Ubiquitination and degradation of MGMT by TRIM72 increases the sensitivity of uveal melanoma cells to Dacarbazine treatment

Abstract

Uveal melanoma (UM) is the most common primary intraocular malignancy in adults with high metastasis rates. The O6-methylguanine DNA methyl transferase (MGMT) is involved in chemoresistance of Dacarbazine (DTIC) treatment. Our previous study found that the combination of oncolytic adenovirus H101 and DTIC in the treatment of UM cells shows a synergistic antitumor effect mainly though down-regulation of MGMT. MGMT knockdown by shRNAs increases the sensitivity of uveal melanoma cells to DTIC treatment. The protein hemostasis of MGMT is important for the antitumor effect of DTIC. Tripartite motif-containing protein 72 (TRIM72) belongs to the tripartite motif (TRIM) proteins family and was identified as a novel E3 ligase for MGMT, which interacts with and mediates the ubiquitination of MGMT. TRIM72 knockdown increases the protein levels of MGMT, while reduces the ubiquitination of MGMT. Further study indicated that MGMT is highly expressed in UM cells, and the protein levels of MGMT and TRIM72 shows a negative correlation. UM cells that ectopically expressing TRIM72 shows increased sensitivity to DTIC treatment, which is consistent with the antitumor affect exhibited by H101. These results suggest that TRIM72 is a promising therapeutic target for UM treatment.

Abbreviation

UM	Uveal melanoma
MGMT	O6-methylguanine DNA methyl transferase
DTIC	dimethyl-triazeno-imidazol carboxamide
MOI	multiplicities of infection
TRIM72	Tripartite motif-containing protein 72
TRIM	tripartite motif
IB	immunoblotting
Y2H	Yeast two-hybrid

Co-IP	Co-immunoprecipitation
IP	immunoprecipitation
CHX	cycloheximide
IPTG	isopropyl- $\beta$ -d-thiogalactopyranoside
E1	ubiquitin-activating enzyme
E2	ubiquitin-conjugating enzyme
E3	ubiquitin-protein ligase
Usp2cc	the catalytic core of human deubiquitinase
	Usp2

1. Introduction

Uveal melanoma (UM) is the most common primary intraocular malignancy in adults, and gives rise to metastases in 50% of cases [1, 2]. For the highly metastatic nature, it is an intractable disease with a low survival rates, despite adequate local treatment [3, 4]. Risk factors include light-coloured eyes, fair skin, congenital ocular melanocytosis, ocular melanocytoma and the BAP1-tumour predisposition syndrome [1]. Ocular treatment aims at preserving the eye and useful vision and, if possible, preventing metastases. Recently, surgery combined with chemotherapy, immune-therapy, gene therapy and other methods have been used to the treatment of UM [5].

Dacarbazine or DTIC (dimethyl-triazeno-imidazol carboxamide) is an alkylating agent, which results in DNA methylation, is commonly used to treat melanoma [6]. O6-methylguanine DNA methyl transferase (MGMT) is a DNA repair protein which transfers the methyl group from guanine to a cysteine residue, repairing the cytotoxic lesion induced by alkylating agents, such as DTIC [7]. The overexpression of MGMT is a key mechanism of cancers resist to alkylating agents [8]. In our previous studies, we found that combination of oncolytic adenovirus H101 and dacarbazine enhances antitumor ability against uveal melanoma cells through down-regulation of MGMT [9, 10].

Table 1

Sequences of the shRNAs for MGMT and TRIM72

shRNA	Target site sequence (5’3’)
Scramble	GCGCGATAGCGCTAATAATTT
shMGMT-1	TTACCAGCAATTAGCAGCCCT
shMGMT-2	AGCCTGGCTGAATGCCTATTT
shMGMT-3	GAGCAGGGTCTGCACGAAATA
shTRIM72-1	CAGACTGAGTTCCTCATGAAA
shTRIM72-2	CCAGCTGCCAATTATCTCAGA
shTRIM72-2	CCTCATGAAATACTGCCTGGT

Protein homeostasis is fundamental in normal cellular function and cell survival, and ubiquitination is an evolutionary conserved highly-orchestrated enzymatic cascade essential for normal cellular functions and homeostasis maintenance [11, 12, 13, 14]. The ubiquitination system relies on a defined set of cellular enzymes, among them, substrate-specific E3 ubiquitin ligases (E3s) are the most critical players [12]. Ubiquitination is involved in the regulation of many eukaryotic signaling pathways and aberrant ubiquitin signaling is currently an active area in cancer research [15]. So far, several mechanisms for the down-regulation of MGMT gene expression have been used in new strategies to decrease chemoresistance and enhance anti-tumor ability [16]. MGMT serves as an important target for cancer treatment. The regulation of MGMT protein homeostasis at post-translational level might be a promising field for uveal melanoma therapy.

