Sage Journals: Discover world-class research

Abstract

BACKGROUND:

To investigate the influences of HOX transcript antisense ribonucleic acid (HOTAIR) on the proliferation and apoptosis of glioblastoma cells by targeting micro RNA (miR)-219.

OBJECTIVE:

With glioblastoma cell line U87 as the object, the changes in expression levels of HOTAIR and miR-219 in each group were detected via quantitative real-time polymerase chain reaction (qRT-PCR) after HOTAIR in U87 cell lines was knocked down using small interfering RNA (siRNA). Then the cell proliferation in each group was determined using Cell Counting Kit-8 (CCK-8) and colony formation assays. Flow cytometry was applied to detect the cell apoptosis, and Western blotting assay was adopted to measure the changes in protein levels of Cyclin D1 and Bcl-2-associated X protein (Bax). After miR-219 knockdown with siRNA, the changes in expression levels of HOTAIR and miR-219 in each group were examined through qRT-PCR, and the cell proliferation was tested by CCK-8 assay.

RESULTS:

After interference inHOTAIR using siRNA, compared with those in control group, the RNA expression level of HOTAIR was decreased remarkably ( $p<$ 0.05), the RNA expression level of miR-219 was increased notably ( $p<$ 0.05), the cell proliferation rate was inhibited evidently ( $p<$ 0.05), the apoptosis rate was enhanced obviously ( $p<$ 0.05), the protein expression level of Cyclin D1 declined markedly ( $p<$ 0.05), and the protein expression level of Bax rose distinctly ( $p<$ 0.05) in HOTAIR-siRNA group. After miR-219 knockdown with siRNA, the cell proliferation rate was raised remarkably ( $p<$ 0.05), but there was no significant change in the RNA expression level of HOTAIR ( $p>$ 0.05).

CONCLUSION:

HOTAIR can repress the proliferation and promote the apoptosis of glioblastoma cells by targeting miR-219.

Keywords

HOTAIR miR-219 glioblastoma proliferation and apoptosis

1. Introduction

Brain glioma, derived from the deterioration and progression of neuroepithelial cells, is the most common malignant tumor in the central nervous system of adults, with an extremely high fatality rate. The 5-year survival rate of the patients with malignant brain glioma is merely 5%, and the disease is characterized by infiltrative growth, easy recurrence, poor prognosis, etc. [1]. According to the WHO morphological classification criteria, brain glioma is classified into four grades and many types, and the prognosis of conventional chemoradiotherapy varies greatly from case to case due to different malignancies. In addition, the molecular mechanisms of the occurrence and development of various types of glioma, primary glioma and recurrent glioma differ from one to another. Therefore, it is urgent to develop new typing standards for molecular pathology to guide clinical treatment and personalized medicine and improve patient’s survival time and quality of life [2].

There are increasingly more reports about long non-coding ribonucleic acids (lncRNAs), a category of RNAs without protein coding capacity and with diversified physiological functions [3]. Currently, more attention has been paid to the role of lncRNAs in tumors [4, 5]. LncRNAs are found to play important regulatory roles in modulating transcriptionally and post transcriptionally the coding transcriptome, which are involved in pathological conditions such as cancer [6, 7]. Studies have discovered that lncRNA HOX transcript antisense RNA (HOTAIR) is highly expressed in different tumor tissues [8], but the role and regulatory mechanism of HOTAIR in gliomas remain unclear. In addition, a growing number of research reports have manifested that many micro RNAs (miRNAs) exert vital effects in the occurrence and development of tumors [9]. Among them, a study reported that miR-219 acts as an anti-oncogene in the progression of small cell lung cancer [10]. However, the function of HOTAIR in gliomas and the regulatory relationship between HOTAIR and miR-219 have not been clarified.

In this study, the expression level of HOTAIR in glioma cell line U87 was interfered, and the related mechanism of HOTAIR in the proliferation and apoptosis of glioblastoma cells by targeting miR-219 was explored, so as to investigate whether it possesses research prospect and important significance for the clinical diagnosis and treatment of glioma.

