Sage Journals: Discover world-class research

Abstract

BACKGROUND:

LncRNA and microRNA play an important role in the development of human cancers; they can act as a tumor suppressor gene or an oncogene. LncRNA GAS5, originating from the separation from tumor suppressor gene cDNA subtractive library, is considered as an oncogene in several kinds of cancers. The expression of miR-221 affects tumorigenesis, invasion and metastasis in multiple types of human cancers. However, there’s very little information on the role LncRNA GAS5 and miR-221 play in CRC. Therefore, we conducted this study in order to analyze the association of GAS5 and miR-221 with the prognosis of CRC and preliminary study was done on proliferation, metastasis and invasion of CRC cells. In the present study, we demonstrate the predictive value of long non-coding RNA GAS5 (lncRNA GAS5) and mircoRNA-221 (miR-221) in the prognosis of colorectal cancer (CRC) and their effects on CRC cell proliferation, migration and invasion.

METHODS:

One hundred and fifty-eight cases with CRC patients and 173 cases of healthy subjects that with no abnormalities, who’ve been diagnosed through colonoscopy between January 2012 and January 2014 were selected for the study. After the clinicopathological data of the subjects, tissue, plasma and exosomes were collected, lncRNA GAS5 and miR-221 expressions in tissues, plasma and exosomes were measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). The diagnostic values of lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes in patients with CRC were analyzed using receiver operating characteristic curve (ROC). Lentiviral vector was constructed for the overexpression of lncRNA GAS5, and SW480 cell line was used for the transfection of the experiment and assigned into an empty vector and GAS5 groups. The cell proliferation, migration and invasion were tested using a cell counting kit-8 assay and Transwell assay respectively.

RESULTS:

The results revealed that LncRNA GAS5 was upregulated while the miR-221 was downregulated in the tissues, plasma and exosomes of patients with CRC. The results of ROC showed that the expressions of both lncRNA GAS5 and miR-221 in the tissues, plasma and exosomes had diagnostic value in CRC. While the LncRNA GAS5 expression in tissues, plasma and exosomes were associated with the tumor node metastasis (TNM) stage, Dukes stage, lymph node metastasis (LNM), local recurrence rate and distant metastasis rate, the MiR-221 expression in tissues, plasma and exosomes were associated with tumor size, TNM stage, Dukes stage, LNM, local recurrence rate and distant metastasis rate. LncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes were found to be independent prognostic factors for CRC. Following the overexpression of GAS5, the GAS5 expressions was up-regulated and miR-221 expression was down-regulated; the rate of cell proliferation, migration and invasion were decreased.

The results obtained from the present study provide evidence on the roles of lncRNA GAS5 and miR-221 in the diagnosis and prognosis of CRC, and lncRNA GAS5 was found to inhibit CRC cell proliferation, migration and invasion by down-regulation of miR-221.

Keywords: Long non-coding RNA GAS5, mircoRNA-221, colorectal cancer, diagnosis, prognosis, cell proliferation, cell migration, cell invasion

1. Introduction

Colorectal cancer (CRC) is one of the leading causes of cancer-related death in the world, mainly due to the historical changes in the risk factors (including decreased smoking and red meat consumption and increased use of aspirin), and the incidence and mortality rate have shown a massive increase in the past couple of decades in China [1, 2]. At the time of diagnosis, between 8–29% of the patients with CRC had symptoms of a malignant obstruction, and approximately 75% of colon obstructions could be observed on the left side of the colon [3]. Because of its prevalence in the population and occurrence as both sporadic and familial diseases, there have been a number of studies on CRC at the molecular level in order to characterize the genetic, epigenetic and proteomic changes for the purpose of disease detection [4]. Based on previously accumulated data, an estimated number of 700000 people die from CRC annually [5]. It has been reported that the expression of microRNA (miR) might affect the survival rate in patients after their diagnosis with CRC [6].

It has been previously detected that MiRs play an important role in the multistep processes of carcinogenesis through their oncogenic or tumor suppressor functions, and have been extended into many kinds of tumors, including CRC [7, 8]. A previous study revealed that in patients with CRC, expression of miR-221 was significantly higher in their blood samples when compared to those in the control group [9]. Long non-coding RNA (LncRNA) plays an important role in various aspects of cellular homeostasis, including survival, proliferation, and migration rates [10]. ncRNAs are secreted by cells and can enter into the extracellular environment and this extracellular signaling mechanism is associated with physiology and pathology; a recent study has revealed the involvement of ncRNAs in the pathobiology of CRC [11]. Due to its tumor suppressive functions in several types of cancers, lncRNA GAS5 was regarded to be a diagnostic and prognostic biomarker and a therapy target [12]. LncRNA GAS5 affected cell proliferation and can lead to the poor prognosis of CRC in patients [13]. Based on a previously acquired evidence GAS5 can directly bind to miR-221, leading to the decrease in miR-221 expression and lncRNA GAS5 functioned as a competing endogenous RNA for miR-221 decreasing cell growth in osteosarcoma [14]. LncRNA GAS5 has been reported to inhibit cell proliferation, induce G0/G1 arrest and apoptosis, and function as a prognostic marker in CRC [15]. In another study, it was indicated that LncRNA GAS5 contributed to lymphatic metastasis in CRC [16]. The aforementioned studies led to the hypothesis that miR-221 and lncRNA GAS5 are involved in CRC, thus we conducted the present study in order to explore the effects of LncRNA GAS5 on cell proliferation, migration and invasion by the down-regulation of miR-221.

2. Subjects and methods

2.1 Ethics statement

All participants signed an informed consent. This study is consistent with the relevant ethical standards and has been approved ethical institutions that follow the National Research Council standards.

2.2 Study subjects

A total of 158 patients, including 95 males and 63 females between the ages of 30–72 years (mean age: 56.9 $\pm$ 7.4) diagnosed with CRC were selected from Cancer Hospital Affiliated to Xinjiang Medical University between January 2013 and January 2014. Among these patients, 87 of them had a well differentiated CRC and 71 had moderately or poorly differentiated CRC. According to the colon cancer TNM staging system proposed by the American Joint Committee on Cancer (AJCC) and the Union for International Cancer Control (UICC) in 2002, the pateints were divided in two groups: stage I $+$ II and stage III $+$ IV, with 74 patients in the first group and 84 patients in the second group [17]. The inclusion criteria were as follows: 1) patients were diagnosed with CRC by histopathological examination, in line with WHO (2000) standard [18]; 2) patients without any treatment before surgery; 3) patients with complete clinical data and follow-up information. The exclusion criteria included: 1) patients with a recent history of other malignant tumors, accompanied by a serious active diseases; 2) patients with drug-induced hepatitis, alcoholic liver disease, autoimmune liver disease or other diseases. 173 additional subjects without any abnormalities that had been diagnosed through colonoscopy in the same period, without the presence of any tumor in the remaining parts of their body parts and gastrointestinal disease were used as the control group. There was no significant difference in baseline characteristics including age and gender between the two groups (all $p>$ 0.05).