In this study, TRIM72 was identified as a novel E3 ligase for MGMT, which mediates the ubiquitination and degradation of MGMT, thus favors the antitumor effect of DTIC. Therefore, TRIM72 may act as a potential therapeutic target for UM.

2. Materials and methods

2.1 Cell culture, transfection and treatment

The normal human pigment epithelial cell line ARPE-19 and three human uveal melanoma (UM) cell lines 92.1, MuM2B and OMM1 were kindly gifted from Professor Xianqun Fan (Shanghai Jiao Tong University, China). All these cells were cultured in DMEM medium, supplemented with 10% FBS and 100 U/mL penicillin and 100mg/mL streptomycin (all from Gibco, USA), in a 37 ${}^{\circ }$ C humidified atmosphere of 5% CO ${}_2$ . Plasmids were transiently transfected into UM cells using Lipofectamine 2000 (Life Technologies, USA) according to the manufacturer’s instructions and the stably transfected cell lines were screened by puromycin (2 $\mu$ g/mL, Thermofisher, USA). For chemicals or oncolytic adenovirus treatment, cells were treated with DTIC (5 $\mu$ g/ml, Nanjing Pharmaceutical Factory, China), H101 (from 25 to 200 multiplicities of infection (MOI), Shanghai Sunway Biotech, China) or cycloheximide (CHX, 100 $\mu$ g/ml, Selleck, China) for different time before harvesting, and then subjected to other analysis.

2.2 Plasmids construction

The shRNAs for MGMT and TRIM72 were synthesized as oligos (Sangon, China), annealed and inserted into the pLKO.1 vector that was digested with EcoRI and AgeI (NEB, USA), the specific sequences for shRNAs seen in Table 1. The plasmids containing TRIM72 and MGMT were amplified from the cDNA of human HEK293T cells, and inserted into pCDH, pCADNA3.0, pGBKT7, pET22B or pGEX4T-1 vector. The plasmids of MGMT mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, USA). Plasmids that expressing UBA1, UBCH5A, Ubiquitin and Usp2cc were kindly provided by Professor Yuexiang Wang (Chinese Academy of Sciences, Shanghai, China).

2.3 Cell viability assay

MuM2B or 92.1 cells were seeded into 96-well plates, and treated with DITC, H101, or both agents in combination. Cell viability was determined using Cell Counting Kit-8 (CCK8, Jiangsu, China) solution according to the manufacturer’s instructions at different time points, and the product was quantified spectrophotometrically at a wavelength of 450 nm using a microplate reader (Bio-Rad, USA). The absorbance is directly proportional to number of viable cells. The 0 h time point was defined as 6 h after the cells were seeded. All experiments were conducted with six replicates and repeated three times.

2.4 Yeast two-hybrid screening

The MGMT ORF (open reading frame) was cloned into pGBKT7, generating the bait plasmid, named pGBKT7-MGMT, which contained the in-frame fusion of GAL4 DNA binding domain. Yeast two-hybrid (Y2H) screening was performed by transforming yeast strain (Mav203 strain) that harbored bait vector, with the pACT2 prey vectors for human E3 ubiquitin-protein ligases cDNA expression library. Yeast transformants were first grown on to the plate on SD-2 (deficient in Leu, Trp) for selection of yeast cells containing both bait and prey vectors, and then transferred to SD-4 (deficient in Leu, Trp, His and Ura) plates to screen for E3 ligase proteins that potentially interact with human MGMT. The interaction was confirmed by transforming yeast Mav203 cells with the indicated bait and prey vectors, and allowing the transformants to grow on the SD-2 or SD-4 agar plates for approximately 3 days at 30 ${}^{\circ }$ C. Images of the colonies on both plates were recorded by camera.