2. Materials and methods

2.1 Reagents and instruments

Cell Counting Kit-8 (CCK-8) (MSU, Sigma, USA), RNA extraction kit (Invitrogen Life Technologies, Car-lsbad, CA, USA), quantitative real-time polymerase chain reaction (qRT-PCR) kit and TUNEL assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), primer synthesis kit (Hanbio Biotechnology Co., Ltd., Shanghai, China), Annexin V/propidium iodide (AV/PI), bicinchoninic acid (BCA) protein assay kit and lysis buffer (Hanbio Biotechnology Co., Ltd., Shanghai, China), and Cyclin D1, Bcl-2-associated X protein (Bax) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primary antibodies (Cell Signaling Technology Inc, Shanghai, China).

2.2 Cell culture and transfection

Glioblastoma cell line U87 was cultured in an incubator with 5% CO ${}_{2}$ at 37 ${}^{\circ}$ C. When the fusion was about 80%, the cell line was digested with trypsin into single-cell suspension, followed by inoculation and culture in corresponding culture plates for subsequent experiments and use. Then the cells were transfected with HOTAIR-small interfering RNA (siRNA) and negative control (NC)-siRNA or miR-219 inhibitor separately when the confluence was 60–70%. Cells were cultured until they reached 10 ${}^{5}$ cells/ml in 6-well plates prior to transfection. In the meantime, at one day before transfection, the control group cells were plated at the same density as the si-HOTAIR and si-NC groups, or miR-219 inhibitor and inhibitor-NC groups. The cells were transfected using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer’s instructions. After that, the cells were incubated in the incubator again.

2.3 Detection of U87 cell proliferation activity via CCK-8

At 48 h after cell transfection, CCK-8 was applied to detect the activity of cell proliferation. The cells (1 $\times$ 10 ${}^{5}$ /mL) were inoculated into a 96-well plate, with 100 $\mu$ L in each well. 3 wells were repeated in each group, and the liquid was replaced at 48 h after culture and incubation at 37 ${}^{\circ}$ C with 5% CO ${}_{2}$ . Subsequently, 10 $\mu$ L of CCK-8 detection solution was added into each well, and, 30 min later, the optical density at the wavelength of 562 nm was measured in each well using a microplate reader.

2.4 Detection of apoptosis rate of U87 cells via flow cytometry

At 60–70% confluence in a 6-well plate, the U87 cells were transfected for 48 h, and the cells were digested with trypsin and then harvested. Later, 300 $\mu$ L of binding buffer was added and mixed sufficiently by gentle shaking, and 5 $\mu$ L of AV and 5 $\mu$ L of PI were added into each tube for incubation at room temperature for 15 min. Next, the cell apoptosis was determined using a flow cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, USA).

2.5 Colony formation assay

When the U87 cell fusion in the 6-well plate reached 60–70%, the cells were transfected with siRNA, followed by trypsin digestion and collection. The cells were then seeded in 6-well plates at 200 per well and incubated for 2 weeks at 5% CO ${}_{2}$ , 37 ${}^{\circ}$ C for the colony formation assay. The cells were then washed twice with PBS, fixed with methanol/acetic acid (3:1, v/v), and stained with 0.5% crystal violet (Sigma, St Louis, MO, USA). The number of colonies was counted under the microscope (Olympus IX81, Tokyo, Japan).

Table 1
Primer sequences for RT-PCR

Gene name	Primer name	Primer sequence
HOTAIR	Forward primer	GACGGAGGTTGAGA TGAAGG
	Reverse primer	ATTCGGGGCTGTAGTCCT
MiR-219	Forward primer	5 ${}^{\prime}$ -ACGCACGACGTCTTCCAGTA-3 ${}^{\prime}$
	Reverse primer	5 ${}^{\prime}$ -CCACCTGGTTCAACTCACTCC-3 ${}^{\prime}$
U6	Forward primer	GGATATTGTTGCCATCAATGACC
	Reverse primer	AGCCTTCTCCATGGTGGTGAAGA

