (i.e., effect size), it is not possible to perform sample size calculations.

Value versus expense of comparator controls

Given the expense and difficulty of obtaining appropriate comparators in experiments with a limited number of GnEd animals, it is worth considering the value of generating contemporary comparator data. It costs ∼$1,500 per year to feed and maintain one animal at the UC Davis beef facility. Meat nutritional analysis cost $948 per sample for our full analysis (proximate analysis, 18 amino acids, Fe, Zn, P, riboflavin, niacin, and vitamins B₆ and B₁₂), which does not include all compositional analytes that could be analyzed in meat (e.g., additional minerals and vitamins plus a fatty acid analysis).

Our milk analysis cost $42 per sample in the United States, but the equivalent testing in Australia, for example, was priced out at $500 per sample (for lactose, butterfat, true protein, casein, Ca, Na, P, Mg, S, and Cl). If there is a statistical difference in compositional analytes between the GnEd animals and conventional comparators, but all of the values lie within those located in the literature or standard database reference values, this difference is not likely to be a nutritional hazard.

The generation and maintenance of conventional comparators are expensive and impracticable, if not an unfeasible undertaking for experiments in which no conventional comparators are routinely being produced or raised (e.g., nonedited animals of the same genotype). In our experiment, we intentionally produced and raised three control horned Holstein bull × horned Hereford calves to serve as conventional comparators, one of which was female (HO1.calf2). Although meat from these comparator animals was able to be sold at the end of the experiment to help defray their expenses, as distinct from the offspring of the GnEd bull that cannot enter the food supply under U.S. regulations, this approach adds significant expense to GnEd animal experiments, especially with large livestock species.

It is also at odds with the guiding principles of the three Rs of animal experimentation (i.e., replacement, reduction, and refinement), which calls for a reduction in the number of animals used in research to the minimum needed without meaningfully diminishing the amount and quality of information gleaned from experiment.²⁴

It has been proposed that the compositional assessment of GE organisms should follow a stepwise approach to determine what, if any, compositional data generation is necessary.²⁵ If traits are designed to affect or regulate biochemical pathways and cascades, hypothesis-driven compositional studies looking at affected pathways might well be warranted.⁸ The list of compositional analytes that pose a potential human food safety hazard should be based on a hypothesis generated by the nature of the trait being introduced.²⁶ Experiments can then be designed to measure the appropriate key nutrients to test that specific hypothesis.

Antibiotic resistance genes in food

In the case of the GalSafe pig, the FDA identified the nptII gene (also known as the neo gene), as a potential human food safety hazard. This gene encodes the aminoglycoside-3′-phosphotransferase enzyme under the control of an α1,3-galactosyltransferase promoter in the pPL657 rDNA construct in the GalSafe pig genome. The nptII gene is already widely distributed among soil and enteric bacteria, and confers resistance to aminoglycoside antibiotics (e.g., kanamycin, neomycin, geneticin) that have no or only limited therapeutic relevance in human and veterinary medicine.²⁷

One safety stipulation was that these pigs be raised without the use of aminoglycosides to treat bacterial infections. The producers of GalSafe pigs are also required to collect, isolate, and test bacteria collected during different life stages of the GalSafe pigs to monitor for development of resistance to aminoglycosides.²³ Horizontal gene transfer from the genome of the GalSafe pigs to their microflora in the absence of a transposable element or a transfer vector organism²⁸ is highly unlikely.

In this study, we assayed milk and meat samples for antibiotic residues, and meat samples for the expression of antibiotic resistance genes. This was done in part due to our previous publication detailing that four of the six polled offspring of a GnEd bull (RC.calves1, 4, 5, 6) inherited a copy of the pCR2.1 plasmid backbone in addition to the POLLED allele.¹⁰ The integrated plasmid sequence includes two bacterial antimicrobial resistance genes: one for β-lactam resistance (bla) and the other for kanamycin/neomycin (aminoglycoside) resistance (neo) under the control of a prokaryotic promoter to facilitate growth and selection of the plasmid in bacteria.

However, these analyses were also done in part to address confusing reports after the publication of a preprint,²⁹ after which numerous sources claimed that these cattle would contribute to the development of antibiotic resistant bacteria.^30–34 One article³⁵ even went so far as to erroneously claim that a Cas9-expressing plasmid had been introduced, “sparing the scientists the complexities of dealing with unstable protein.”

The Codex Guideline³ states, “Gene transfer from animals and their food products to gut microorganisms or human cells is considered a rare possibility because of the many complex and unlikely events that would need to occur consecutively. Nevertheless, the possibility of such events cannot be completely discounted.” The latter statement is qualified with regard to food containing antibiotic resistance markers by adding, “In cases where there are high levels of naturally occurring bacteria which are resistant to the antibiotic, the likelihood of such bacteria transferring this resistance to other bacteria will be orders of magnitude higher than the likelihood of transfer between ingested foods and bacteria.” The genetic basis for antibiotic resistance was present long before the introduction of antibiotics.³⁶

In assessing whether antibiotic resistance marker genes represent a potential human food safety hazard, the Codex Guideline³ recommends considering whether the antibiotic resistance genes are already widely distributed among soil and enteric bacteria, and the clinical and veterinary use and importance of the antibiotic in question.²⁷ The β-lactam and aminoglycosides are two classes of antibiotics for which resistance genes are widespread among many bacterial species.³⁷

The bla gene is widespread in enterobacterial genera such as Escherichia, Haemophilus, Neisseria, and Salmonella, and confers resistance to β-lactam antibiotics (e.g., ampicillin, penicillin G, and amoxycillin) that are used for therapy only in defined areas of human medicine, although they are used extensively in livestock and equine medicine. And as discussed earlier with regard to the nptII (or neo) gene, aminoglycoside antibiotics have no or only limited therapeutic relevance in human and veterinary medicine,²⁷ being used mostly in equine medicine.