2.3 Sample collection

All CRC tissues were extracted through a surgical process from patients: normal colon tissue with healthy colonic mucosal samples confirmed by the pathology were regarded as the control group. The samples were fixed in the neutral formalin immediately, dehydrated with gradient ethanol, and cleaned with formaldehyde. Next, the paraffin-embedded samples were cut into 4 $\mu$ m serial sections for further experimentation.

The 4 mL peripheral venous blood was collected from CRC patients who’ve undergone fasting the morning before the surgery and was put into an ethylene diamine tetraacetic acid (EDTA) anticoagulant tube. The samples were centrifuged at 2000 r/min for 10 min, and the serum was separately put into an eppendorf (EP) tube and cryopreserved at $-$ 80 ${}^{\circ}$ C after recording. The peripheral venous blood from the healthy subjects who’ve undergone fasting was also collected in the morning and was used as the control group.

The steps of extraction of exosomes by differential ultracentrifugation were as follows: The serum was centrifuged at 10000 g for 30 min, and then the supernatant was centrifuged at 110000 g for 70 min in a low temperature ultra-high speed centrifuge l-80XP (Eppendorf, Hamburg, Germany) and the precipitate was obtained. Afterwards, phosphate buffered saline (PBS) was added in order to resuspend the precipitate which was then centrifuged at ultra-high speed with the exosomes obtained. Finally, 100 uL PBS was added into the exosomes for resuspension, followed by the cryopreservation of the exosomes at $-$ 80 ${}^{\circ}$ C.

2.4 Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from the tissues, plasma and exosomes using RNAiso plus (D9108A) Trizol (Dalian Biotech Co., Ltd., Dalian, Liaoning, China). Chloroform (200 $\mu$ L chloroform/mL RNAiso Plus) was added into the lysis buffer, after which the samples were sharply shaken for 15 s to emulsify adequately and were placed at room temperature for 15 min. Then the samples were centrifuged at 12000 g for 15 min at 4 ${}^{\circ}$ C. The upper aqueous phase was drawn into a different centrifuge tube (avoid sucking the white middle layer), and an equal volume of isopropyl alcohol was added into the supernatant, mixed and allowed to stand at a 15 $\sim$ 30 ${}^{\circ}$ C environment for 10 min. Next, the samples were centrifuged at 12000 g for 10 min at 4 ${}^{\circ}$ C until the precipitate appeared on the bottom of the tube. After the supernatant was carefully removed, 1 mL 75% ethyl alcohol was added slowly along the wall of the tube and gently shaken up and down the centrifuge tube. Next the samples were centrifuged at 12000 g for 10 min at 4 ${}^{\circ}$ C and the supernatant was carefully removed. The samples were dried at room temperature for 2–5 min, after which the appropriate amount of RNase-free water was added for the dissolution of the precipitate. Next, the concentration of RNA was determined with Nanodrop2000 and preserved at $-$ 80 ${}^{\circ}$ C. The cDNA was diluted with ultrapure water (1:40) for qPCR. The qPCR amplification of the reaction system was as follows: 5 $\mu$ L of Best primer ${}^{\text{TM}}$ Real time PCR Master Mix; 4.2 $\mu$ L of DNA template; 0.4 $\mu$ L of 10 uM forward primer; and 0.4 $\mu$ L of 10 uM reverse primer. The reaction conditions were as follows: stage 1: at 95 ${}^{\circ}$ C for 30 s for one cycle; stage 2: at 95 ${}^{\circ}$ C for 5 s, at 60 ${}^{\circ}$ C for 31 s for 40 cycles; stage 3: at 95 ${}^{\circ}$ C for 15 s, at 60 ${}^{\circ}$ C for 1 min, at 95 ${}^{\circ}$ C for 15 s (Dissociation Stage). The data was automatically generated by the ABI 7500 system (Applied Biosystems, Inc. California, USA) software SDS, and the Ct value (the number of cycles required to reach threshold) was determined by the number of PCR cycles for $\Delta$ Rn. The relative expression of the target gene was corrected with 18sRNA and calculated according to the following formula: 2 ${}^{-\Delta\Delta\text{Ct}}$ ( $\Delta$ Ct $=$ Ct ${}_{\text{[target gene]}}$ $-$ Ct ${}_{\text{[18sRNA]}}$ ). The RT-qPCR primer sequences are shown in Table 1.

Table 1
RT-qPCR primer sequences

Gene	Primer sequences (5’-3’)
GAS5	F: CTTCTGGGCTCAAGTGATCCT
	R: TTGTGCCATGAGACTCCATCAG
GAPDH	F: GTCAACGGATTTGGTCTGTATT
	R: AGTCTTCTGGGTGGCAGTGAT
miR-221	F: AGCTAAAAAAGCTACATTGTCTGCTGGGT
	TTCG
	R: GATCCGAAACCCAGCAGACAATGTAGCTT
	TTTT
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT

Notes: RT-qPCR, reverse transcription quantitative polymerase chain reaction; F, forward; R, reverse.

2.5 Follow-up

The follow up date was scheduled 30 days after surgery for a period of 6 months. The follow-up visits were done through regular outpatient visits, home visits, telephone and e-mails. The blood samples were collected from the patients and the survival, recurrence and metastasis rates were investigated. Overall survival rate was the percentage of the number of the survival cases at the end of follow-up visits to the total number of observed cases. Local recurrence rate was the recurrence rate caused by local jumping foci or tumor cell residues due to other causes. Distant metastasis rate referred to the percentage of the number of the distant metastases cases at the end of follow-up visits to the total number of observed cases. The complete data was collected from the follow-up of the patients without losing any files, which lasted until March 2017.

2.6 Lentivirus packaging, infection and identification

Passaged 293T cells that have already been passaged were prepared, for the use of lentivirus packaging operation when the cell density reached 60%–80%. The transfection was carried out after 24 h. The former solution was changed to complete culture medium without penicillin/streptomycin (P/S) (dulbecco’s modified eagle medium [DMEM] $+$ 10% fetal bovine serum [FBS]) 2 h before the lentivirus packaging transfection. A lentiviral plasmid (2–25 $\mu$ L of volume) containing 1 $\mu$ g target gene was mixed with 5 $\mu$ g of the pPACK packaging plasmid (including 1.7 $\mu$ g vesicular stomatitis virus [VSV], 1.7 $\mu$ g reticuloendotheliosis Virus [REV] and 1.7 $\mu$ g glycosaminoglycan [GAG]). Then the mixture of plasmids were diluted with 200 $\mu$ L DMEM medium without serum and double antibody and were placed at room temperature for 15 min. Next, 15 $\mu$ L transfection reagent Lipofectamine 2000 was diluted with 200 $\mu$ L DMEM medium without serum and double antibody, slightly mixed and placed at room temperature for 15 min. The diluted transfection reagent was then added dropwise into the DNA/DMEM mixture, slightly mixed and placed at room temperature for 20 min. The 293T cells were washed with DMEM medium without serum and double antibody, and a 1.5 mL DMEM medium containing 10% FBS without double antibody was added into the samples in each of the 6 cm dishes. DNA/Lipo mixture was added into the culture medium of 293T cells, slightly mixed and placed at 37 ${}^{\circ}$ C incubator. After 6–8 h, the transfected 293T cells were taken out and the original medium was replaced with 2 mL of fresh medium without the presence of a double antibody. The cells were continually incubated, and at 24, 48, 72 h, the culture was medium collected from the virus solution. The collected virus solution was centrifuged at 1000 rpm for 5 min in order to remove cell debris. The virus solution was filtered through a 0.45 $\mu$ M polyvinylidene fluoride (PVDF) filter into a sterile EP tube and was either directly stored in a refrigerator at $-$ 80 ${}^{\circ}$ C or immediately used for transfection. When the transfection cell density grew to 60%–80%, cell culture medium was slightly removed. Next, 1 mL virus solution and 1 mL complete medium were added into the samples, and 2 $\mu$ L polybrene was added to ensure a final concentration of 8 $\mu$ g/mL. After 24 h of incubation, the normal complete medium was used. The screened drug was added in the doubled time of the cells, and the cells were selected after addition of 3 $\mu$ g/mL puromycin 72 h after transfection (the cells were selected for 10 $\sim$ 15 days). Total RNA was extracted from the stable cell lines and verified by RT-qPCR. The cell supernatant was collected and the expression of miR-221 was measured by RT-qPCR.

