Determining the Transrepression Activity of Xenoestrogen on Nuclear Factor- κ B in Cos-1 Cells by Estrogen Receptor- α

Abstract

Functional assays have been used to define the estrogenicity of xenoestrogens in cotransfection studies employing estrogen receptors in various cell lines. It is known that estrogen is able to affect transcription from other nuclear transcription factors, especially the nuclear factor-κB (NF-κB). The ability of selected xenoestrogens (methoxychlor [MXC], dieldrin, and o′, p′-DDT) to transrepress the NF-κB–mediated transcription in Cos-1 cells was evaluated by cotransfection of human estrogen receptor-α (hERα). These xenoestrogens have been described as comparably potent xenoestrogens, whereas their relative binding activity (RBA) has been relegated to a lower order as compare to estrogen. The two NF-κB response element–containing SV40 promoter and −242/+54 cytomegalovirus (CMV)–expressing firefly luciferase (2 × NRE-PV-Luc and 2 × NRE-CMV-Luc, respectively) were transfected into Cos-1 cells with pRL-tk, expressing the renilla luciferase as internal control. The estrogen receptor was expressed from cytomegalovirus major immediate early promoter (CMV-MIEP) (CMV5-hERα). Treatment with 1 nM estrogen (E₂) (26.2%), 5 nM E₂ (41.4%; p < .05), and xenoestrogens (methoxychlor [1 nM: 29.6%, p < .05; 10 nM: 22.6%), dieldrin [1 nM: 10.3%; 10 nM: 36.06%, p < .05], and o′, p′-DDT [1 nM: 17.0%; 10 nM: 7.15%]) repressed transcription from 2 × NREX-PV-Luc. The antiestrogen, ICI 182,780, failed to antagonize the effects of xenoestrogens. The effects of xenoestrogens in transrepression of NF-κB by ERα were similar when 2 × NRE-CMV-Luc was employed as reporter. Statistically significant (p < .01) repression by 1 nM E₂ (69.2%), 5 nM E₂ (69.1%), 1 nM o′, p′-DDT (51.4%), 1 nM dieldrin (47.3%), and 1 nM MXC (73.3%) were observed. The effect of these xenoestrogens without ERα cotransfection on 2 × NRE-PV-Luc- and 2 × NRE-CMV-Luc-mediated NF-κB transcription was not affected by the treatment alone. It is concluded that xenoestrogens, like estrogens, are capable of producing transrepression of NF-κB by hERα.

The presence of endocrine disrupters in the environment has raised concern for potential impacts they might have on human health and wildlife (Kavlock et al. 1996; Toppari et al. 1996). A decrease in human sperm counts due to the exposure of persistent residues in our environment has been postulated (Carlsen, Giwercman, and Skakkebaek 1993). An increase in human testicular cancers has also been suggested due to the presence of persistent residues in the environment (Henderson et al. 1982; Giwercman and Skakkebaek 1992). Increased incidence of prostatic cancer and hyspadias has also been postulated due to exposure to these chemicals (Davis et al. 1993; Jobling et al. 1995; Soto et al. 1995). However, the mechanism of any postulated links to these chemicals and health effects has not yet been fully deciphered.

Environmental xenoestrogens constitute a wide variety of chemicals, which include, but is not limited to, organochlorine pesticides and their metabolites, polychlorinated and brominated biphenyls, phthalates, alkylphenols, bisphenol/noniphenol, and antioxidants (Gray et al. 1989; Klein et al. 1994; Zava, Blen, and Duwe 1997). Moreover, plants and fungi are also the source of phytoestrogens and mycoestrogens through food (Toppari et al. 1996). These compounds constitute a wide variety of chemical classes, ranging from differing chemical structures through the presence of halogens. Hence, the ability to predict the estrogenic activity of a compound by chemical modulation is low.

Due to the difficulties mentioned above, reliable functional assays were needed to help identify the estrogenecity of chemicals. To address this, the U.S. Environmental Protection Agency (USEPA) developed the Endocrine Disrupter Screening and Testing Program (EDSTP). The protocol of EDSTP includes in vivo and in vitro screening assays: nuclear receptor (estrogen, androgen, and thyroid receptors)-mediated transcriptional activation assay, rodent 3-day uterotrophic assays, fish gonadal recrudence assay, and 20-day pubertal female assay. The chemicals that are positive in these short-term assays are then further evaluated in longer-term assays (Gray et al. 1997).