None of the animals in the study were treated with any antibiotics during their lifetime, and unsurprisingly we could not detect any antibiotic residues in milk or meat from either RC.calf1 or contemporary comparator HO1.calf2. Both bla and neo mRNA were occasionally detected in meat samples from both control and polled offspring of the GnEd bull with and without the plasmid in their genome. Almost all (95%) of the bla and neo cDNA sequences that were cloned from these meat samples had polymorphisms ranging from one to seven as compared with the reported sequence of these genes in the pCR2.1 plasmid (data not shown), presumably derived from naturally occurring bacteria on the meat samples carrying these widespread antibiotic resistance genes. This rate of SNPs detected was 2.3-fold higher than the rate of proofreading error due to Taq polymerase.

Antibiotic resistant bacteria have been detected on meat samples from multiple species in other studies including raw chicken,^38,39 pork,⁴⁰ beef, and turkey.⁴¹ A recent study examined the level and types of antibiotic resistance found in the oral bacteria of humans eating meat or other animal products as compared with humans on a vegan diet (for at least a year before the study was undertaken), and no differences between the groups were observed.⁴²

Hazard identification and food safety assessments

The data presented in this study and our earlier report¹⁰ provide the types of data suggested by the Codex Guideline.³ Similar to rDNA plants, core molecular studies characterizing the nature of the alteration and presence of unintended plasmid sequences should be evaluated as a routine part of food safety assessments as was done in our studies. In the past decade, after the editing of the cell line that produced the original founder GnEd polled bull,⁴³ there have been many advancements in GnEd including the increased use of ssDNA repair templates,⁴⁴ which obviates the need for the use of a donor plasmid. This effectively precludes the possibility of integration of donor plasmid sequences in the end product.

If a novel protein is expressed in GnEd animals, then protein characterization and hazard identification encompassing toxicity and allergenicity should be performed on the resulting food products as a part of the core protein characterization studies for food safety assessments. It has been proposed²⁶ that additional studies should only be required when a food safety hazard is identified in the first set of core molecular and protein characterization studies.²⁵ And furthermore, that problem formulation should be employed to design hypothesis-driven supplementary studies that should only be performed to characterize hazard and exposure when a hazard is identified. Both hazard identification and exposure are required to calculate the potential risks, if any, posed by GnEd animals.

Conclusions

In the case of the P_C Celtic POLLED allele, there are no novel expressed substances or expression products to assess for toxicity, bioactivity, and allergenicity; nor was there any biological reason to hypothesize that the polled phenotype would have major impacts on the composition of milk and meat. The health and product compositional data we collected for a 2 year period suggested that the six polled offspring of the GnEd bull were healthy, and products derived from them were nutritionally similar to contemporary comparator cattle and within the norms of known biological variability.

In the absence of any biologically plausible hypothesis for an adverse effect resulting from the P_C Celtic POLLED allele substitution, measuring a catalog of compositional analytes does not provide useful information to inform food safety assessments, given the well-established background compositional variation known to exist in milk and meat.

The Bigger Picture

This study required considerable time and resources to investigate the health and product composition of milk and meat from the offspring of a GnEd bull. The empirical findings of this study lend support to the proposal that product compositional data from GnEd animals should only be required by regulatory agencies if a hazard has been identified. We propose that risk assessment studies on products from GnEd animals should be based on the hypothesized path to harm based on this hazard, and designed so that consumer exposure to that hazard can be quantified.

In the absence of a hazard, mandating that regulatory approval requires the measurement of concentrations of undefined key components of GnEd animals and conventional counterparts grown and bred under the same husbandry conditions will unneccesarily make it cost prohibitive to use GnEd to introduce useful traits such as polled, disease resistance, and heat tolerance into conventional food animal breeding programs.

Materials and Methods

Animals

All animals were housed at the UC Davis Beef Barn and managed by facility personnel as approved by the UC Davis Institutional Animal Care and Use Committee (protocol #18855). The breeding of the cattle was described by Young et al.¹⁰. In brief, 16 contemporary animals were included in this study (Table 5), 12 of which were described by Young et al.¹⁰ These 12 have had their genomes sequenced and include 6 polled offspring of the homozygous GnEd polled bull (RCI002) RC.calves1–6, 3 horned offspring of the Horned Holstein sire of RCI002 (CO-OP OMAN LOGAN-ET; HO1), HO1.calves1–3 (Supplementary Fig. S1), and 3 purebred Horned hereford offspring HH.calves1–3.

Table 5.

Information about the animals used in this study and which data were collected and analyzed from each

ID	Genotype	Gender	Sire	Dam	Health data	Growth (no. of time points)	Meat	Milk
RC.calf1	P_c#p	F	RCI002	HH	Yes	1	Full	Yes
RC.calf2	P_c^*p	M	RCI002	HH	Yes	3	Full	—
RC.calf3	P_c^*p	M	RCI002	HH	Yes	3	Full	—
RC.calf4	P_c#p	M	RCI002	HH	Yes	3	Partial	—
RC.calf5	P_c#p	M	RCI002	HH	Yes	3	Full	—
RC.calf6	P_c#p	M	RCI002	HH	Yes	2	Partial	—
HH.calf1	pp	F	100HH2981	HH	Yes	2	—	Yes
HH.calf2	pp	F	100HH2381	HH	Yes	3	—	Yes
HH.calf3	pp	M	100HH2381	HH	Yes	3	—	—
AN.calf1	P_cp	F	AN	HH	Yes	1	—	—
AN.calf2	P_cp	F	AN	HH	Yes	1	—	—
HH.calf4	pp	M	HH	HH	Yes	2	—	—
HH.calf5	pp	M	HH	HH	Yes	2	—	—
HO1.calf1	pp	M	HO1	HH	Yes	3	Partial	—
HO1.calf2	pp	F	HO1	HH	Yes	3	Full	Yes
HO1.calf3	pp	M	HO1	HH	Yes	2	Full	—
#3113	Pp or PP	F	AN or HH	AN or HH	—	—	—	Yes