Figure 1.

lncRND GAS5 was upregulated while the miR-221 was downregulated in tissues, plasma and exosomes of patients with CRC. Note: RT-qPCR was used to determinate the expression of lncRNA GAS5 and miR-221 in tissues, plasma and exosomes of patients with CRC. Panel A, the scatter plot reveals that lncRNA GAS5 is poorly expressed in tissues, plasma and exosomes in the CRC group; Panel B, the scatter plot reveals that miR-221 is highly expressed in tissues, plasma and exosomes in the CRC group; ${}^{****}$ , $p<$ 0.05 vs. the control and CRC groups. The data are presented as mean $\pm$ standard deviation, analyzed by one-way ANOVA. lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; RT-qPCR, reverse transcription quantitative polymerase chain reaction; there were 173 cases in the control group and 158 group in the CRC group; independent sample $t$ -test was used for comparisons between two groups.

Figure 2.

lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes had diagnostic value in CRC. Note: Panel A, ROC curve reveals that lncRNA GAS5 expression in tissues, plasma and exosomes had diagnostic value in CRC; Panel B, ROC curve reveals that miR-221 expression in tissues, plasma and exosomes had diagnostic value in CRC. The data are presented as mean $\pm$ standard deviation, analyzed by one-way ANOVA. lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; ROC, receiver operating characteristic; CRC, colorectal cancer.

2.7 Cell treatment

Human CRC cell line SW480 (Cellular Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China) was cultured with a DMEM medium containing 10% FBS and 1% antibiotics (penicillin, streptomycin and mitomycin) in a 5% CO ${}_{2}$ incubator at 37 ${}^{\circ}$ C. The cells in logarithmic growth phase were used for the experiment. These cells were assigned into the empty vector group and the GAS5 group and the HCT116 cells were inoculated in a 6-well plate. When the cell confluency reached 50%, 20 nmol/L empty vector and lentivirus lncRNA GAS5 overexpression plasmids were transfected into the cells according to the Lipofectamine 2000 transfection reagent instructions, and the cells were collected for subsequent experiments 48 h after transfection.

2.8 Cell counting kit-8 (CCK-8) assay

After the digestion and inoculation of cells into a 96-well culture plate, with 100 $\mu$ L (3000 cells) medium in each well, the cells were cultured in a 5% CO ${}_{2}$ incubator at 37 ${}^{\circ}$ C. Following the adherence of the cells to the wall, the medium was changed and the culture solution containing 10% CCK-8 was added into each well. Next, the samples were incubated at 37 ${}^{\circ}$ C for 1 h. After the cell was taken out from the incubator and balanced at the room temperature, the optical density (OD) value was determined at the wavelength of 450 nm. The cell viability was measured at 24 h, 48 h and 72 h and the cell growth curve was drawn and analyzed statistically

2.9 Transwell assay

After the cells in logarithmic growth phase were treated with trypsin and counted, the cell density was diluted to 2.5 $\times$ 10 ${}^{5}$ /mL with serum-free medium. Next, 8 $\mu$ M polycarbonate Transwell chamber was placed in a 24-well plate; 200 $\mu$ L of cell suspension was added to the Transwell apical chamber and 700 $\mu$ L complete medium containing 10% FBS was added to the Transwell basolateral chamber. The samples were then placed in a 5% CO ${}_{2}$ incubator at 37 ${}^{\circ}$ C. The 24-well plate was taken out 24 h later and the solution in Transwell apical and basolateral chambers was carefully removed. The chambers were washed 3 times (5 min each) with PBS, and 700 $\mu$ L 1% glutaraldehyde was added into the Transwell basolateral chamber. Subsequently, the samples were fixed at room temperature for 30 min, followed by the removal of the fixed solution and washing of the chambers with PBS for 5 min. After the basolateral chamber was dried, 700 $\mu$ L crystal violets were added and the samples were dyed at room temperature for 30 min. The chambers were washed with PBS 3 times (5 min each), and the cells that failed to penetrate through the inner membrane of the apical chamber were carefully wiped out with a cotton swab. After being dried at room temperature, the cells passing through the outer membrane of the chambers were observed under a microscope. Then the 6 fields of vision that had been randomly selected were counted and the results were calculated.

Matrigel was dissolved on ice and diluted (1:6) with the pre-cooled serum-free medium, followed by the vertical addition of 100 $\mu$ L diluted Matrigel into the pre-cooled 8 $\mu$ M polycarbonate Transwell chamber (operated on ice). The 24-well plate with Matrigel was incubated in an incubator at 37 ${}^{\circ}$ C for 2 h, and After the solidification of the Matrigel, the subsequent experimentation was carried out, including the cell invasion, and the addition of 100 $\mu$ L cell suspensions (1 $\times$ 10 ${}^{6}$ /mL). The samples were then dyed and observed after 24 h cell culture. Finally, 6 fields of vision were randomly selected and counted and the results were calculated.

2.10 Statistical analysis

All data were processed by SPSS 19.0 (IBM Corp. Armonk, NY, USA). The measurement data were expressed as mean $\pm$ standard deviation. The comparisons between CRC tissues and normal tissues were made by $t$ -test; comparisons between two groups were made by independent sample $t$ -test and comparisons among multiple groups were made by one-way analysis of variance (ANOVA). Count data was expressed as percentage/rate and compared by $\chi^{2}$ test. The expression of lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes were regarded as receiver operating characteristic curve (ROC) of patients with CRC to assess the sensitivity and specificity. The survival rate, local recurrence rate and distant metastasis rate were calculated using the Kaplan-Meier method. The Log-rank method was used to determine the difference in survival rate and multivariate Cox regression method was employed to analyze the factors affecting the prognosis of CRC. A $p$ value less than 0.05 was considered to be a significant difference.