In vitro assays typically involve the binding of chemicals to estrogen receptor. The majority of the estrogenic potency of the compounds is defined with only estrogen receptor-α (ERα). However, the majority of the nuclear receptors are represented by more than one receptor (Tsai and O’Malley 1994; Lee et al. 1998; Li and Karin 1999). Studying the binding activity of the xenoestrogens to only ERα will not fully decipher the overall potential of exposure of xenoestrogens. Estrogens produce pleiotropic effects, and these effects are not only mediated by the presence of receptors and its subtypes, but they are capable of cross-talk with other nuclear receptors (Lee et al. 1998; Li and Karin 1999; McKay and Cidlowski 1999; Webb et al. 1999). Therefore, current binding studies do not take into account the presence of other ER subtypes (ERβ), metabolism of the compounds by the cells, and cross-talk within the nuclear receptors. It is not possible to fully reconcile the potential effects of xenoestrogens based on their binding to only the ERα. It is important to define the pleitropic effects of xenoestrogens by studying possible nuclear cross-talk. The studies reported here were performed in Cos-1 cells to evaluate the effects of selected xenoestrogens on nuclear factor κB (NF-κB)–mediated transcription due to activation of ERα.

MATERIALS AND METHODS

Reporter and Expression Plasmids

The promoter vector was obtained from Promega (Madison, WI). The promoter vector contains SV40 promoter (203 bp) with no enhancer elements. Promoter vector (PV) was digested with Bgl II and Sma I. The 2 × NF-κB response element (top strand 5′-GATCCAAGGGGACTTTCCATGGATCCAAGGGGACTTT-CCATGA, bottom strand 5′-GATCTCATGGAAAGTCCCCT TGGATCCATGGAAAGTCCCC TTG GATC-3′ (Hill et al. 2000) with 5′ blunt end and 3′ Bgl II end was annealed and ligated with standard T4 DNA ligase. The ligated product was then redigested with Sma I after DNA precipitation to eliminate the colonies without insert. Escherichia coli strain DH5α was transformed by electroporation. The positive colonies were selected after defining the loss of Sma I and regeneration of Bgl II sites in the plasmid. The presence of NF-κB response element (2×NRE) was confirmed by sequencing. The new plasmid (2×NRE-PV-Luc) expresses the firefly (Photinus pyrails) luciferase. In order to construct 2×NRE-CMV-Luc reporter, 203 bps SV40 promoter region of 2×NRE-PV-Luc was released by digestion with Bgl II and Hind III. The 5′ Bgl II of 2 × NRE-PV-luc was end filled with Klenov fragment. The 296 bp of −242/+54 of CMV promoter region was cloned as 5′-end filled and 3′ Hind III to create 2×NRE-CMV-Luc reporter. The −242/+54 CMV-MIEP was kindly provided by P. Ghazal (Scripps Institute, La Jolla, CA). For internal control, pRL-tk, which expresses renilla luciferase (Renilla reniformis) from tk-promoter, was included to complement the dual luciferase assay (Figure 1a ).

The estrogen receptor-α was expressed from cytomegalovirus (CMV) major immediate early promoter (MIEP). Estrogen receptor-α plasmid (CMV5-hERα) was kindly provided by Benita S. Katzenellenbogen, Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, IL. CMV MIEP is a promiscuous promoter and is capable of expression of genes in a wide variety of cells. The structures of the expression plasmids are represented in Figure 1b . For simplicity and better understanding, plasmids are drawn linear.