AN, Angus; full, meat analyzed for proximates, amino acids, four vitamins, three minerals; GnEd, genome-edited; HH, horned Hereford; HO1, Holstein bull CO-OP OMAN LOGAN-ET; RCI002, RCI-002 BURI-ETN; partial, meat analyzed for proximates, vit B₁₂ and iron; P_c#, GnEd P_c including pCR2.1 plasmid sequence; P_c^*, GnEd P_c; P_c, Celtic POLLED allele.

Four additional comparator animals were included, all of which were born to Horned hereford cows: two were polled and sired by an Angus bull (AN.calves1–2) and two were purebred Horned Herefords sired by a third Horned hereford bull (HH.calves4–5). One cow was also included, 3113, a Horned hereford × Angus crossbred cow (Table 5). She was not initially included as a contemporary control animal, but she calved at a similar time to RC.calf1 and was under similar husbandry conditions and as such provided a milk comparator for this cow. Milk was collected from her for 3 weeks at which stage she rejected her calf and ceased producing milk.

Veterinary examinations

Calves (n = 6 GnEd offspring; n = 10 controls) underwent a complete physical examination at ∼1 week, 8 months, and 1 year of age. At the time of each physical examination, blood was drawn from the jugular or tail vein into evacuated tubes spray coated with K2 EDTA (Becton Dickson and Company, NJ) and analyzed for both complete blood counts and blood chemistry by the UC Davis Veterinary Medical Teaching Hospital. The typical reference range for blood analytes from 1 week old, 8 month old, and adult cattle was sourced from two veterinary medical teaching hospitals,^45–48 and other primary publications.^11,49–57

Where available, minimum and maximum values were used as the range of reference values. Otherwise, the calculation of mean ± 2 × SD was used to generate a 95% confidence interval as a reference range of values.

The average ages for the 1 week, 8 months, and 1 year veterinary examinations and blood draws were 9, 250, and 377 days for the offspring of the GnEd bull; and 11, 263, and 387 days for the control offspring. After the 1 year health examination, the bulls were subjected to a breeding soundness examination, following the standards set forth by the Society for Theriogenology, including semen collection through electroejaculation and analysis for sperm motility and morphology.

The average age for the breeding soundness examination was 447 days for the offspring of the GnEd bull and 440 days for the control offspring. The offspring of the GnEd bull were killed by captive bolt at ages ranging from 643 to 1,137 days at the UC Davis Veterinary School and incinerated. The control offspring were killed by captive bolt at the UC Davis meat laboratory at ages ranging from 587 to 1,045 days.

Meat analysis

A sample of both sirloin cap and chuck arm was dissected from the carcasses of the polled offspring of the GnEd bull (RC.calves1–6) and controls (HO1.calves1–3), trimmed of excess fat, and frozen at −80°C. A sample of tri-tip was dissected from the carcass of the GnEd bull and frozen at −80°C. The muscle was analyzed by Eurofins Microbiology Laboratories (Garden Grove, CA) by proximate analysis (n = 13 GnEd offspring; n = 6 control; Table 5) as well as for 18 amino acids, Fe, Zn, P, riboflavin, niacin, and vitamins B₆ and B₁₂ (n = 8 GnEd offspring; n = 4 control; Table 5), using AOAC International methods (Rockville, MD).

Reference nutrient data for beef were sourced for cuts of raw meat in comparable areas of the carcass to our sampling sites (sirloin cap and chuck arm) and included chuck, flank, filet, sirloin, striploin, tenderloin, stewing steak, ground beef, short ribs, shoulder, flat ribs, beef steak, beef back (Austria only), blade (Australia, France and Italy only), and buttock/rump (Argentina, Italy, Australia, New Zealand, United Kingdom, Serbia, Sweden, Netherlands, and Slovenia only).

Nutrient data for U.S. beef or beef imported from Australia graded either USDA Choice or Select were sourced from the USDA National Beef Database.⁵⁸ These animals were younger than 42 months of age.⁵⁹ Nutrient data for beef from 22 European countries (Austria, Belgium, Czech Republic, Denmark, Estonia, Finland, France, Germany, Iceland, Italy, Lithuania, Netherlands, Norway, Poland, Portugal, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, and the United Kingdom), plus Pakistan, Tunisia, Japan, Iran, and Canada, were sourced from EuroFIR Food EXplorer (membership required) or from individual country databases listed on their site.⁶⁰ Nutrient data from New Zealand,⁶¹ Mexico,⁶² Colombia,⁶³ West Africa,⁶⁴ Argentina,⁶⁵ Brazil,⁶⁶ Peru,⁶⁷ and Turkey⁶⁸ were sourced from individual country databases (Supplementary Table S1).

Milk analysis

Calves were separated from their dams (n = 5) for 2–12 h before milking. Milk was collected by hand milking once or twice weekly, at lactation stages ranging from day 7 (week 1) through day 53 (week 7) of lactation. All four quarters were collected individually at each milking except for five collections wherein samples were combined from all quarters due to the small quantities obtained. Milk was placed immediately on ice, and a Broad Spectrum Microtab^® II (Advanced Instruments, Inc.) pellet was dissolved in the milk before freezing at −20°C. Milk collected for antibiotic residue testing from RC.calf1 (day 29 of lactation) and HO1.calf2 (day 46 of lactation) was pooled equally from all four quarters and frozen without the addition of a Microtab II pellet.