2.5 Co-immunoprecipitation (Co-IP), immunoprecipitation and immunoblotting

For Co-IP, cells were lysed in 500 $\mu$ l Co-IP buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA and 1% NP-40, pH 7.5) supplemented with a protease inhibitor cocktail (Selleck, China). Subsequently, the cell lysates were centrifuged and incubated with anti-MGMT antibody (1:50 dilution; 17195-1-AP, Proteintech, USA) and Protein G agarose beads (L-1006, Biolinkedin Biotech, China). For immunoprecipitation, cells were lysed in 500 $\mu$ l immunoprecipitation buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 0.1% SDS and 1% NP-40, pH 7.4) supplemented with a protease inhibitor cocktail. Subsequently, the cell lysates were centrifuged and incubated with anti-MGMT antibody and Protein G agarose beads, or anti-Flag affinity gels (IK-1013, Biolinkedin Biotech, China) overnight at 4 ${}^{\circ }$ C. The immunoprecipitates were enriched and denatured at 100 ${}^{\circ }$ C for 15 min in 2x SDS-PAGE loading buffer (40 $\mu$ l). The inputs, immunoprecipitates and other cell lysates were subjected to 10% SDS-PAGE, and transferred to a PVDF membrane (Bio-Rad). The membranes were blocked with 10% skimmed milk at room temperature (RT) for 1 h, and immunoblotted with the specified antibodies as follows: anti-TRIM72 (1:1000 dilution; 22151-1-AP, Proteintech), anti-MGMT, anti-Myc (1:3000 dilution; 10828-1-AP, Proteintech), anti-HA (1:1000 dilution; 51064-2-AP, Proteintech), anti-Flag (1:4000 dilution; 80010-1-RR, Proteintech), anti-UB (ubiquitin) (1:500 dilution; sc-47721, Santa Cruz, USA), anti-GST (1:5000 dilution; HRP-66001, Proteintech), and anti-GAPDH (1:5000 dilution; 60004-1-Ig, Proteintech). Then the membranes were incubated with HRP conjugated goat anti-mouse IgG (1:5000 dilution; SA00001-1, Proteintech) or Goat anti-rabbit IgG (1:5000 dilution; SA00001-2, Proteintech) secondary antibodies, and the signals were visualized using a Tanon 5200 Imaging System (Tanon, China).

2.6 Expression and purification of recombinant proteins

Recombinant proteins were purified as previously described [17]. Briefly, His6- or GST-tagged proteins were expressed in BL21 E.coli cells. After 400 mM isopropyl- $\beta$ -d-thiogalactopyranoside (IPTG, Sangon, China) induction, the cells were pelleted, lysed in PBS buffer and incubated with glutathione or Ni ${}^{2+}$ TA beads (Sangon) to enrich the respective proteins, followed by elution with 20 mM L-glutathione reduced or 400 mM imidazole (Sangon) dissolved in PBS buffer, and then dialysis in PBS buffer supplemented with 10% glycerol before being aliquoted and preserved at $-$ 80 ${}^{\circ }$ C.

2.7 GST pull-down assay

Purified His6 tagged proteins (25 $\mu$ g), GST tagged proteins (25 $\mu$ g), and Glutathione Sepharose4B (IK-1014, Biolinkedin Biotech) were incubated at 4 ${}^{\circ }$ C overnight in 800 ml GST pull-down buffer (20 mM Tris-Cl, 100 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 1% NP-40, 10 mg/mL of BSA, pH 7.4). The beads were then pelleted and washed five times with the GST pull-down buffer. The recovered immunoprecipitates were boiled in 2xSDS-PAGE loading buffer (40 $\mu$ l) and detected by immunoblotting analysis using the indicated antibodies.

2.8 In vitro ubiquitination assay

In vitro ubiquitination assays were performed as previously described [18]. Briefly, recombinant 100 ng His6-Ub, 100 ng UBA1-His6 (E1), 100 ng UBCH5A-His6 (E2), 300 ng Gst-TRIM72 (E3) and 300 ng MGMT-His6 proteins were added to ubiquitination buffer (25 mM Tris-Cl, 100 mM NaCl, 1 mM DTT, 5 mM MgCl ${}_2$ , 2 mM ATP, pH 7.4) with a final reaction volume of 30 $\mu$ l and incubated at 37 ${}^{\circ }$ C for 1.5 h. The ubiquitination levels of proteins were examined by immunoblotting assay using an anti-MGMT antibody.