3. Results

3.1 lncRND GAS5 is upregulated while the miR-221 is reciprocal in tissues, plasma and exosomes of patients with CRC

The results indicated that lncRNA GAS5 might be down-regulated and miR-221 up-regulated in patients

Table 2
The expression of lncRNA GAS5 is associated with TNM stage, Dukes stage, differentiation and LNM in patients with CRC

Clinicopathological features	N	Expression of lncRNA GAS5 in tissues			Expression of lncRNA GAS5 in plasma			Expression of lncRNA GAS5 in exosomes
		High expression	Poor expression	$p$	High expression	Poor expression	$p$	High expression	Poor expression	$p$
Gender
Male	95	12 (12.63%)	83 (87.37%)	0.177	10 (10.53%)	85 (89.47%)	0.477	9 (9.47%)	86 (90.53%)	0.738
Female	63	13 (20.63%)	50 (79.37%)		9 (14.29%)	54 (85.71%)		7 (11.11%)	56 (88.89%)
Age				0.936			0.316			0.116
$\geqslant$ 60	58	9 (15.52%)	49 (84.48%)		5 (8.62%)	53 (91.38%)		3 (5.17%)	55 (94.83%)
$<$ 60	100	16 (16.00%)	84 (84.00%)		14 (14.00%)	86 (86.00%)		13 (13.00%)	87 (87.00%)
Tumor sizes				0.328			0.439			0.142
$\geqslant$ 5	96	13 (13.54%)	83 (86.46%)		10 (10.42%)	86 (89.58%)		7 (7.29%)	89 (92.71%)
$<$ 5	62	12 (19.35%)	50 (80.65%)		9 (14.52%)	53 (85.48%)		9 (14.52%)	53 (85.48%)
TNM stage				0.001			0.012			0.017
Stage I–II	74	19 (25.68%)	55 (74.32%)		14 (18.92%)	60 (81.08%)		12 (16.22%)	62 (83.78%)
Stage III–IV	84	6 (7.14%)	78 (92.86%)		5 (5.95%)	79 (94.05%)		4 (4.76%)	80 (95.24%)
Dukes stage				0.043			0.016			0.008
A $+$ B	60	14 (23.33%)	46 (76.67%)		12 (20.00%)	48 (80.00%)		11 (18.33%)	49 (81.67%)
C $+$ D	98	11 (11.22%)	87 (88.78%)		7 (7.14%)	91 (92.86%)		5 (5.10%)	93 (94.90%)
Differentiation				0.044			0.002			0.001
Moderately and well	72	16 (22.22%)	56 (77.78%)		15 (20.83%)	57 (63.89%)		14 (19.44%)	58 (80.56%)
Poorly	86	9 (10.47%)	77 (89.53%)		4 (4.65%)	82 (95.35%)		2 (2.33%)	84 (97.67%)
LNM				0.002			0.024			0.002
No	70	18 (25.71%)	52 (74.29%)		13 (18.57%)	57 (81.43%)		13 (18.57%)	57 (81.43%)
Yes	88	7 (7.95%)	81 (92.05%)		6 (6.82%)	82 (93.18%)		3 (15.91%)	83 (96.59%)

Notes: TNM, tumor node metastasis; LNM, lymph node metastasis; N, numbers; lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; CRC, colorectal cancer.

Table 3

The expression of miR-221 is associated with tumor size, TNM stage, Dukes stage, differentiation and LNM in patients with CRC

Clinicopathological features	N	Expression of miR-221 in tissues			Expression of miR-221 in plasma			Expression of lncRNA GAS5 in exosomes
		High expression	Poor expression	$p$	High expression	Poor expression	$p$	High expression	Poor expression	$p$
Gender
Male	95	72 (75.79%)	23 (24.21%)	0.695	71 (74.74%)	24 (25.26%)	0.662	74 (77.89%)	21 (22.11%)	0.176
Female	63	46 (73.02%)	17 (26.98%)		49 (77.78%)	14 (22.22%)		43 (68.25%)	20 (31.75%)
Age				0.795			0.714			0.463
$\geqslant$ 60	58	44 (75.86%)	14 (24.14%)		45 (77.59%)	13 (22.41%)		41 (70.69%)	17 (29.31%)
$<$ 60	100	74 (74.00%)	26 (26.00%)		75 (75.00%)	25 (25.00%)		76 (76.00%)	24 (24.00%)
Tumor sizes				0.018			0.002			0.001
$\geqslant$ 5	96	78 (81.25%)	18 (18.75%)		81 (84.38%)	15 (15.63%)		80 (83.33%)	16 (16.67%)
$<$ 5	62	40 (64.52%)	22 (35.48%)		39 (62.90%)	23 (37.10%)		37 (59.68%)	25 (40.32%)
TNM stage		48 (64.86%)	26 (35.14%)		44 (59.46%)	30 (40.54%)		44(59.46%)	30(40.54%)
Stage I–II	74	70 (83.33%)	14 (16.67%)		76 (90.48%)	8 (9.52%)		73 (86.90%)	11 (13.10%)
Stage III–IV	84			$<$ 0.001			0.001			0.006
Dukes stage		35 (58.33%)	25 (41.67%)		37 (61.67%)	23 (38.33%)		37 (61.67%)	23 (38.33%)
A $+$ B	60	83 (84.69%)	15 (15.31%)		83 (84.69%)	15 (15.31%)		80 (81.63%)	18 (18.37%)
C $+$ D	98			$<$ 0.001			0.001			$<$ 0.001
Differentiation		40 (55.56%)	32 (44.44%)		46 (63.89%)	26 (36.11%)		42 (58.33%)	30 (41.67%)
Moderately and well	72	78 (90.70%)	8 (9.30%)		74 (86.05%)	12 (13.95%)		75 (87.21%)	11 (12.79%)
Poorly	86			$<$ 0.001			$<$ 0.001			0.001
LNM		42 (60.00%)	28 (40.00%)		42 (60.00%)	28 (40.00%)		43 (61.43%)	27 (38.57%)
No	70	76 (86.36%)	12 (13.64%)		78 (88.64%)	10 (11.36%)		74 (84.09%)	14 (15.91%)
Yes	88	48 (64.86%)	26 (35.14%)		44 (59.46%)	30 (40.54%)		44(59.46%)	30(40.54%)

Notes: TNM, tumor node metastasis; LNM, lymph node metastasis; N, numbers; lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; CRC, colorectal cancer.

with CRC. Initially, RT-qPCR was performed in order to investigate the expression of lncRNA GAS5 and miR-221 in tissues, plasma and exosomes of patients with CRC. The results of RT-qPCR (Fig. 1) showed that compared with the control group, there was a significantly lower expression of lncRNA GAS5 while miR-221 was highly expressed (all $p<$ 0.01) in tissues in the CRC group; lncRNA GAS5 was poorly expressed, and miR-221 was the reciprocal in plasma and exosomes ( $p<$ 0.05).