2.6 etection of expression levels of relevant RNAs via qRT-PCR

A total of 500 $\mu$ L of TRIzol was added into each well of the treated 6-well plate, and chloroform was added after placing for 5 min and shaken vigorously for 15 s, followed by standing for 15 min. Then the aqueous phase layer was transferred into a new batch of Eppendorf (EP) tubes, added with isopropyl alcohol and centrifuged after inverting for several times. The white precipitate at the bottom of the tube was RNA, which was washed and dissolved in water to measure the concentration and purity, with the absorbance (A) ${}_{260}$ /A ${}_{280}=$ 1.8–2.0 as eligible. Next, the RNA was reversely transcribed into cDNA, and the mRNA expression level was detected via fluorescence qRT-PCR. The primer sequences are shown in Table 1. Reaction conditions: at 94 ${}^{\circ}$ C for 5 min, followed by 40 cycles of amplification at 94 ${}^{\circ}$ C for 30 s, 57 ${}^{\circ}$ C for 30 s and 72 ${}^{\circ}$ C for 30 s, and at 72 ${}^{\circ}$ C for 5 min. Microsoft Excel was utilized for data processing. With GAPDH gene as the reference gene, the relative expression levels of target genes were calculated by means of 2 ${}^{-\Delta\Delta Ct}$ method according the following formulas: $\Delta$ Ct (target gene) $=$ Ct (target gene) $-$ Ct (reference gene), $\Delta\Delta$ Ct $=\Delta$ Ct (target gene) $-\Delta$ Ct (standard value).

2.7 Western blotting assay

Each well of the treated 6-well plate was added with 100 $\mu$ L of RIPA lysis buffer for lysis on ice for 20 min. Then the cells were scrapped and centrifuge at 12,000 rpm and 4 ${}^{\circ}$ C for 10 min, and the supernatant was collected into another batch of new EP tubes. Subsequently, the concentration of extracted protein was measured and quantified using the BCA kit. 20 $\mu$ g of proteins were taken for Western blotting assay, and the proteins isolated through electrophoresis were transferred onto a PVDF membrane in the electrophoresis buffer under a voltage. Next, the membrane was sealed in 5% skim milk at room temperature for 2 h and then incubated in an antibody incubation box containing primary antibodies (1:1000) at 4 ${}^{\circ}$ C overnight after washing on a shaking table. After the membrane was washed adequately with Tris-Buffered Saline-Tween (TBST), secondary antibodies (1:5000) were added and incubated at room temperature for 1 h, followed by image development with ECL in a dark room and scanning and recording using a gel imager (Bio-Rad Laboratories, CA, USA). Finally, the grayscale was analyzed and compared with GAPDH as the internal reference.

2.8 Statistical analysis

The data were presented as mean $\pm$ standard deviation, and SPSS 17.0 (International Business Machines Corporation, USA) was adopted for data processing. One-way analysis of variancewas used for statistical analysis of data obtained. $p<$ 0.05 suggested that the difference was statistically significant. All experiments were carried out in triplicates.

3. Results

3.1 Impact of HOTAIR on miR-219 after interference with siRNA

According to Fig. 1, after interference in HOTAIR, the RNA level of HOTAIR was decreased obviously ( $p<$ 0.01), while the RNA level of miR-219 was increased markedly ( $p<$ 0.01) compared with those in control group at 24, 48, 72 h post transfection, suggesting that HOTAIR can negatively regulate the expression of miR-219. We then evaluated the effect of HOTAIR after transfection for 48 h.

Figure 1.

The expressions of HOTAIR and miR-219 in U87 cells detected via qRT-PCR after si-HOTAIR was transfected for 24, 48, 72 hs. A, the relative expression of HOTAIR. B, the relative expression of miR-219. * $p<$ 0.05 vs. Blank control.

3.2 Impact of HOTAIR on cell proliferation activity after interference with siRNA

The results of CCK-8 assay manifested that the cell proliferation activity was weakened remarkably after the interference in HOTAIR in comparison with that in control group ( $p<$ 0.01), indicating that HOTAIR can significantly influence the proliferation activity of U87 cells (Fig. 2).

Figure 2.

Cell proliferation activity after interference in HOTAIR detected via CCK-8, ** $p<$ 0.01 vs. NC.

3.3 Impact of HOTAIR on cell proliferation activity after interference with siRNA detected via colony formation assay

After the interference in HOTAIR in U87 cells, HOTAIR-siRNA group had evidently fewer macroscopic colonies formed in the culture dishes than NC-siRNA group (Fig. 3).

Figure 3.