2.9 Statistical analysis

The data were analyzed by one-way ANOVA with Tukey’s post-hoc test using GraphPad Prism 5 (GraphPad Software Inc., San Diego, USA). A $p$ value less than 0.05 is considered to be significant difference, and less than 0.01 is considered to be very significant difference.

3. Results

3.1 Down-regulation of MGMT by oncolytic adenovirus (H101) or shRNAs enhances the sensitivity of uveal melanoma (UM) cells to Dacarbazine (DTIC) treatment

Our previous studies found that combination of oncolytic adenovirus H101 and dacarbazine (DTIC) enhances antitumor ability against uveal melanoma cells through downregulation of MGMT [9, 10]. This phenomenon was confirmed in two other uveal melanoma cell lines, as showed in Fig. 1A, combination of H101 and DTIC enhanced the antitumor ability against 92.1 and MuM2B cells. The protein levels of MGMT mainly down-regulated by H101 but not DTIC (Fig. 1B), and we also found that down-regulation of MGMT expression by H101 in a dose dependent manner (Fig. 1C). To further investigate the role of MGMT in uveal melanoma, three shRNAs targeting MGMT were designed and tested in 92.1 and MuM2B cells. Immunoblotting analysis indicated that MGMT was significantly decreased in cells stably transfected with shMGMT-1 and shMGMT-3 (Fig. 1D), and these two shRNAs were selected for further study. The cell viability of 92.1 and MuM2B cells that stably expressing MGMT shRNAs, treated with DTIC or not, was detected by the CCK-8 assay at different time points, and the results indicated that MGMT knockdown increased the sensitivity of uveal melanoma cells to DTIC treatment (Fig. 1E).

Figure 1.

Down-regulation of MGMT by oncolytic adenovirus (H101) or shRNAs enhances the sensitivity of uveal melanoma (UM) cells to Dacarbazine (DTIC) treatment. (A) Combination of H101 and DTIC enhanced the antitumor ability against UM cells. Cell viability of PBS (Control), DTIC (5 $\mu$ g/ml), H101 (50 MOI), and DTIC $+$ H101 on 92.1 and MUM2B cells were detected by the CCK-8 assay at 24, 48 and 72 hours after treatment, and the 0 h time point was defined as 6 hours after the cells were seeded. Cytotoxicity was calculated as the cell viability of drug treated groups compared to PBS group, and the data were expressed as mean $\pm$ SD and analyzed using one-way ANOVA with Tukey’s post-hoc test. ${}^{*}P<$ 0.05, significantly different; ${}^{**}P<$ 0.01, very significantly different, three independent experiments. MOI, multiplicities of infection. DITC, dimethyl-triazeno-imidazol carboxamide; H101, oncolytic adenovirus H101. (B) Down-regulation of MGMT expression by H101 in UM cells. 92.1 and MUM2B cells were treated with PBS (Control), DTIC, H101, or DTIC $+$ CH101 for 48 hours, and subjected to immunoblotting analysis using indicated antibodies. IB, immunoblotting. (C) Down-regulation of MGMT expression by H101 in a dose dependent manner in UM cells. 92.1 and MUM2B cells were treated with different dose H101 (25, 50, 100 and 200 MOI) for 48 hours, and subjected to immunoblotting analysis using indicated antibodies. (D) The knockdown efficiency of shRNAs targeting MGMT was tested by immunoblotting analysis. The shRNAs for MGMT were transfected into 92.1 and MUM2B cells and then puromycin selection (2 $\mu$ g/ml) was used to establish stable expressing cell lines. The levels of MGMT were detected by immunoblotting analysis. (E) MGMT knockdown increased the sensitivity of uveal melanoma cells to DTIC treatment. 92.1 and MUM2B cells stably expressing MGMT shRNAs were seeded into 96-well plates, treated with DTIC (5 $\mu$ g/ml) or not, and the cell viability were detected using the CCK-8 assay at the indicated time points. The data were expressed as mean $\pm$ SD and analyzed using one-way ANOVA with Tukey’s post-hoc test. ${}^{*}P<$ 0.05, significantly different; ${}^{**}P<$ 0.01, very significantly different, three independent experiments.