Milk samples (n = 101) were analyzed for moisture (%), fat (%), true protein (%), lactose (%), solids (%), freezing point depression (%), and casein (%) using Fourier Transform Infrared Spectroscopy (Dairy One Cooperative, Ithaca, NY). Most of the samples (n = 93) were of a sufficient volume to also be analyzed by Dairy One for Ca %, P %, Mg %, Na %, S %, and Cl %. For Ca, P, Mg, Na, and S, samples were digested using a CEM Microwave Accelerated Reaction System (MARS6), with MarsXpress Temperature Control, using 50 mL calibrated Xpress Teflon PFA vessels with Kevlar/fiberglass insulating sleeves (CEM, Matthews, NC). The digested samples were then analyzed by inductively coupled plasma (ICP) using a Thermo iCAP 6300 ICP Radial Spectrometer (Thermo Scientific, Waltham, MA).

The chloride ion was measured using potentiometric titration. In brief, 1–5 g milk was extracted for 15 min in 50 mL 0.1 N HNO₃, followed by potentiometric titration with AgNO₃ (0.01 or 0.10 N) using a Metrohm 905 Titrando Titration Unit equipped with an Ag-ring electrode, controlled by Metrohm Tiamo software (Dairy One).

Nutrient data for fluid cow milk were sourced from online nutrient databases,^69,70 and other literature.^{13,20,71–79} Given a scarcity of data for S % in milk, we also calculated the expected range of this nutrient from the range in the literature of % true protein in milk. Milk protein contains 2.97 g methionine/100 g CP and 0.94 g cystine/100 g CP.²¹ Methionine is 21.8% S and cystine is 23.7% S. Thus, the CP–S ratio is 114.94 g/g. Milk true protein can be calculated from milk CP by multiplying by 0.945, as 5.5% of nitrogen in milk is nonprotein nitrogen,¹³ so the true protein–S ratio is 108.6 g/g. Thus the expected range of S % in milk based on the range of % true protein in milk is 0.017 − 0.046% (Table 4).

PCR of antibiotic resistance gene expression

RNA was extracted from muscle tissue using Trizol (Invitrogen) and quality checked using electrophoresis through 3-(N-Morpholino)propanesulfonic acid-formaldehyde gels. The RNA was DNase treated using TURBO Dnase (Invitrogen) and 1 μg was reverse transcribed using GoScript (Promega, Madison, WI), primed with oligo dT and random hexamers in a 20 μl reaction volume, and heated according to the manufacturer's instructions. Control reactions were performed that omitted either the GoScript or the RNA.

PCR was performed using GoTaq (Promega) and primers designed to detect Escherichia coli β-lactamase (bla) (F: TTCCGTGTCGCCCTTATTCCCT; R: CAGTGAGGCACCTATCTCAGCG; Tm 65°C, 40 cycles), bacterial neomycin phosphotransferase (neo) (F: GATGGATTGCACGCAGGTTCTCC; R: CGTCAAGAAGGCGATAGAAGGCG; Tm 67°C, 40 cycles), and a housekeeping gene EEF1A2 (F: TCTACAAATGCGGGGGCATC; R: CTGCCTTCAGCTTGTCCAGT; Tm 62°C, 30 cycles), which has previously been found suitable for evaluating gene expression changes in muscle tissue.⁸⁰

gDNA extracted from RC.calf1 was used as a positive control for the bla and neo PCRs. All bla and neo PCR products detected in muscle cDNA were gel purified, cloned into pCR™4-TOPO^® TA (Invitrogen), and three clones for each PCR product were sequenced in both directions. The PCR products of bla and neo from RC.calf1 gDNA were cloned into pCR4-TOPO TA and five clones were sequenced in both directions to measure the background error rate of GoTaq polymerase. We also used bla primers to PCR amplify the gDNA that was coextracted from the muscle tissue from cattle that showed bla expression but were not carrying the pCR2.1 plasmid backbone sequence. These PCR products were likewise sequenced in both directions.

Antibiotic residues in meat and milk

Skeletal muscle (600 g) and milk (90 mL) from HO1.calf2 (control cow) and RC.calf1 (Polled GnEd cow with insertion of pCR2.1 vector sequence in the genome) were analyzed for the presence of β-lactam antibiotics (amoxicillin, ampicillin, cloxacillin, dicloxacillin, nafcillin, oxacillin, and penicillin G) by liquid chromatography-tandem mass spectrometry (LC-MS-MS) using a modification of the USDA method CLG-BLAC.03, and for aminoglycosides (dihydrostreptomycin, gentamycin, hygromycin, kanamycin, neomycin, paromomycin, spectinomycin, and streptomycin) by LC-MS-MS using the USDA method CLG-AMG 4 (Eurofins DQCI LLC, Fresno, CA).

The detection limits for β-lactams in meat and milk were <2.0 μg/kg amoxicillin, <3.0 μg/kg ampicillin (<1.0 μg/kg in milk), <4.0 μg/kg cloxacillin (<1.0 μg/kg in milk), <5.0 μg/kg dicloxacillin (<1.0 μg/kg in milk), <5.0 μg/kg nafcillin (<2.0 μg/kg in milk), <3.0 μg/kg oxacillin (<1.0 μg/kg in milk), and <4.0 μg/kg penicillin G (<1.0 μg/kg in milk). The detection limits for aminoglycosides in both meat and milk were <10 μg/kg dihydrostreptomycin, <50 μg/kg gentamycin, <20 μg/kg hygromycin, <20 μg/kg kanamycin, <20 μg/kg neomycin, <25 μg/kg paromomycin, <50 μg/kg spectinomycin, and <20 μg/kg streptomycin.