Cell Culture and Transfection

Cos-1 cells were derived from monkey and were transformed by the presence of T antigen. Cos-1 cells were grown in Del-becco’s modified Eagle’s medium (DMEM) with high glucose and 10% fetal bovine serum supplemented with antibiotics and fungisome in a humidified chamber containing 5% CO₂. The cells were transfected at the confluency of 60% to 70%. Before transfection, the cells were depleted of steroids for 24 h by growing the cells in 5% charcoal/dextran-treated serum and regular medium without phenol red. The plasmid DNAs were transfected by GenePorter (San Diego, CA) according to the manufacturer’s protocol. Approximately 6–8 × 10⁶ cells were transfected with 8 μg of DNA. The DNA was precipitated and suspended into DNA diluent (200 μl). GenePorter reagent (28 μl) was mixed to 172 μl of DMEM (phenol red—free medium) for 5 to 10 min. The suspended DNA solution and GenePorter reagents were mixed and allowed to incubate at room temperature for 5 to 10 min. The mixture was then added to the cells to which 4.6 ml phenol red—free DMEM was already added. The transfection was allowed to proceed 16 h. The 2×NRE-PV-Luc versus internal control was transfected with a ratio of 50:1, and the estrogen receptors were expressed at a ratio of 50:1:1. The reporter plasmid 2 × NRE-CMV-Luc was transfected in the ratio of 10:1, and the estrogen receptors were expressed in the ratio of 10:1:1. The transfected cells were split the next day. All subsequent procedures were performed in 5% serum treated with charcoal- and dextran-containing DMEM (phenol red–free medium) with antibiotics. One transfection was split into one-treatment groups. A set of four to seven transfections were used to create a treatment group. The cells were treated with various agents for two 24-h exposure periods. After 48 h of treatment, the cells were washed twice with 1 × phosphate-buffered saline (PBS). The cells were lysed in 100 μl 1 × lysis buffer (Promega) after scrapping, followed by two freeze-thaw cycles.

Dual-Luciferase Assay

The dual-luciferase assay was performed according to the manufacturer’s instruction (Promega). A manual miniassay with 10 μl cell extract was performed. To the cell extract, 50 μl Reagent II was added, and the firefly luciferase activity was recorded within 3 s by a luminometer (Moon Light 2010; Analytical Luminescence Laboratory). Subsequently, 50 μl of Stop and Glo reagent was added, and the activity of renilla luciferase was recorded within 3 s. The addition of Stop and Glo reagent quenches the firefly luciferase and activates the renilla luciferase. The level of reporter gene (firefly) was divided by renilla activity (internal control) to correct the transfection values. The ratios of control and experimental ± SD were analyzed by analysis of variance (ANOVA) and level of significance between two groups were determined by the Student’s t test.

Expression of Estrogen Receptor-α

Cos-1 cells (2 × 10⁶) were transfected with 2 μg of CMV5-hERα plasmid. After 16 h of transfection, cells were split in different treatment groups. After 2 × 24-h treatments with various agents, the cells were trypsinized, centrifuged, and washed twice with 1 × PBS. The cells were lysed in lysis buffer (PBS containing 1% Triton X-100). The protein concentration of samples was determined by dye binding method. Protein samples of 50 μg were subjected for Western Blot analysis for expression of hERα. The samples were cracked with 4× cracking buffer and heated for 5 min at 95°C. The samples were then loaded onto 10% poly aery lamide–1% sodium dodecyl sulfate (SDS-PAGE) mini slab gels. The proteins were transferred to nitrocellulose membrane by semidry transfer system (Fisher Scientific). After blocking with 5% dry milk in TBST (20 mM Tris pH 7.4, 150 m M NaCl, and 0.05% Tween-20) overnight, the blots were treated with ERα[CH-20: sc-543] polyclonal antibodies (Santa Cruz Biotechnology, San Diego, CA) for 2 h followed by alkaline phosphatase linked to secondary antibodies against immunoglobulin G (IgG) for 1 h. The blots were developed colorimetrically.

Determination of Level of NF-κB Level in Growing Cos-1 Cells

The Cos-1 cells were grown in DMEM and treated with various agents for 3 h. The nuclear extracts were made by the Dignam method (Dignam, Lebovitz, and Roeder 1983). Double stranded NF-κB sequence (top strand 5′-AGTTGAGGGGACTTTCCCAGGC-3′, bottom strand

5′-GCCTGGGAAAGTCCCCTCAACT-3′) was end labeled with ³²P (ATP-λ³²P) by T4 polynucleotide kinase. About 10 to 20 labeled pmoles and 5 μg of nuclear extracts in a reaction of 20 μl were used to determine the level of activated NF-κB in growing Cos-1 cells by electrophoretic mobility shift assay (EMSA). Reactions (20 μl) at 4°C were incubated for 20 min into 1 × binding buffer (25 mM Hepes [pH 7.5], 100 mM NaCl, 2 mM dithiothreitol [DTT], 0.2 mM phenylmethylsulfonyl fluoride [PMSF], 1 mg/ml bovine serum albumin [BSA], 100 μg/ml dI-dC, and 5% glycerol) (Han et al. 1999). The competition with cold oligos was conducted by incubating the cold oligos before the addition of labeled probe. The product was analyzed on 6% PAGE (29:1) gel in 0.5 × TBE at 260 V for 2.5 h. The gel was dried and exposed to X-mat Kodak films. For positive control. HepG₂ cells were grown in DMEM supplemented with fetal bovine serum (FBS). A total cell extract of HepG₂ cells was made after treatment with 10 nM PMA (phorbol 12-myristate 13-acetate) for 6 h. The cells were washed twice on ice with PBS. For one 100-mm plate about 200 μl ELB (extract lysis buffer: 20 mM Tris-HCl. pH 7.4. 600 mM KC1. 2 mM DTT, 5 mM PMSF, 20% glycerol, 5 μg/ml leupeptin. 5 μg/ml antipain) was added. The cells were scrapped and homogenized with a loose pestle with 10 strokes in the homogenizer. The homogenate was centrifuged at 100,000 ×g for 30 min. The supernatant was used as cell extract for EMSA, which served as positive control (Han et al. 1999).