Figure 2.

TRIM72 interacts with MGMT. (A) Yeast two-hybrid (Y2H) screening identified TRIM72 as an interacting partner for MGMT. MGMT was used as a bait. SD-2, deficient in Leu and Trp; SD-4, deficient in Ura, His, Leu and Trp. (B) Endogenous TRIM72 interacted with MGMT in UM cells. The lysates of 92.1 cells were immunoprecipitated with anti-IgG or anti-MGMT antibody, and subjected to immunoblotting analysis. (C) TRIM72 interacted with MGMT in vitro. Recombinant GST-tagged TRIM72 and His6-tagged MGMT were purified, and then GST pull-down assays were performed and subjected to immunoblotting analysis. PD, GST pull-down. (D) The N-terminal region of MGMT directly interacted with the RING domain of TRIM72. GST pull-down assays were performed with indicted recombinant GST tagged TRIM72, MGMT or their fragments, and His6 tagged TRIM72 or MGMT. RING, RING (short for Really Interesting New Gene) domain; B-BOX, B-Box-type zinc finger domain; PRYPSRY, the conserved B30.2/SPRY domain for TRIM proteins.

Figure 3.

TRIM72 mediates the ubiquitination and degradation of MGMT. (A) The knockdown efficiency of shRNAs targeting TRIM72 was tested by immunoblotting analysis. The shRNAs for TRIM72 were transfected into 92.1 cells, and puromycin selection was used to establish stable expressing cell lines. The levels of TRIM72 were detected by immunoblotting analysis. (B) TRIM72 knockdown increased the protein levels of MGMT. The lysates of 92.1 cells that stably expressing with TRIM72 shRNAs were subjected to immunoblotting analysis with indicated antibodies. (C) TRIM72 promoted the degradation of MGMT in a dose-dependent manner. 92.1 cells that transiently transfected with different amounts of pCDNA3.0-TRIM72-Myc or empty vectors were subjected to immunoblotting analysis using indicated antibodies after treatment with 100 $\mu$ g/ml CHX for 6 hours. CHX, full name is cycloheximide, a protein synthesis inhibitor. (D) TRIM72 knockdown reduced the ubiquitination of endogenous MGMT. The lysates of 92.1 cells stably expressing TRIM72 shRNAs were immunoprecipitated with anti-MGMT antibody and subjected to immunoblotting analysis using indicated antibodies. IP, immunoprecipitation. (E) TRIM72 mediated the ubiquitination of MGMT in vitro. An in vitro ubiquitination assay was carried out using the recombinant MGMT-His6, UBA1 (E1), UBCH5A (E2) and TRIM72 (E3), together with the indicated components, and then detected by immunoblotting analysis using anti-MGMT antibody. E1, ubiquitin-activating enzyme; E2, ubiquitin-conjugating enzyme; E3, ubiquitin-protein ligase; Usp2cc, the catalytic core of human deubiquitinase Usp2. (F) Three Lys (K) residues (K3, K8 and K18, shown in red color) were the major sites for TRIM72 mediated ubiquitination of MGMT. Lysates of 92.1 cells ectopically expressing Ha-UB, TRIM72-Myc, and MGMT-Flag or the indicated K-to-R (Lysine to Arginine) mutants were subjected to immunoprecipitated using anti-Flag affinity gels followed by immunoblotting analysis using indicated antibodies. K3-8-18R, K3R+K8R+K18R. (G) TRIM72 mediated the degradation of wild type MGMT but not K3-8-18R mutant. The lysates of 92.1 cells that co-transfected with TRIM21-Myc, and MGMT-Flag or MGMT (K3-8-18R)-Flag were subjected to immunoblotting analysis using indicated antibodies after treatment with CHX (100 $\mu$ g/ml) for 6 hours.

Figure 4.