Statistics

Data were analyzed by one way or two way analysis of variance (ANOVA) using Prism 9 (GraphPad Software, San Diego, CA) followed by a post hoc Tukey or Bonferroni test while controlling for multiple testing. Data were transformed to normality or homogeneity of variance when necessary. Time, genotype, and cow were considered fixed effects. Health data were analyzed using a repeated measures ANOVA. Effect of genotype on milk and meat nutrients was analyzed by Student's t-test. Significance was declared at p < 0.05.

Footnotes

Acknowledgments

We acknowledge the following: Recombinetics, Eagan, MN, for developing the GnEd bull, RCI002 (Holstein Registry RCI-002 BURI-ETN), partially supported by USDA NIFA National Research Initiative Competitive Grant no. 2015-67015-23316 (T.S. Sonstegard), and Marissa Fisher and the students and staff of the UC Davis Animal Science Beef Barn for their assistance and expertise handling and managing the cattle. The residents and students of the UC Davis veterinary teaching hospital large animal clinic, in particular Drs. Tara Urbano and Paolo Tempini, were instrumental in monitoring the health of the animals.

Authors' Contributions

J.F.T. contributed to methodology, validation, formal analysis, investigation, data curation, writing—original draft, review, and editing. A.E.Y. was involved in conceptualization, methodology, investigation, data curation, and funding acquisition. B.R.N. was involved in investigation and resources. X.Y. was in charge of methodology. T.F.B. carried out investigation. A.L.V. carried out conceptualization, methodology, resources, writing—original draft, review and editing, supervision, project administration, and funding acquisition.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This project was supported by funds provided by USDA NIFA AFRI Biotechnology Risk Assessment Grant award no. 2017-33522-27097.

Supplementary Material

References

Goonewardene

, Price

, Okine

, et al. Behavioral responses to handling and restraint in dehorned and polled cattle. Appl Anim Behav Sci. 1999; 64:159–167. DOI: https://doi.org/10.1016/S0168-1591(99)00034-9.

Mueller

, Cole

, Sonstegard

, et al. Comparison of gene editing versus conventional breeding to introgress the POLLED allele into the US dairy cattle population. J Dairy Sci. 2019; 102:4215–4226. DOI: 10.3168/jds.2018-15892.

FAO/WHO. Guideline for the conduct of food safety assessment of foods derived from recombinant-DNA animals (CAC/CL 68-2008) [Codex Standard]. 2008. Available at https://www.who.int/docs/default-source/food-safety/food-genetically-modified/cxg-068e.pdf?sfvrsn=c9de948e_2 Last accessed March 2, 2022.

Lema

, Burachik

. Safety assessment of food products from r-DNA animals. Comp Immunol Microbiol Infect Dis. 2009; 32:163–189. DOI: 10.1016/j.cimid.2007.11.007.

Ridley

, Shillito

, Coats

, et al. Development of the International Life Sciences Institute Crop Composition Database. J Food Compost Anal. 2004; 17:423–438. DOI: 10.1016/j.jfca.2004.03.006.

Alba

, Phillips

, Mackie

, et al. Improvements to the International Life Sciences Institute Crop Composition Database. J Food Compost Anal. 2010; 23:741–748. DOI: 10.1016/j.jfca.2010.03.007.

Sult

, Barthet

, Bennett

, et al. Report: release of the International Life Sciences Institute Crop Composition Database Version 5. J Food Compost Anal. 2016; 51:106–111. DOI: 10.1016/j.jfca.2016.05.002.

Herman

, Chassy

, Parrott

. Compositional assessment of transgenic crops: an idea whose time has passed. Trends Biotechnol. 2009; 27:555–557. DOI: 10.1016/j.tibtech.2009.07.003.

Carlson

, Lancto

, Zang

, et al. Production of hornless dairy cattle from genome-edited cell lines. Nat Biotechnol. 2016; 34:479–481. DOI: 10.1038/nbt.3560.

10.

Young

, Mansour

, McNabb

, et al. Genomic and phenotypic analyses of six offspring of a genome-edited hornless bull. Nat Biotechnol. 2020; 38:225–232. DOI: 10.1038/s41587-019-0266-0.

11.

Zhao

, Xu

, Wang

, et al. Nutritional composition analysis of meat from human lactoferrin transgenic bulls. Anim Biotechnol. 2013; 24:44–52. DOI: 10.1080/10495398.2012.739979.

12.

Lim

, Mayakrishnan

, Lee

, et al. A comparative study on milk composition of Jersey and Holstein dairy cows during the early lactation. J Anim Sci Technol. 2020; 62:565–576. DOI: 10.5187/jast.2020.62.4.565.

13.

DePeters

, Cant

. Nutritional factors influencing the nitrogen composition of bovine milk: a review. J Dairy Sci. 1992; 75:2043–2070. DOI: 10.3168/jds.S0022-0302(92)77964-8.

14.

Bijl

, van Valenberg

, Huppertz

, et al. Protein, casein, and micellar salts in milk: current content and historical perspectives. J Dairy Sci. 2013; 96:5455–5464. DOI: 10.3168/jds.2012–6497.

15.

Food Standards Australia New Zealand. Australia New Zealand Food Standards Code—Standard 2.5.1—Milk. Federal Register of Legislation. 2015. Available at https://www.legislation.gov.au/Details/F2015L00462 Last accessed March 30, 2022.