Impact of interference in HOTAIR on proliferation activity in U87 cells detected via colony formation assay. Photomicrographs of Giemsa-stained colonies of U87 cells growing in 6-well plates for 14 days after infection. The number of cells in each colony was counted. Cell number in HOTAIR-siRNA group was significantly reduced, as compared with the NC-siRNA group. * $p<$ 0.01vs. NC-siRNA.

3.4 Impact of HOTAIR on cell apoptosis after interference with siRNA detected via flow cytometry with AV/PI

The number of apoptotic U87 cells was increased notably after the interference in HOTAIR compared with that in control group ( $p<$ 0.01), illustrating that HOTAIR is significantly correlated with U87 cell apoptosis (Fig. 4).

Figure 4.

Impact of HOTAIR on cell apoptosis after interference with siRNA detected via flow cytometry, ** $p<$ 0.01 vs. NC.

Figure 5.

Impacts of HOTAIR on Cyclin D1 and Bax proteins after interference with siRNA detected via Western blotting, ** $p<$ 0.01 vs. NC.

3.5 Impacts of HOTAIR on Cyclin D1 and Bax proteins after interference with siRNA detected via Western blotting

According to the results of Western blotting assay (Fig. 5), in comparison with those in control group, the protein expression level of Cyclin D1 declined markedly ( $p<$ 0.01), but that of Bax rose distinctly ( $p<$ 0.01) after the interference in HOTAIR in U87 cells.

3.6 Impact of miR-219 on RNA expression of HOTAIR after interference with siRNA

The RNA expression of miR-219 was lowered prominently after the interference in miR-219 with inhibitor at different time points, suggesting that the interference was successful. However, there was no significant difference in the RNA expression level of HOTAIR between control group and miR-219 inhibitor group ( $p>$ 0.01) (Fig. 6).

Figure 6.

The expressions of HOTAIR and miR-219 in U87 cells detected via qRT-PCR after miR-219 inhibitor was treated for 24, 48, 72 hs.A, the relative expression ofmiR-219. B, the relative expression of HOTAIR. * $p<$ 0.05, compared to Blank control.

3.7 Impact of miR-219 on cell proliferation rate after interference with siRNA detected via CCK-8

The results of CCK-8 assay showed that the proliferation rate of glioma U87 cells in miR-219 inhibitor group after interference with siRNA was markedly higher than that in control group ( $p<$ 0.01) (Fig. 7).

Figure 7.

Impact of miR-219 on cell proliferation rate after interference with siRNA, ** $p<$ 0.01 vs. control group.

4. Discussion

Glioblastoma mostly occurs in adults and has the highest incidence rate among the primary intracranialmalignancies [11]. The treatment effect on glioblastoma is not optimistic in present clinical practices, and even today’s most standard treatment methods, including surgical procedure, radiotherapy and chemical drugs, for such tumor patients still cannot realize objective survival time. Hence, actively exploring the targeted therapeutic drugs or methods with conspicuous efficacy is of important significance.

HOTAIR is first discovered in HOX gene in human fibroblasts [12]. The highly conserved HOX gene not only participates in cell growth and development but also receives signals to regulate the cell differentiation and apoptosis [13]. It has been reported that HOTAIR is involved in the lining of some chromosomes, which is closely associated with tumor metastasis. Moreover, it has been proven that HOTAIR promotes the further exacerbation and distant metastasis of tumors [14]. For example, the expression of HOTAIR is increased obviously in the tissue specimens of breast cancer, and it is hundreds of times higher in metastatic tumors than that in normal tissues, manifesting an apparent overexpression trend [15]. Similar results are also obtained in liver cancer. According to the PCR assay results, the expression of HOTAIR is raised evidently in a majority of liver cancer tissues compared with that in normal tissues, and it is obviously positively correlated with the prognosis of patients [16]. Besides, the expression level of HOTAIR in epithelial ovarian cancer is also distinctly higher than that in normal tissues, and HOTAIR can control the development of tumor cells by regulating matrix metalloproteinase (MMP) and epithelial-mesenchymal transition (EMT) and affect cell proliferation and apoptosis through regulating the proteins related to cell cycle and apoptosis, such as Cyclin D1 and Bax [17]. Furthermore, a growing number of studies on various life-regulating processes have revealed that miRNAs play extremely important roles in individual growth and development, cell proliferation and differentiation and metabolism [18]. For instance, it is reported in a study that miR-219-5p is specifically highly expressed in brain tissues and down-regulated notably in astrocytoma in comparison with that in other normal human tissues, indicating that the down-regulated miR-219-5p in human brain probably has a certain relation with the occurrence of glioma [19]. Nevertheless, can HOTAIR influence the occurrence and development of glioma through the targeted regulation on miR-219? Such a hypothesis was confirmed in the present study.