Figure 3.

lncRNA GAS5 expression and miR-221 expression in exosomes are independent prognostic factors for CRC. Note: Panel A, survival curve was used to analyze the 3-year overall survival rate, local recurrence rate and distant metastasis rate among the 158 patients (67.72%, 55.06% and 29.75%); Panel B, the 3-year overall survival rate, local recurrence rate and distant metastasis rate differ between patients with high expression of lncRNA GAS5 in tissues and those with poor expression; Panel C, the 3-year overall survival rate, local recurrence rate and distant metastasis rate differ between patients with high expression of lncRNA GAS5 in plasma and those with poor expression; Panel D, the 3-year overall survival rate, local recurrence rate and distant metastasis rate differ between patients with high expression of lncRNA GAS5 in exosomes and those with poor expression.

Figure 3.

continued. Panel E, the 3-year overall survival rate, local recurrence rate and distant metastasis rate differ between patients with high expression of miR-221 in tissues and those with poor expression; Panel F, the 3-year overall survival rate, local recurrence rate and distant metastasis rate differ between patients with high expression of miR-221 in plasma and those with poor expression; Panel G, the 3-year overall survival rate, local recurrence rate and distant metastasis rate differ between patients with high expression of miR-221 in exosomes and those with poor expression; The data are presented as mean $\pm$ standard deviation, analyzed by one-way ANOVA. lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; CRC, colorectal cancer.

Table 4

Tumor size, TNM stage, LNM, lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes are independent prognostic factors for patients with CRC

Clinicopathological features	n	Overall survival rate		Local recurrence rate		Distant metastasis rate
		%	$p$	%	$p$	%	$p$
Gender
Male	95	69.47%	0.563	61.05%	0.063	32.63%	0.330
Female	63	65.08%		46.03%		25.40%
Age			0.189		0.724		0.927
$\geqslant$ 60	58	74.14%		56.90%		29.31%
$<$ 60	100	64.00%		54.00%		30.00%
Tumor sizes			0.162		0.001		0.003
$\geqslant$ 5	96	63.54%		65.63%		38.54%
$<$ 5	62	74.19%		38.71%		16.13%
TNM stage			0.001		0.001		0.015
Stage I–II	74	81.08%		40.54%		20.27%
Stage III–IV	84	55.95%		67.86%		38.10%
Dukes stage			$<$ 0.001		0.001		$<$ 0.001
A $+$ B	60	85.00%		38.33%		13.33%
C $+$ D	98	57.14%		65.31%		39.80%
Differentiation			$<$ 0.002		$<$ 0.001		0.001
Moderately and well	72	80.56%		25.00%		16.67%
Poorly	86	56.98%		80.23%		40.70%
LNM			$<$ 0.001		$<$ 0.001		$<$ 0.001
Yes	88	51.14%		79.55%		42.05%
No	70	88.57%		24.29%		14.29%
lncRNA GAS5 in tissues			$<$ 0.018		$<$ 0.001		0.010
Highly expressed	25	88.00%		20.00%		8.00%
Poorly expressed	133	63.91%		61.65%		33.83%
lncRNA GAS5 in plasma			0.031		0.007		0.013
Highly expressed	19	89.47%		26.32%		5.26%
Poorly expressed	139	64.75%		58.99%		33.09%
lncRNA GAS5 in exosomes			0.019		$<$ 0.001		0.030
Highly expressed	16	93.75%		12.50%		6.25%
Poorly expressed	142	64.79%		59.86%		32.39%
miR-221 in tissues			$<$ 0.001		$<$ 0.001		0.018
Highly expressed	118	59.32%		65.25%		34.75%
Poorly expressed	40	92.50%		20.00%		15.00%
miR-221 in plasma			$<$ 0.001		$<$ 0.001		0.001
Highly expressed	120	60.00%		63.33%		36.67%
Poorly expressed	38	92.11%		28.95%		7.89%
miR-221 in exosomes			0.016		$<$ 0.001		0.039
Highly expressed	117	62.39%		64.96%		34.19%
Poorly expressed	41	82.93%		26.83%		17.07%

Notes: TNM, tumor node metastasis; LNM, lymph node metastasis; lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; CRC, colorectal cancer; N, numbers; CRC, colorectal cancer.

Table 5

lncRNA GAS5 expression and miR-221 expression in exosomes are independent prognostic factors for CRC

Factors	Overall survival rate		Local recurrence rate		Distant metastasis rate
	$p$	OR (95% CI)	$p$	OR (95% CI)	$p$	OR (95% CI)
Tumor sizes	–	–	0.690	1.108 (0.671 $\sim$ 1.830)	0.883	0.961 (0.566 $\sim$ 1.632)
TNM stage	0.019	1.917 (1.114 $\sim$ 3.301)	0.060	1.611 (0.980 $\sim$ 2.649)	0.058	1.705 (0.981 $\sim$ 2.961)
Dukes stage	0.035	1.705 (1.038 $\sim$ 2.802)	0.003	2.194 (1.318 $\sim$ 3.653)	0.076	1.595 (0.953 $\sim$ 2.671)
Differentiation	0.844	1.071 (0.543 $\sim$ 2.112)	0.092	1.854 (0.904 $\sim$ 3.803)	0.144	1.731 (0.829 $\sim$ 3.614)
LNM	0.021	2.401 (1.144 $\sim$ 5.042)	0.039	2.213 (1.042 $\sim$ 4.699)	0.969	1.015 (0.485 $\sim$ 2.213)
lncRNA GAS5 in tissues	0.145	0.541 (0.237 $\sim$ 1.236)	0.070	0.379 (0.132 $\sim$ 1.084)	0.284	0.670 (0.322 $\sim$ 1.394)
lncRNA GAS5 in plasma	0.047	0.131 (0.018 $\sim$ 0.976)	0.533	0.737 (0.283 $\sim$ 1.923)	0.639	0.805 (0.325 $\sim$ 1.995)
lncRNA GAS5 in exosomes	0.024	0.253 (0.077 $\sim$ 0.835)	0.023	0.328 (0.126 $\sim$ 0.857)	0.044	0.336 (0.116 $\sim$ 0.970)
miR-221 in tissues	0.978	1.008 (0.572 $\sim$ 1.775)	0.591	1.174 (0.653 $\sim$ 2.111)	0.541	1.206 (0.662 $\sim$ 2.197)
miR-221 in plasma	0.001	4.160 (1.746 $\sim$ 9.913)	0.187	1.574 (0.802 $\sim$ 3.087)	0.346	1.350 (0.723 $\sim$ 2.521)
miR-221 in exosomes	0.002	2.798 (1.480 $\sim$ 5.291)	0.006	2.365 (1.273 $\sim$ 4.394)	0.013	2.211 (1.179 $\sim$ 4.147)

Notes: TNM, tumor node metastasis; LNM, lymph node metastasis; OR, odds ratio; CI, confident interval; lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; CRC, colorectal cancer.