Ectopically expressing TRIM72 in UM cells increases their sensitivity to DTIC treatment. (A) Protein profile of TRIM72 and MGMT in human pigment epithelial cell line (ARPE-19) and uveal melanoma cell lines (92.1, MuM2B and OMM1) detected by immunoblotting analysis. (B) The protein levels of TRIM72 and MGMT in UM cells stably expressing TRIM72 were detected by immunoblotting analysis. 92.1 and MuM2B were transfected with empty vectors (PCDH) or vectors that expressing TRIM72 (PCDH-TRIM72), and puromycin selection was used to establish stable expressing cell lines. (C) Ectopically expressing TRIM72 in UM cells increases their sensitivity to DTIC treatment. 92.1 and MUM2B cells stably expressing TRIM72 were seeded into 96-well plates, treated with DTIC (5 $\mu$ g/ml) or not, and the cell viability were detected using the CCK-8 assay at the indicated time points. The data were expressed as mean $\pm$ SD and analyzed using one-way ANOVA with Tukey’s post-hoc test. ${}^{*}P<$ 0.05, significantly different; ${}^{**}P<$ 0.01, very significantly different, three independent experiments. (D) A model depicting how TRIM72 mediates ubiquitination and degradation of MGMT enhances DTIC anti-tumor effect in uveal melanoma cells.

3.2 TRIM72 interacts with MGMT

To explore how the homeostasis of MGMT protein is regulated in UM cells, yeast two-hybrid (Y2H) screening was performed to identify the potential E3 ligase for MGMT. Three proteins that interacted with MGMT were identified, and they are HACE1, MARCH2 and TRIM72. HACE1 and SYVN1 proteins are mainly located in the cytoplasm, while TRIM72 and MGMT mainly located in the nucleus of cells (The human Protein Atlas database), so TRIM72 was selected for further study. TRIM72 was identified as an interacting partner for MGMT and validated in yeast cells (Fig. 2A). Co-immunoprecipitation (Co-IP) assay showed that endogenous TRIM72 formed complexes with MGMT in 92.1 cells (Fig. 2B), and GST pull-down assay indicated that TRIM72 directly interacted with MGMT in vitro (Fig. 2C). Further study found that the N-terminal region of MGMT directly interacted with the RING domain of TRIM72 (Fig. 2D).

3.3 TRIM72 mediates the ubiquitination and degradation of MGMT

To explore the effect of TRIM72 on MGMT protein homeostasis, three shRNAs targeting TRIM72 were designed and tested in 92.1 cells. As showed in Fig. 3A, TRIM72 was significantly decreased in cells stably transfected with shTRIM72-1 and shTRIM72-2, and these two shRNAs were selected for further study. The protein levels of MGMT were obviously increased in TRIM72 knockdown 92.1 cells compared with the scramble group (Fig. 3B), and further study found that TRIM72 promoted the degradation of MGMT in a dose-dependent manner (Fig. 3C). Ubiquitination assay indicated that TRIM72 knockdown reduced the ubiquitination of endogenous MGMT in 92.1 cells (Fig. 3D). An in vitro ubiquitination assay was performed with indicated recombinant proteins, UBA1 as the ubiquitin-activating enzyme (E1), UBCH5A as the ubiquitin-conjugating enzyme (E2) and TRIM72 as the ubiquitin-protein ligase (E3), together with other components. Only when E1, E2 and E3 were all present, the ubiquitination of MGMT could be detected, and this signal efficiently eliminated by Usp2cc which is the catalytic core of human deubiquitinase Usp2 (Fig. 3E). Ubiquitin is usually covalently attached to the lysine (K) residues of targeting proteins, and there are five lysine (K) residues in the N-terminal region of MGMT which is essential for TRIM72 binding. Three Lys residues (K3, K8 and K18, shown in red color) in MGMT turned out to be the major sites for TRIM72 mediated ubiquitination in 92.1 cells, as the MGMT mutants that bears these individual Lys-to-Arg (K-to-R) substitutions showed attenuated ubiquitination, while the mutant bearing simultaneous K-to-R substitutions (K3-8-18R) at the three Lys residues almost totally abolished TRIM72 mediated ubiquitination on MGMT (Fig. 3F). Further study indicated that TRIM72 mediated the degradation of wild type MGMT but not K3-8-18R mutant in 92.1 cells (Fig. 3G), which again demonstrated the authenticity of these three sites.