Recent evidence revealed that lncRNA HOTAIR could specifically bind to miR-204 as a competing endogenous RNA and promote the progression of oesophageal cancer [20]. HOTAIR was also found to function as miR-217 sponge and contribute to gastric cancer [21]. Similar to the pervious results of HOTAIR on the carcinogenesis, by using glioblastoma cell line U87 as the object of this study, we found HOTAIR can significantly elevate the proliferation activity of glioblastoma cells. The results of detection with AV/PI showed that after the interference in HOTAIR, the cell apoptosis rate was increased obviously, the expression level of cycle-related protein Cyclin D1 was lowered markedly, while the protein expression level of Bax was elevated distinctly. Of note, the RNA expression level of HOTAIR declined remarkably, while the RNA expression level of miR-219 rose notably after knockdown of HOTAIR using siRNA in HOTAIR-siRNA group compared with those in control group. After miR-219 knockdown with siRNA, the cell proliferation rate was raised remarkably, but no significant change in the RNA expression level of HOTAIR in cells was observed, demonstrating that HOTAIR is located in the upstream of miR-219 and can targetedly regulate the expression level of miR-219. As previous study illustrated the sponge function of HOTAIR to miR-217 and miR-211 to exert certain effects [21, 22], we propose that HOTAIR may serve similar sponge function to miR-219. However, in silico analysis has so far not yet identify any potential binding site between HOTAIR and miR-219, and the exact regulatory mechanism of HOTAIR to miR-219 remains to be investigated. Similarly, an in-vitro experiment of colorectal carcinoma also verified that the up-regulated HOTAIR is capable of stimulating PCR2 to target some genes and promoting tumor metastasis [23]. In addition, HOTAIR is able to induce further deterioration of gastrointestinal stromal tumor by targeting specific genes [24]. The above findings illustrate that HOTAIR can target specific genes in various tumors and have close correlations with the occurrence and development of tumors.

5. Conclusion

In conclusion, HOTAIR can repress the proliferation and promote the apoptosis of glioblastoma cells by targeting miR-219, which possesses research prospect and important significance for the clinical diagnosis and treatment of gliomas.

References

Cho

W.C.

, MicroRNAs: Potential biomarkers for cancer diagnosis, prognosis and targets for therapy, Int J Biochem Cell Biol 42(8) (2010), 1273–1281.

Sempere

L.F.

Freemantle

and Pitha-rowe

, Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation, Genome Biol 5(3) (2004), R13.

Rao

S.A.

Santosh

and Somasundaram

, Genome-wide expression profiling identifies deregulated miRNAs in malignant astrocytoma, Mod Pathol 23(10) (2010), 1404–1417.

Yan

Zhang

and Sun

, Identification of MMP-9 specific microRNA expression profile as potential targets of anti-invasion therapy in glioblastoma multiforme, Brain Res 1411 (2011), 108–115.

Dobes

Khurana

V.G.

and Shadbolt

, Increasing incidence of glioblastoma multiforme and meningioma, and decreasing incidence of Schwannoma (2000–2008): Findings of a multicenter Australian study, Surg Neurol Int 2 (2011), 176.

Stupp

Mason

W.P.

and Van Den Bent

M.J.

, Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma, N Engl J Med 352(10) (2005), 987–996.

Rustin

van der Burg

and Griffin

, Early versus delayed treatment of relapsed ovarian cancer, Lancet 377(9763) (2011), 380–381.

Rinn

J.L.

Kertesz

and Wang

J.K.

, Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs, Cell 129(7) (2007), 1311–1323.

Liu

and Zhu

, The sequence, structure and evolutionary features of HOTAIR in mammals, BMC Evol Biol 11 (2011), 102.

10.

Qiu

J.J.

Lin

Y.Y.

and Ye

L.C.