RESULTS

Expression of Estrogen Receptors in Cos-1 Cells and Effects of Treatment

The expression of ERα in Cos-1 cells by CMV5-hER and the effects of treatment are shown in Figure 2. The hERα receptor (67 kDa) is expressed in appreciable amount as determined by Western blot analysis of Cos-1–transfected cells. There was no appreciable effect on the level of hERα receptor expression by treatment of estrogen (1 nM) o′, p′-DDT, or dieldrin (10 nM). However, methoxychlor (10 nM) and the antiestrogen ICI 182,780 (10 nM) caused slight upregulation of ERα from CMV5-hERα.

Effect of Xenoestrogens on Transrepression of 2×NRE-PV-Luc–and 2×NRE-CMV-Luc–Mediated NF-κB Transcription by hERα

Initially, the effects of various treatments on NF-κB–mediated transcription in Cos-1 cells by 2×NRE-PV-Luc and 2 × NRE-CMV-Luc were determined without expression of estrogen receptor. There was no statistically significant effect on the transcription from 2×NRE-PV-Luc and 2 × NRE-CMV-Luc without expression of estrogen receptor. With treatments, the values of reporter gene (firefly) were increased slightly. The effects of ERα expression by cotransfection in Cos-1 cells on NF-κB–mediated transcription by xenoestrogens on 2×NRE-PV-Luc are presented in Figure 3. As presented in Figure 3, ERα cotransfection and treatment with estrogen (E₂) (1 nM: 26.6%; 5 nM: 41.5%), the antiestrogen ICI 182,780 (5 nM: 23%; 10 nM: 43.7%), E₂ + ICI 182,780 (1 nM E₂ + 10 nM ICI 182,780: 45.12%; 5 nM E₂ + 10 nM ICI 182,780: 32.5%), o′, p′-DDT(l nM: 17%; 10 nM: 7%), dieldrin (1 nM:10.3%; 10 nM: 36.1%), and methoxychlor (1 nM: 29.6%; 10 nM: 22.6%) produced transrepression from 2×NRE-PV-Luc.

The effect of E₂ and xenoestrogens on 2 × NRE-CMV-Luc–mediated transrepression of NF-κB by ERα are presented in Figure 4. The effects of transrepression of 2 x× NRE-CMV-Luc by estrogen cotransfection and xenoestrogens treatment are similar; however; the effect is comparatively higher as compared to 2×NRE-PV-Luc. ERα cotransfection led to repression by 1 nM E₂ (79.3%), 5 nM E₂ (69.1%), 1 nM o′, p′-DDT (51.4%), 1 nM dieldrin (47.3%), and 1 nM MXC (73.3%).

NF-κB Activity in Growing Cos-1 Cells

All studies were performed without induction of NF-κB activity of Cos-1 cells. The NF-κB activity can be induced by treatment with PMA (Han et al. 1999). In order to determine the activity of NF-κB in growing cells, EMSA studies were performed with nuclear extracts of Cos-1 cells with various treatments (Figure 5). Partial activation of NF-κB was observed because two bands were retarded with the nuclear extracts of Cos-1 cells. The retarded bands I and II in Cos-1 nuclear extract were competed out by 100 × cold oligos. As shown in Figure 5, treatment with various agents caused no appreciable change in NF-κB level (bands I and II). A PMA (1 μM × 6 h)–treated HepG2 cell extract served as the positive control. Retarded bands I and II were observed with PMA-induced HepG2 cell extract. Bands III and IV were present in HepG₂ whole-cell extracts and may be due to the dimerizations and heteromerization of bands I and II. It is evident that NF-κB is present in a partially activated form in growing Cos-1 cells, and this activation may be due to the presence of components in the serum.