3.4 Ectopically expressing TRIM72 in UM cells increases their sensitivity to DTIC treatment

Protein profile indicated that the expression of MGMT was higher in the three UM cell lines (92.1, MuM2B and OMM1) compared to the normal human pigment epithelial cell line (ARPE-19), while TRIM72 showed lower expression levels in UM cells compared to ARPE-19 (Fig. 4A). 92.1 and MuM2B cells that stably expressing TRIM72 were constructed, and the protein levels of TRIM72 and MGMT showed negative correlation (Fig. 4B). The cell viability of 92.1 and MuM2B cells that stably expressing TRIM72, treated with DTIC or not, was detected by the CCK-8 assay at different time points, and showed that ectopically expressing TRIM72 in UM cells increases their sensitivity to DTIC treatment (Fig. 4C).

4. Discussion

In this study, we found that combination of oncolytic adenovirus H101 and dacarbazine (DITC) enhances antitumor ability against 92.1 and MuM2B cells (Fig. 1A), which was consistent with our previous studies [9, 10]. H101 decreased the expression of MGMT was again verified (Fig. 1B), which enhanced the antitumor effect of DITC. The down-regulation of MGMT expression by H101 in a dose dependent manner and 50 MOI seems to be the most cost-effective concentration for UM treatments in this study (Fig. 1C).

H101, an oncolytic adenovirus with no E1B and portions of E3 regions, is designed to replicate in tumor cells that have inactivated p53 [9]. The p53 gene rarely has mutation in patients with UM and UM cell lines including 92.1 cells [19] which were involved in our study, while MuM2B cells carrying mutated p53 [20], but H101 showed antitumor effect on both of them, which was consistent with other studies that the replication of H101 may be independent of p53 [21, 22].

MGMT knockdown showed the enhanced sensitivity of UM cells to DTIC treatment (Fig. 1E), which was similar to the antitumor effect of H101 combined with DTIC. The down-regulation of MGMT serves as an important method for UM therapy. TRIM72 belongs to the tripartite motif (TRIM) proteins family, and accumulating studies indicate that these proteins regulate various biological processes [23], which was identified as a new E3 ligase for MGMT ubiquitination and degradation (Figs 2 and 3). TRIM72 interacts with and ubiquitinates the N-terminal region of MGMT that contains methyltransferase domain (Fig. 2D and F), so we speculate that the ubiquitination modification will also affect its catalytic activity, which need to be further study.

The expression of MGMT shows a significant association with DTIC chemoresistance. According to previous studies, high MGMT expression levels in tumor cells usually means pronounced resistance to DTIC [24, 25]. The expression of MGMT was higher in the three UM cell lines compared to the normal human pigment epithelial cell line (ARPE-19), while TRIM72 showed lower expression levels in UM cells compared to ARPE-19 (Fig. 4A). In UM cells, TRIM72 knockdown increased the protein levels of MGMT, while TRIM72 overexpression reduced the protein levels of MGMT (Figs 3B and 4B). UM cells that ectopically expressing TRIM72 showed increased sensitivity to DTIC treatment (Fig. 4C), which was consistent with the antitumor affect exhibited by H101. Thus TRIM72 acts as a promising therapeutic target for UM treatment, and an ongoing effort is to test the function of TRIM72-MGMT axis in animal models and patient sample.

5. Conclusions

The combination of oncolytic adenovirus H101 and DTIC in the treatment of UM cells shows a synergistic antitumor effect mainly though down-regulation of MGMT. TRIM72 was identified as a novel E3 ligase for MGMT, which interacts with and mediates the ubiquitination of MGMT. Ectopically expressing TRIM72 shows enhanced sensitivity to DTIC treatment, which was consistent with the antitumor affect exhibited by H101 (Fig. 4D).

Author contributions

Conception: Ping Chen and Biyun Cun.

Interpretation or analysis of data: Xun Li, Cong Yang, Ning Luo, Yunzhi Yang and Yan Guo.

Preparation of the manuscript: Ping Chen and Biyun Cun.

Revision for important intellectual content: Xun Li, Cong Yang, Ping Chen and Biyun Cun.

Supervision: Ping Chen and Biyun Cun.

Data availability

All the data generated or analyzed during this study are included in this published article and materials are available for other researchers after the manuscript is published.