3.2 lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes have diagnostic value in CRC

ROC was performed in order to explore the diagnostic value of lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes in CRC (Fig. 2). The results showed under the area of the curve (AUC) values of lncRNA GAS5 expression in tissues, plasma and exosomes in CRC were 0.791 (95% confidence interval [CI]: 0.739–0.842, $p<$ 0.001), 0.875 (95% CI 0.838–0.911, $p<$ 0.001) and 0.964 (95% CI: 0.945–0.983, $p<$ 0.001), respectively. The AUC values of lncRNA GAS5 expression in tissues, plasma and exosomes in CRC were 0.858 (95% CI: 0.816–0.900, $p<$ 0.001), 0.781 (95% CI 0.733–0.829, $p<$ 0.001) and 0.827 (95% CI: 0.783–0.871, $p<$ 0.001), respectively. The critical values with their respective sensitivity and specificity values of CRC diagnosed by lncRNA GAS5 expression in tissues are mentioned below: A value of 0.0081 was regarded as the critical value, with sensitivity and specificity of 78.6% and 84.2%. A value of 0.1009 was regarded as the critical value, and with sensitivity and specificity of 95.4% and 89.9%. A value of 0.5430 was regarded as the critical value, with sensitivity and specificity of 74.7% and 88.4%. A value of 0.056 was regarded as the critical value, with sensitivity and specificity of 79.1% and 64.7%. A value of 0.0042 was regarded as the critical value, and the sensitivity and specificity of 72.2% and 85.5%.

3.3 The expression of miR-221 is associated with tumor size, TNM stage, Dukes stage, differentiation and LNM in patients with CRC

The association of the expression of lncRNA GAS5 and miR-221 with clinicopathological features of patients with CRC was investigated and the results from the analysis of lncRNA GAS5 and miR-221 expressions in tissues, plasma and exosomes and the clinicopathological features are shown in Tables 2 and 3. The lncRNA GAS5 expression in tissues, plasma and exosomes was only associated with tumor node metastasis (TNM) stage, Dukes stage, differentiation degree and lymph node metastasis (LNM) of the patients (all $p<$ 0.05) and had no relation with the gender, age or tumor size of the patients (all $p>$ 0.05). The miR-221 expression in tissues, plasma and exosomes was not associated with the gender or age of the patients (all $p>$ 0.05) while associated with tumor size, TNM stage, Dukes stage, differentiation degree, and LNM of the patients (all $p<$ 0.05). The results revealed that lncRNA GAS5 expression in the tissues of stage III–IV patients presented was extremely lowered in comparison with stage I–II patients. Compared with Dukes stage A $+$ B patients, the cases of poor expression of C $+$ D patients increased significantly. Compared with poorly differentiated patients, the cases of poor expression in moderately and well differentiated patients decreased significantly. Compared with patients without LNM, the cases of poor expression of patients with LNM increased significantly. Compared with lncRNA GAS5 expression in tissues, the miR-221 expression in plasma and exosomes showed the opposite trend.

3.4 Tumor size, TNM stage, LNM, lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes are independent prognostic factors for patients with CRC

The association of lncRNA GAS5 and miR-221 expression and clinicopathological data with the prognosis of CRC patients was investigate. The 3-year survival rate, local recurrence rate and distant metastasis rate of patients with CRC and lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes are shown in Fig. 3. Among the 158 patients, the 3-year overall survival rate, local recurrence rate and distant metastasis rate were found to be 67.72%, 55.06% and 29.75%, respectively (Fig. 3A). The 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with high expression of lncRNA GAS5 in tissues were 88.00%, 20.00%, 8.00% respectively and the 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with poorly expressed lncRNA GAS5 in tissues were 63.91%, 61.65%, 33.83%, respectively (all $p<$ 0.05) (Fig. 3B). The 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with high expression of lncRNA GAS5 in plasma were 89.47%, 26.32%, 5.26% respectively and the 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with poorly expressed lncRNA GAS5 in plasma were 64.75%, 58.99%, 33.09%, respectively (all $p<$ 0.05) (Fig. 3C). The was a significant difference in the 3-year overall survival rate, local recurrence rate and distant metastasis rate between the patients with high expression of lncRNA GAS5 in plasma and those with low expression of lncRNA GAS5 in plasma (all $p<$ 0.05). The 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with high expression of lncRNA GAS5 in exosomes were 93.75%, 12.50%, 6.25% respectively and the 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with lowered levels of lncRNA GAS5 expression in exosomes were 64.79%, 59.86%, 32.39%, respectively (all $p<$ 0.05) (Fig. 3D). The 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with high expression of miR-221 in tissues were 59.32%, 62.25%, 34.75% respectively and the 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with poorly expressed miR-221 in tissues were 92.50%, 25.00%, 15.00%, respectively (all $p<$ 0.05) (Fig. 3E). The 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with high expression of miR-221 in plasma were 60.00%, 63.33%, 36.67% respectively and the 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with poor expression of miR-221 in plasma were 92.11%, 28.95%, 7.89%, respectively (all $p<$ 0.05) (Fig. 3F). The 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with high expression of miR-221 in exosomes were 62.39%, 64.96%, 34.19% respectively and the 3-year overall survival rate, local recurrence rate and distant metastasis rate of patients with lowered levels of miR-221 expression in exosomes were 82.93%, 26.83%, 17.07%, respectively (all $p<$ 0.05) (Fig. 3G). The lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes in patients with CRC were analyzed by single factor survival with clinicopathological data. The results, as shown in Table 4, are illustrated as follows: The 3-year overall survival rate was associated with TNM stage, LNM, lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes; local recurrence rate and distant metastasis rate were correlated with tumor size, TNM stage, LNM, lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes (all $p<$ 0.05). The results indicated that tumor size, TNM stage, LNM, lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes might be independent prognostic factors for patients with CRC.

3.5 lncRNA GAS5 expression and miR-221 expression in exosomes are independent prognostic factors for CRC

Next, the multivariate Cox regression method was used to analyze the risk factors for the prognosis of patients with CRC, including the factors of statistical differences in univariate analysis. The results showed that the overall survival rate was associated with TNM stage, Dukes stage, LNM, lncRNA GAS5 and miR-221 expression in plasma and exosomes in patients with CRC (all $p<$ 0.05) while there was no significant correlation observed between the differentiation degree and lncRNA GAS5 and miR-221 expression in tissues (all $p>$ 0.05). The local recurrence rate was associated with Dukes stage, LNM, lncRNA GAS5 and miR-221 expression in exosomes in patients with CRC (all $p<$ 0.05) while there was no significant correlation with the tumor size, the differentiation degree, lncRNA GAS5 and miR-221 expression in tissues and plasma (all $p>$ 0.05) (Table 5). The distant metastasis rate was closely linked with lncRNA GAS5 and miR-221 expression in exosomes in patients with CRC (all $p<$ 0.05) while there was no significant relationship with the tumor size, TNM stage, Dukes stage, the differentiation degree, LNM, lncRNA GAS5 miR-221 expression in tissues and plasma (all $p>$ 0.05). The results indicated that lncRNA GAS5 expression and miR-221 expression in exosomes were independent prognostic factors for CRC.

Figure 4.