DISCUSSION

A wide range of chemical compounds, including water-soluble phytoestrogens and lipid-soluble 2,3,7,8-tetra-chlorodibenzo-p-dioxin (TCCDs), furans, and biphenyls, have been demonstrated to possess the estrogenic activity (Connor et al. 1997; Klotz, Arnold, and McLachlan 1997; Kramer et al. 1997; Meyers, Lutfi, and Adler 1997; Moore et al. 1997; Chen et al. 1998; Maness, McDonnell, and Gaido 1998; Meek 1998; Stahl et al. 1998; Willey et al. 1998; Chang et al. 1999; Legler et al. 1999; Shiizaki et al. 1999; Turnbull et al. 1999; Charles et al. 2000; Hodges et al. 2000; Miller et al. 2000; Vinggaard et al. 2002). The estrogenic activity can be defined by either in vitro functional assay, or by an increase in the epithelial cells in uterus (Gray et al. 1989; Branham, Zehr, and Sheehan 1993). The functional assays typically involve estrogen receptor–mediated transcription (Connor et al. 1997; Klotz, Arnold, and McLachlan, 1997; Kramer et al. 1997; Meyers, Lutfi, and Adler 1997; Moore et al. 1997; Chen et al. 1998; Maness, McDonnell, and Gaido 1998; Meek 1998; Stahl et al. 1998; Chang et al. 1999; Legler et al. 1999; Shiizaki et al. 1999; Turnbull et al. 1999; Charles et al. 2000; Hodges et al. 2000; Miller et al. 2000; Vinggaard et al. 2002). These compounds have been defined as xenoestrogens because they have been found to activate transcription from estrogen response element(s) in the typical reporter assay system. In addition, the ability of these xenoestrogens to bind to estrogen receptors, especially to α-receptors, has been defined as RBA (relative binding affinity) values (Zacharewski 1998; Kuiper et al. 1997). The RBA values of the xenoestrogens, o′,p′-DDT, methoxychlor, and dieldrin are at least an order of magnitude lower than E₂ (Bolger et al. 1998). Therefore, based on their RBA values, these xenoestrogens are weaker and less effective when compared to the natural hormone E₂. With the advent of another receptor (ERβ) and its N-terminal variants (53 aminoacids in N-terminal), the paradigm of cellular responses of estrogen and xenoestrogens has undergone a significant change (Ogawa et al. 1998). Due to the expression of receptor subtypes, antiestrogens respond differently i.e., in MCF-7 cells, hERα is expressed, and the antiestrogen tamoxifen and ICI 164,384 behaves as an antiestrogen (Watanabe et al. 1997). In many other cell types where both ERα and ERβ are expressed, antiestrogens exert estrogenic responses in promoter reporter assays (Paech et al. 1997; Gaido et al. 1999; Ramamoorthy et al. 1999). The aforementioned finding necessitates the evaluation of estrogenic properties of selected xenoestrogen with complex scenarios of ERα and ERβ in various cell types and such an study is still in offing. It is known that estrogen not only signals via ERs but also it possesses a significant cross talk with other nuclear transcription factors, including NF-κB, AP-1, GC-rich SP1 and GATA transcription factors (Blobel, Sieff, and Orkin 1995; Blobel and Orkin 1996; Paech et al. 1997; Gaido et al. 1999; Mckay, Cidlowski 1999; Webb et al. 1999; Ramamoorthy et al. 1999; Saville et al. 2000). It is possible that the xenoestrogens may produce their effects not only by activation of their corresponding steroidal receptors such as ERα and/or its subtypes but can also produce effects via nuclear cross-talk with other members of nuclear transcription factors.