16.

Food Standards Australia New Zealand. Australia New Zealand Food Standards Code—Standard 2.2.1—Meat and meat products. Federal Register of Legislation. 2015. Available at https://www.legislation.gov.au/Details/F2016C00173 Last accessed March 30, 2022.

17.

, Gong

, Fletcher

, et al. Growth enhancement in transgenic atlantic salmon by the use of an “all fish” chimeric growth hormone gene construct. Nat Biotechnol. 1992; 10:176–181. DOI: 10.1038/nbt0292-176.

18.

Phelps

, Koike

, Vaught

, et al. Production of alpha 1,3-galactosyltransferase-deficient pigs. Science. 2003; 299:411–414. DOI: 10.1126/science.1078942.

19.

Veterinary Medicine Advisory Committee. Briefing Packet: AquAdvantage Salmon. Food and Drug Administration Center for Veterinary Medicine. 2010. Available at http://wayback.archive-it.org/7993/20170404230823/https://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/VeterinaryMedicineAdvisoryCommittee/UCM224762.pdf Last accessed February 14, 2022.

20.

National Research Council. Air Emissions from Animal Feeding Operations: Current Knowledge, Future Needs. Washington, DC: The National Academies Press. 2003.

21.

Pieniaźek

, Rakowska

, Szkilladziowa

, et al. Estimation of available methionine and cysteine in proteins of food products by in vivo and in vitro methods. Br J Nutr. 1975; 34:175–190. DOI: 10.1017/s0007114575000232.

22.

Csapó

, Salamon

. Composition of the mother's milk I. Protein contents, amino acid composition, biological value. A review. Acta Univ Sapientiae Aliment., 2009; 2:174–195.

23.

U.S. Food and Drug Administration. Freedom of Information Summary. Original New Animal Drug Application. NADA 141–542. Silver Spring, MD: U.S. Department of Health & Human Services. 2020.

24.

Parker

, Browne

. The place of experimental design and statistics in the 3Rs. ILAR J. 2014; 55:477–485. DOI: 10.1093/ilar/ilu044.

25.

Brune

, Chakravarthy

, Graser

, et al. Core and supplementary studies to assess the safety of genetically modified (GM) plants used for food and feed. J Regul Sci. 2021; 9:45–60. DOI: 10.21423/jrs-v09i1brune.

26.

Waters

, Ramos

, Culler

, et al. Recommendations for science-based safety assessment of genetically modified (GM) plants for food and feed uses. J Regul Sci. 2021; 9:16–21. DOI: 10.21423/jrs-v09i1waters.

27.

van den Eede

, Aarts

, Buhk

, et al. The relevance of gene transfer to the safety of food and feed derived from genetically modified (GM) plants. Food Chem Toxicol. 2004; 42:1127–1156. DOI: 10.1016/j.fct.2004.02.001.

28.

Ivancevic

, Kortschak

, Bertozzi

, et al. Horizontal transfer of BovB and L1 retrotransposons in eukaryotes. Genome Biol. 2018; 19:85. DOI: 10.1186/s13059-018-1456-7.

29.

Norris

, Lee

, Greenlees

, et al. Template plasmid integration in germline genome-edited cattle. bioRxiv. 2019:715482. DOI: 10.1101/715482.

30.

Latham

, Wilson

. FDA Finds Unexpected Antibiotic Resistance Genes in ‘Gene-Edited’ Dehorned

Cattle

. Independent Science

News.

2019. Available at https://www.independentsciencenews.org/news/fda-finds-unexpected-antibiotic-resistance-genes-in-gene-edited-dehorned-cattle/ Last accessed March 30, 2022.

31.

Third World Network. Genome-Edited Hornless Cattle Found to Have Unintended Antibiotic Resistance Genes. Biosafety Information Centre. 2019. Available at https://biosafety-info.net/articles/agriculture-organisms/animalsfish/genome-edited-hornless-cattle-found-to-have-unintended-antibiotic-resistance-genes/ Last accessed March 30, 2022.

32.

Regalado

. Gene-edited cattle have a major screwup in their

DNA

. MIT Technology

Review.

2019. Available at https://www.technologyreview.com/2019/08/29/65364/recombinetics-gene-edited-hornless-cattle-major-dna-screwup/ Last accessed March 30, 2022.

33.

Robinson

. Gene-edited hornless cattle: flaws in the genome overlooked GM

Watch

. 2019. Available at https://www.gmwatch.org/en/news/archive/2019/19084-gene-edited-hornless-cattle-flaws-in-the-genome-overlooked Last accessed March 30, 2022.

34.

Bloch

. FDA finds a surprise in gene-edited cattle: antibiotic-resistant, non-bovine

DNA

. The

Counter.

2019. Available at https://thecounter.org/fda-gene-edited-cattle-antibiotic-resistant-crispr-dna Last accessed January 18, 2022.

35.

Berman

. Serious problem found with gene-edited celebrity cows. Big

Think

. 2019. Available at https://bigthink.com/technology-innovation/hornless-dna-problem Last accessed March 30, 2022.

36.

Pöntinen

, Top

, Arredondo-Alonso

, et al. Apparent nosocomial adaptation of Enterococcus faecalis predates the modern hospital era. Nat Commun. 2021; 12:1523. DOI: 10.1038/s41467-021-21749-5.

37.

National Database of Antibiotic Resistant Organisms (NDARO). Available at https://www.ncbi.nlm.nih.gov/pathogens/antimicrobial-resistance/ Last accessed March 26, 2021.

38.