GAS5 was upregulated in SW480 cells after overexpression of GAS5. Note: RT-qPCR assay was used to determine the relative expression of GAS5 in the supernatant liquid of SW480 cells after transfection. After the overexpression of GAS5, GAS5 was upregulated in SW480 cells. ${}^{*}$ , $p<$ 0.05 vs. the empty vector and GAS5 vector groups. The data are presented as mean $\pm$ standard deviation, analyzed by one-way ANOVA. RT-qPCR, reverse transcription quantitative polymerase chain reaction; lncRNA GAS5, Long non-coding RNA GAS5.

Figure 5.

Overexpression of lncRNA GAS5 inhibits the expression of miR-221. Note: RT-qPCR assay was used to determine the relative expression of miR-221 in the supernatant liquid of SW480 cells after transfection. The determination by RT-qPCR assay reveals that overexpression of lncRNA GAS5 could inhibit the expression of miR-221. ${}^{**}$ , $p<$ 0.01 vs. the empty vector and GAS5 vector groups. The data are presented as mean $\pm$ standard deviation, analyzed by one-way ANOVA. RT-qPCR, reverse transcription quantitative polymerase chain reaction; lncRNA GAS5, Long non-coding RNA GAS5; miR-221, microRNA-221; CRC, colorectal cancer.

Figure 6.

Overexpression of lncRNA GAS5 inhibits SW480 cell proliferation, migration and invasion. Note: Panel A, SW480 cells treated by overexpression of lncRNA GAS5 show lower OD values 1, 2, 3, 4, 5 d after treatment. Panel B, lncRNA GAS5 inhibits SW480 cell migration and invasion in the scatter and histograms. ${}^{*}$ , $p<$ 0.05 vs. the empty vector and GAS5 vector groups at the same time point; ${}^{**}$ , $p<$ 0.01 vs. the empty vector and GAS5 vector groups at the same time point; ${}^{***}$ , $p<$ 0.001 vs. the empty vector and GAS5 vector groups at the same time point. The data are presented as mean $\pm$ standard deviation, analyzed by one-way ANOVA. lncRNA GAS5, Long non-coding RNA GAS5; OD, optical density.

3.6 GAS5 is upregulated in SW480 cells after overexpression of GAS5

Subsequently, RT-qPCR was performed in order to observe the change in the expression of GAS5 after the overexpression of GAS5. The results, as shown in (Fig. 4) showed that GAS5 expression in the empty vector group was 0.031 $\pm$ 0.015 and GAS5 expression in the GAS5 group was 0.137 $\pm$ 0.045 – the over-expression of GAS5 was 4.4 times higher than that of GAS5 indicating with the overexpression of GAS5, SW480 cell was successfully constructed and could be used for subsequent experimentation.

3.7 Overexpression of lncRNA GAS5 inhibits the expression of miR-221

In addition, it was investigated whether or not lncRNA GAS5 could affect miR-221. RT-qPCR was performed in order to measure the expression of miR-221 after the overexpression of GAS5. The results, as shown in Fig. 5, led to the following conclusions: miR-221 expression in the empty vector group was 0.010 $\pm$ 0.002; miR-221 expression in the GAS5 group was 0.004 $\pm$ 0.001. Compared with the empty vetor group, the abundance of miR-221 in the GAS5 vector group decreased. The results above indicated that the expression of miR-221 can be inhibited by the overexpression of lncRNA GAS5.

3.8 Overexpression of lncRNA GAS5 inhibits SW480 cell proliferation, migration and invasion

Lastly, CCK-8 assay and Transwell assay were conducted to investigate whether lncRNA GAS5 could affect SW480 cell proliferation, migration and invasion. The results of CCK-8 showed that 1 d–5 d after cell transfection, compared with the empty vector group, the cell proliferation in the GAS5 group markedly decreased (all $p<$ 0.05) (Fig. 6A). The results from the Transwell assay revealed that compared with the empty vector group, the cell migration and cell invasion presented with a notable decrease in the GAS5 group (all $p<$ 0.05) (Fig. 6B). These results indicated that the overexpression of lncRNA GAS5 might inhibit SW480 cell proliferation, migration and invasion.

4. Discussion

As the third most commonly diagnosed cancer in the world, CRC is regarded as a global health burden [5]. Based on previous studies, it was found that the perturbed expression of numerous miRs in CRC may have a functional effect on tumor cell behavior, and some miRs, which could potentially contribute to the prognosis of CRC, might be of clinical importance [8]. In the present study, the correlations among lncRNA GAS5, miR-221 and prognosis of CRC were explored and the results highly suggested that lncRNA GAS5 and miR-221 have certain diagnostic and prognostic values in CRC. It was found that lncRNA GAS5 inhibited CRC cell proliferation, migration and invasion by the down-regulation of miR-221.

The results of RT-qPCR revealed that there was a significantly lower level of lncRNA GAS5 expression, while the expression of miR-221 was elevated in tissues, plasma and exosomes in patients with CRC, and the overexpression of lncRNA GAS5 repressed miR-221 expression. It is well-known that lncRNA GAS5, a tumor suppressor, is expressed at a low level in various cancers, such as head and renal cell carcinoma, glioblastoma, prostate cancer and breast cancer [13]. In a previous study conducted by Li et al., it was observed that there was an under-expression of lncRNA GAS5 in CRC, which was consistent with the results obtained from the present study [19]. MiR-221 is an oncogene, because it can repress p27 (Kip1) and CDKNC/p57, which are key cell cycle inhibitors [20]. In addition, miR-221 is reported to be overexpressed in numerous types of cancer, such as urinary bladder cancer, breast cancer, pancreatic cancer, gastric cancer and glioblastoma [21]. A previous study revealed that miR-221 expression was higher in CRC tumors than in their corresponding adjacent normal tissues [22], which was identical to our results. Additionally, circulating miR-221 that is extended from plasma in a direct manner has revealed to be a promising diagnostic as well as prognostic marker of colorectal cancer, as it regulates p53 expression [23]. Secreted miRNAs enclosed in exosomes can act as intercellular bio-messengers [24]. According to previous studies, miRNA-221 was associated with increased oncogenic activity in gastric cancer and promoted tumor progression in glioma [25, 26]. Importantly, a prior study provided evidence that lncRNA GAS5 could repress miR-221 expression by directly binding to miR-221 in osteosarcoma cells [14]. LncRNAs play an important role in modulating gene expression and is also able to mediate biological functions through transcriptional regulation, splicing and translation; it has been reported that due to its endogenous sponge functions, Gas5 could bind to miR-222 and their reciprocal repression might result from RNA-induced silencing complex [27]. Therefore, it was presumed that the downregulation of miR-221 by GAS5 might follow a similar mechanism.