In this study, the effects of selected xenoestrogens were evaluated on NF-κB transcription by ERα co-transfection in Cos-1 cells. The selection of Cos-1 cells eliminates the possibility of presence of other ER-receptor or its variants. Two NF-κB response elements were subcloned upstream of SV₄₀ (no enhancer) and −242/+54 CMV promoter elements. Due to SV40 promoter, the activity of the reporter gene expressed by plasmid was appreciably high in Cos-1 cells, thus enabling the determination of the effects. The activity of the 2×NRE-PV-Luc plasmid in MCF-7 and the HeLa cell were very low. Presence of T antigen, and hence activation of SV40 promoter, and absence of estrogen receptors in Cos-1 cells were determinant for the selection of cells types exclusively for this assay. Because estrogen causes transrepression of NF-κB. the lower expression of firefly from 2×NRE-PV-Luc in HeLa and MCF-7 cells resulted into further repression. This did not permit any evaluation in HeLa and MCF-7 cells. The 2×NRE-PV-Luc exhibits appreciable activity (10⁶ RLUs) in Cos-1 cells, and permits the determination of the effects of estrogens, antiestrogen, and xenoestrogens. Similarly, 2×NRE-CMV-Luc also exhibits higher activity permitting the determination of the repression of transcription. Because CMV is a promiscuous promoter, 2×NRE-CMV-Luc can be used in other cell types for determination of transrepression of NF-κB activity.

The present study indicates that the selected xenoestrogens (o′,p′-DDT, methoxychlor, and dieldrin) transrepress the NF-κB transcription. The effects of these compounds are comparable to E₂. Because E₂ can activate transcription at 1.0- to 5.0-nM levels, the treatments were performed at these levels. Further observations indicate that transcription from estrogen response elements (1ERE-PV-Luc) in MCF-7 cells with or without ERα transfection (data not presented) are decreased at 10.0 nM E₂.

The level of expression of ERs is important in the determination of transrepression. Increasing the level of ERα by increasing the amount of plasmid DNAs in cotransfection did not result in further transrepression by treatment with either E₂ or xenoestrogens. Because CMV MIEP contains four NF-κB sites and the promoter is being used in the expression of hERα, the induction of NF-κ B in Cos-1 cells by PMA treatment could result in an appreciable higher expression of receptors (Michelson and Plotkin, 1993). The level of expression of hERα from CMV5-hERα due to various treatments is significant. As noted in Figure 2, the treatment with ICI 182,780 and methoxychlor (10 nM) resulted in an increased expression of hERα from CMV5-hERα. Although antiestrogen ICI 182,780 should have relieved the transpression, it fails to do so, possibly due to the increased expression of hERα. Because of this increased expression of estrogen receptors from the CMV MIEP, antiestrogen failed to relieve the repression. By increasing the amount of estrogen expression plasmid (pCMV5-hERα) in cotransfection lead to decreased activity in control. Therefore, treatments with estrogen and xenoestrogens fail to result in appreciable and significant repression. In order to successfully determine the transrepression activity of xenoestrogens on PMA-inducible NF-κB activity, the estrogen receptors should be expressed from an eukaryotic promoter that is not modulated by induction of NF-κB (PMA treatment).

It has been demonstrated that antiestrogen relieves the effects of E₂ in cell lines such as MCF-7 and HepG₂ (Nicholson et al. 1995). It is known that ICI 182,780 behaves as a true antiestrogen due to its antagonistic properties to both ERα and ERβ (Wakeling and Bowler 1992). These estrogens receptors transactivate the transcription with different coactivators and there is a limited pool of these coactivators inside the cells (Shibata et al. 1997. It has been demonstrated that p300/CBP (cAMP response element-binding protein [CREB]-binding protein) and CBP-associated factor (p/caf) are coactivators of estrogen receptors and nuclear factor-κB –mediated transcriptions (Shibata et al. 1997; Harnish et al. 2000). When ER transcription is activated, the pool of p300/CBP and p/caf is not sufficiently available for transactivation from NF-κB; therefore, the transcription from NF-κB is decreased (transrepressed). The antiestrogen ICI 182,780 should relieve the coactivator p300/CBP from the ER-assembled transcription complex and should make available p300/CBP and p/caf for NF-κB mediated transcription to proceed effectively. As observed in the present study, because ICI 182,780 causes increased expression of hERα, the coactivators may still be associated with ER. Due to nonavailability of coactivators, the NF-κB transcription is not free to proceed. However, other mechanisms of its effects cannot be ruled out. It has also been demonstrated that in rat ER, a group of certain amino acids are capable of interaction with NF-κB and hence can produce the transrepression effects (Valentine et al. 2000; Quaedackers et al. 2001). Moreover, estrogens and glucocorticoids have been found to repress NF-κB activity by increased IκB synthesis, but such a mechanism may be cell specific (Han et al. 1999; Quaedackers et al. 2001). It is concluded that these selected xenoestrogens with RBA < 100 times of E₂ are capable of transrepression of NF-κB transcription like E₂.