Zwe

, Tang

VCY

, Aung

, et al. Prevalence, sequence types, antibiotic resistance and, gyrA mutations of Salmonella isolated from retail fresh chicken meat in Singapore. Food Control. 2018; 90:233–240. DOI: 10.1016/j.foodcont.2018.03.004.

39.

Heir

, Moen

, Åsli

, et al. Antibiotic resistance and phylogeny of pseudomonas spp. isolated over three decades from chicken meat in the norwegian food chain. Microorganisms., 2021; 9:207. DOI: 10.3390/microorganisms9020207.

40.

Garofalo

, Vignaroli

, Zandri

, et al. Direct detection of antibiotic resistance genes in specimens of chicken and pork meat. Int J Food Microbiol. 2007; 113:75–83. DOI: 10.1016/j.ijfoodmicro.2006.07.015.

41.

Darphorn

, Bel

, Koenders-van Sint Anneland

, et al. Antibiotic resistance plasmid composition and architecture in Escherichia coli isolates from meat. Sci Rep. 2021; 11:2136. DOI: 10.1038/s41598-021-81683-w.

42.

Milanović

, Aquilanti

, Tavoletti

, et al. Distribution of antibiotic resistance genes in the saliva of healthy omnivores, ovo-lacto-vegetarians, and vegans. Genes. 2020; 11:1088. DOI: 10.3390/genes11091088.

43.

Tan

, Carlson

, Walton

, et al. Chapter two—precision editing of large animal genomes. In: Advances in Genetics. (Friedmann T, Dunlap J and Goodwin S; eds). Academic Press. 2012; pp. 37–97.

44.

Quadros

, Miura

, Harms

, et al. Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long ssDNA donors and CRISPR ribonucleoproteins. Genome Biol. 2017; 18:92. DOI: 10.1186/s13059-017-1220-4.

45.

UC Davis Veterinary Medicine Teaching Hospital. Clinical Diagnostic Laboratory CBC Reference Intervals. Available at https://www.vetmed.ucdavis.edu/sites/g/files/dgvnsk491/files/local_resources/pdfs/lab_pdfs/UC_Davis_VMTH_Hematology_Reference_Intervals.pdf Last accessed March 1, 2022.

46.

UC Davis Veterinary Medicine Teaching Hospital. Clinical Chemistry Reference Intervals. Available at https://www.vetmed.ucdavis.edu/sites/g/files/dgvnsk491/files/local_resources/pdfs/lab_pdfs/UC_Davis_VMTH_Chem_Reference_Intervals.pdf Last accessed March 1, 2022.

47.

Cornell University College of Veterinary Medicine. Hematology (Advia 2120). Available at https://www.vet.cornell.edu/animal-health-diagnostic-center/laboratories/clinical-pathology/reference-intervals/hematology Last accessed March 1, 2022.

48.

Cornell University College of Veterinary Medicine. Chemistry (Cobas). Available at https://www.vet.cornell.edu/animal-health-diagnostic-center/laboratories/clinical-pathology/reference-intervals/chemistry Last accessed March 1, 2022.

49.

Klinkon

, Ježek

. Values of Blood Variables in

Calves

. In: A Bird's-Eye View of Veterinary Medicine. Perez-Marin CP, ed. London, UK: IntechOpen. 2012; pp. 301–320. DOI: 10.5772/3, 2100.

50.

Dillane

, Krump

, Kennedy

, et al. Establishing blood gas ranges in healthy bovine neonates differentiated by age, sex, and breed type. J Dairy Sci. 2018; 101:3205–3212. DOI: 10.3168/jds.2017–13445.

51.

Roland

, Drillich

, Iwersen

. Hematology as a diagnostic tool in bovine medicine. J Vet Diagn Invest. 2014; 26:592–598. DOI: 10.1177/1040638714546490.

52.

Brun-Hansen

, Kampen

, Lund

. Hematologic values in calves during the first 6 months of life. Vet Clin Pathol. 2006; 35:182–187. DOI: 10.1111/j.1939-165x.2006.tb00111.x.

53.

Doornenbal

, Tong

, Murray

. Reference values of blood parameters in beef cattle of different ages and stages of lactation. Can J Vet Res. 1988; 52:99–105.

54.

Wilm

, Costa

JHC

, Neave

, et al. Technical note: serum total protein and immunoglobulin G concentrations in neonatal dairy calves over the first 10 days of age. J Dairy Sci. 2018; 101:6430–6436. DOI: 10.3168/jds.2017-13553.

55.

Panousis

, Siachos

, Kitkas

, et al. Hematology reference intervals for neonatal Holstein calves. Res Vet Sci. 2018; 118:1–10. DOI: 10.1016/j.rvsc.2018.01.002.

56.

, Canalias

, Solà-Oriol

, et al. Age-related serum biochemical reference intervals established for unweaned calves and piglets in the post-weaning period. Front Vet Sci. 2019; 6:1–12. DOI: 10.3389/fvets.2019.00123.

57.

Benesi

, Teixeira

CMC

, Leal

MLR

, et al. Leukograms of healthy Holstein calves within the first month of life. Pesqui Vet Bras. 2012; 32:352–356. DOI: 10.1590/S0100-736X2012000400013.

58.

US Department of

Agriculture

. Composition of Foods

Raw

, Processed, Prepared

Beltsville

, Maryland: Agricultural Research

Service

. Nutrient Data

Laboratory.

2016. Available at https://www.ars.usda.gov/ARSUserFiles/80400535/Data/SR/SR28/reports/sr28fg13.pdf Last accessed October 2, 2021.

59.

Roseland

, Nguyen

, Williams

, et al.

USDA nutrient data set for retail beef cuts from SR, release 3.0.

https://www.ars.usda.gov/ARSUserFiles/80400525/Data/Meat/Retail_Beef_Cuts03.pdf Last accessed September 21, 2021.