, Overexpression of long non-coding RNA HOTAIR predicts poor patient prognosis and promotes tumor metastasis in epithelial ovarian cancer, Gynecol Oncol 134(1) (2014), 121–128.

11.

Kogo

Shimamura

and Mimori

, Long noncoding RNA HOTAIR regulates polycomb-dependent chromatin modification and is associated with poor prognosis in colorectal cancers, Cancer Res 71(20) (2011), 6320–6326.

12.

Yang

Zhou

and Wu

L.M.

, Overexpression of long non-coding RNA HOTAIR predicts tumor recurrence in hepatocellular carcinoma patients following liver transplantation, Ann Surg Oncol 18(5) (2011), 1243–1250.

13.

Marasa

B.S.

Srikantan

and Martindale

J.L.

, MicroRNA profiling in human diploid fibroblasts uncovers miR-519 role in replicative senescence, Aging (Albany NY) 2(6) (2010), 333–343.

14.

Abdelmohsen

Kim

M.M.

and Srikantan

, miR-519 suppresses tumor growth by reducing HuR levels, Cell Cycle 9(7) (2010), 1354–1359.

15.

Abdelmohsen

Srikantan

and Tominaga

, Growth inhibition by miR-519 via multiple p21-inducing pathways, Mol Cell Biol 32(13) (2012), 2530–2548.

16.

Bendoraite

Knouf

E.C.

and Garg

K.S.

, Regulation of miR-200 family microRNAs and ZEB transcription factors in ovarian cancer: Evidence supporting a mesothelial-to-epithelial transition, Gynecol Oncol 116(1) (2010), 117–125.

17.

Hung

and Chang

H.Y.

, Long noncoding RNA in genome regulation: Prospects and mechanisms, RNA Biol 7(5) (2010), 582–585.

18.

Niinuma

Suzuki

and Nojima

, Upregulation of miR-196a and HOTAIR drive malignant character in gastrointestinal stromal tumors, Cancer Res 72(5) (2012), 1126–1136.

19.

Fornari

Milazzo

and Chieco

, In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2, J Pathol 227(3) (2012), 275–285.

20.

Wang

A.H.

Tan

Zhuang

Zhang

X.T.

Z.B.

and Li

L.N.

, Down-regulation of long non-coding RNA HOTAIR inhibits invasion and migration of oesophageal cancer cells via up-regulation of microRNA-204, J Cell Mol Med 23(10) (2019), 6595–6610.

21.

Dong

Guan

Huang

Jia

Huang

Chen

Zhang

Gao

and Wang

, Long non-coding RNA Hotair promotes gastric cancer progression via miR-217-GPC5 axis, Life Sci 217 (2019), 271–282.

22.

Chen

Zhou

Wang

and Zhu

Huang

and Cao

, Long non-coding RNA-HOTAIR promotes the progression of sepsis by acting as a sponge of miR-211 to induce IL-6R expression, Exp Ther Med 18(5) (2019), 3959–3967.

23.

Hou

Y.Y.

Cao

W.W.

and Li

, MicroRNA-519d targets MKi67 and suppresses cell growth in the hepatocellular carcinoma cell line QGY-7703, Cancer Lett 307(2) (2011), 182–190.

24.

Gennarino

V.A.

D’Angelo

and Dharmalingam

, Identification of microRNA-regulated gene networks by expression analysis of target genes, Genome Res 22(6) (2012), 1163–1172.

HOTAIR inhibits the proliferation of glioblastoma cells by targeting miR-219

Abstract

BACKGROUND:

OBJECTIVE:

RESULTS:

CONCLUSION:

Keywords

1. Introduction

2. Materials and methods

2.1 Reagents and instruments

2.2 Cell culture and transfection

2.3 Detection of U87 cell proliferation activity via CCK-8

2.4 Detection of apoptosis rate of U87 cells via flow cytometry

2.5 Colony formation assay

Table 1 Primer sequences for RT-PCR

2.7 Western blotting assay

2.8 Statistical analysis

3. Results

3.1 Impact of HOTAIR on miR-219 after interference with siRNA

3.6 Impact of miR-219 on RNA expression of HOTAIR after interference with siRNA

5. Conclusion

References

Table 1
Primer sequences for RT-PCR