60.

EuroFIR

AISBL.

European Food Information Resource (EuroFIR). Available at www.eurofir.org Last accessed March 30, 2022.

61.

The New Zealand Institute for Plant and Food Research. New Zealand Food Composition Data [Nutrient Database]. 2020. https://www.foodcomposition.co.nz Last accessed March 30, 2022.

62.

Salvador Zubirán National Institute of Medical Sciences and Nutrition (INCMNSZ). Tables of composition of food and food products [Nutrient Database]. 2015. Available at https://www.incmnsz.mx/2019/TABLAS_ALIMENTOS.pdf Last accessed March 30, 2022.

63.

Colombian Institute of Family

Welfare

, National University of

Colombia

. Colombian Food Composition Table (TCAC) [Nutrient Database]. 2018. Available at https://www.icbf.gov.co/system/files/tcac_web.pdf Last accessed March 30, 2022.

64.

Vincent

, Grande

, Compaoré

, et al. FAO/INFOODS Food Composition Table for Western Africa (2019) User Guide & Condensed Food Compsition Table [Nutrient Database]. 2020. Available at www.fao.org/3/ca7779b/CA7779B.pdf Last accessed March 30, 2022.

65.

Universidad Nacional de Luján. Food Composition Table (ARGENFOODS) [Nutrient Database]. 2010. Available at www.argenfoods.unlu.edu.ar/Tablas/Tabla.htm Last acccessed April 6, 2022.

66.

University of São Paulo (USP), Food Research Center (FoRC). Brazilian Table of Food Composition (TBCA) Version 7.1 [Nutrient Database]. 2020. Available at www.fcf.usp.br/tbca Last accessed March 30, 2022.

67.

National Center of Food and Nutrition National Institute of Health. Peruvian Food Composition Tables 8th edition [Nutrient Database]. 2009. Available at https://www.ins.gob.pe/insvirtual/images/otrpubs/pdf/Tabla%20de%20Alimentos.pdf Last accessed March 30, 2022.

68.

Central Research Institute For Food and Feed Control. National Food Composition Database (TürKomp) [Nutrient Database]. 2021. Available at www.turkomp.gov.tr/main Last accessed March 30, 2022.

69.

National Food

Institute

. Frida Food

Data

, Version 4 [Nutrient Database]. 2019. Available at http://frida.fooddata.dk Last accessed March 30, 2022.

70.

Food Standards Australia New Zealand. Australian Food Composition Database—Release 1 [Nutrient Database]. 2019. Available at www.foodstandards.gov.au Last accessed March 30, 2022.

71.

Macy

, Kelly

. Human milk and cow's milk in infant nutrition In: Milk: the Mammary Gland and Its Secretion. (Kon SK, Cowie AT; eds). New York and London: Academic Press. 1961; pp. 265–304.

72.

Paul

, Southgate

DAT

. McCance and Widdowson's The Composition of Foods. New York: Elsevier/North-Holland Biomedical Press. 1978.

73.

Pennington

, Wilson

, Young

, et al. Mineral content of market samples of fluid whole milk. J Am Diet Assoc. 1987; 87:1036–1042.

74.

Souci

, Fachmann

, Kraut

, et al. Food Composition and Nutrition Tables 1981/1982. Stuttgart, Germany: Wissenschaftliche Verlagsgesellschaft. 1981.

75.

Cerbulis

, Farrell

Jr . Composition of milks of dairy cattle. I. Protein, lactose, and fat contents and distribution of protein fraction. J Dairy Sci., 1975; 58:817–827. DOI: 10.3168/jds.S0022-0302(75)84644-3.

76.

Cerbulis

, Farrell

Jr . Composition of the milks of dairy cattle. II. Ash, calcium, magnesium, and phosphorus. J Dairy Sci., 1976; 59:589–593. DOI: 10.3168/jds.S0022-0302(76)84245-2.

77.

Mehta

. Chemical composition of milk and milk products. In: Handbook of Food Chemistry. (Cheung PCK, Mehta BM; eds). Berlin Heidelberg: Springer-Verlag. 2015.

78.

Poetschke

The chlorine content of milk. J Ind Eng Chem. 1912; 4:38–40. DOI: 10.1021/ie50037a013.

79.

Franke

, Bruhn

, Lawrence

. Distribution of protein in California milk in 1983. J Dairy Sci. 1988; 71:2373–2383. DOI: 10.3168/jds.S0022-0302(88)79821-5.

80.

Pérez

, Tupac-Yupanqui

, Dunner

. Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue. BMC Mol Biol. 2008; 9:79. DOI: 10.1186/1471-2199-9-79.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.37 MB

2.03 MB

1.65 MB

1.57 MB

1.55 MB

1.76 MB

1.79 MB

0.58 MB

Animal Health and Food Safety Analyses of Six Offspring of a Genome-Edited Hornless Bull

Abstract

Introduction

Results

Growth

Blood chemistry and hematology

Breeding soundness

Meat composition

Milk composition

Antibiotic residues in meat and milk

Antibiotic resistance gene expression in meat

Discussion

Animal health evaluations

Food safety evaluations

Meat and milk compositional analyses

Value versus expense of comparator controls

Antibiotic resistance genes in food

Hazard identification and food safety assessments

Conclusions

The Bigger Picture

Materials and Methods

Animals

Veterinary examinations

Meat analysis

Milk analysis

PCR of antibiotic resistance gene expression

Antibiotic residues in meat and milk

Statistics

Footnotes

Acknowledgments

Authors' Contributions

Author Disclosure Statement

Funding Information

Supplementary Material

References

Supplementary Material