Furthermore, our results found that lncRNA GAS5 expression is negatively correlated with tumor size, TNM stage, Dukes stage, LNM, local recurrence rate and distant metastasis rate and is positively correlated with differentiation degree and the 3-year overall survival rate, while miR-221 acted on the contrary. Based on a preceding study, low lncRNA GAS5 contributes to larger tumor size and more advanced TNM stage in patients with CRC [19]. The downregulation of lncRNA GAS5 plays a crucial role in LNM [16]. A recent study implied that in patients with low lncRNA GAS5 expression, the survival time was shorten in comparison to those with high lncRNA GAS5 expression [13]. Consistently, Zheng et al. observed that low lncRNA GAS5 expression is correlated with the poor prognosis of CRC [16]. According to a key finding, miR-221 expression tended to increase with the progression of TNM stage and tumor size in patients with hepatocellular carcinoma [28]. In addition, coinciding with our results, Li et al. observed that cutaneous malignant melanoma patients with high miR-221 expression displayed LNM and poor differentiation when compared with the patients with low miR-221 expression [29]. Another study also revealed that miR-221 overexpression plays an essential role in distant metastasis in patients with pancreatic cancer [30]. Similarly, a different study found that miR-221 overexpression decreased the overall survival rate to 5-years [31]. Therefore, decreased lnc-GAS5 expression and increased miR-221 expression were closely correlated with the poor prognosis of CRC.

Finally, in the present study, it was observed that lncRNA GAS5 overexpression inhibits SW480 cell proliferation, migration and invasion. According to a previous study, the downregulation of lncRNA GAS5 expression promotes cell proliferation [19]. LncRNA GAS overexpression was also found to repress cell invasion and melanoma cell migration [32, 33]. A previous study documented that decreased miR-221 expression inhibited CRC cell migration and invasion [20]. Moreover, it has been previously proven that miR-221 overexpression is involved in cancer cell proliferation [34]. Another study also revealed that lncRNA GAS5 could inhibit miR-221 expression by directly binding to miR-221 in osteosarcoma cells [14]. The above findings showed that the overexpression of lncRNA GAS5 suppressed CRC cell proliferation, migration and invasion by decreasing miR-221 expression

In conclusion, our study was able to provide evidence on the effects of lncRNA GAS5 and miR-221 in the cell proliferation, migration and invasion of CRC. Based on the findings, the overexpression of lncRNA GAS5 can inhibit CRC cell proliferation, migration and invasion by the suppression of miR-221, and the overexpression of lncRNA GAS5 and the down-expression of miR-221 highly improve the prognosis of CRC, which facilitates an improved diagnosis and prognosis of CRC and enhance CRC treatment. However, further study should be focus on the concrete mechanism of lncRNA GAS5 and miR-221 in CRC due to the limited experimental conditions in this experiment.

Footnotes

Acknowledgments

This study was supported by the study of Effect and Mechanism of lncRNA GAS5-miR-221/miR-26-RECK Signaling Axis on Colorectal Cancer Metastasis (2017D01Z385, 2017.7.1–2020.6.30).

Conflict of interest

None.

References

Huang

Peng

Sheng

and Du

, Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer, Int J Cancer 127 (2010), 118–126.

Siegel

Desantis

and Jemal

, Colorectal cancer statistics, 2014, CA Cancer J Clin 64 (2014), 104–117.

Wang

Chen

and Yang

, Stenting as a bridge to resection versus emergency surgery for left-sided colorectal cancer with malignant obstruction: A systematic review and meta-analysis, Int J Surg 48 (2017), 64–68.

Weisenberger

D.J.

Liang

and Lenz

H.J.

, DNA methylation aberrancies delineate clinically distinct subsets of colorectal cancer and provide novel targets for epigenetic therapies, Oncogene (2017).

Hadjipetrou

Anyfantakis

Galanakis

C.G.

Kastanakis

and Kastanakis

, Colorectal cancer, screening and primary care: A mini literature review, World J Gastroenterol 23 (2017), 6049–6058.

Slattery

M.L.

Herrick

J.S.

Pellatt

D.F.

Mullany

L.E.

Stevens

J.R.

Wolff

Hoffman

M.D.

Wolff

R.K.

and Samowitz

, Site-specific associations between miRNA expression and survival in colorectal cancer cases, Oncotarget 7 (2016), 60193–60205.

Schetter

A.J.

Leung

S.Y.

Sohn

J.J.

et al., MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma, JAMA 299 (2008), 425–436.

Schepeler

Reinert

J.T.

Ostenfeld

M.S.

et al., Diagnostic and prognostic microRNAs in stage II colon cancer, Cancer Res 68 (2008), 6416–6424.

Sarlinova

Halasa

Mistuna

Musak

Iliev

Slaby

Mazuchova

Valentova

Plank

and Halasova

, miR-21, miR-221 and miR-150 Are Deregulated in Peripheral Blood of Patients with Colorectal Cancer, Anticancer Res 36 (2016), 5449–5454.

10.

Chen

Sun

Cheng

Zhang

Song

Zhou

Lin

and Wang

, Genome-wide analysis of long noncoding RNA (lncRNA) expression in colorectal cancer tissues from patients with liver metastasis, Cancer Med 5 (2016), 1629–1639.

11.

Ragusa

Barbagallo

Statello

Condorelli

A.G.

Battaglia

Tamburello

Barbagallo

Di Pietro

and Purrello

, Non-coding landscapes of colorectal cancer, World J Gastroenterol 21 (2015), 11709–11739.

12.

Guo

Wang

Zhao

Jin

Liu

Chen

Zhou

Wang

and Zhang

, Genetic polymorphisms of long non-coding RNA GAS5 predict platinum-based concurrent chemoradiotherapy response in nasopharyngeal carcinoma patients, Oncotarget 8 (2017), 62286–62297.

13.

Yin

Zhang

Kong

and Zhang

, Long noncoding RNA GAS5 affects cell proliferation and predicts a poor prognosis in patients with colorectal cancer, Med Oncol 31 (2014), 253.

14.

Wang

Zhang

Han

and Nan

, Long Noncoding RNA GAS5 Suppresses Cell Growth and Epithelial-Mesenchymal Transition in Osteosarcoma by Regulating the miR-221/ARHI Pathway, J Cell Biochem 118 (2017), 4772–4781.

15.

Yang

Shen

Yan

et al., Long non-coding RNA GAS5 inhibits cell proliferation, induces G0/G1 arrest and apoptosis, and functions as a prognostic marker in colorectal cancer, Oncol Lett 13 (2017), 3151–3158.

16.

Zheng

Song

Xiao

Yang

Ding

Deng

and Tong

, LncRNA GAS5 contributes to lymphatic metastasis in colorectal cancer, Oncotarget 7 (2016), 83727–83734.

17.

Akkoca

A.N.

Yanik

Ozdemir

Z.T.

Cihan

F.G.

Sayar

Cincin

T.G.

Cam

and Ozer

, TNM and Modified Dukes staging along with the demographic characteristics of patients with colorectal carcinoma, Int J Clin Exp Med 7 (2014), 2828–2835.

18.

Brozek

Kriwanek

Bonner

Peterlik

and Cross

H.S.

, Mutual associations between malignancy, age, gender, and subsite incidence of colorectal cancer, Anticancer Res 29 (2009), 3721–3726.

19.

Huang

Zhao

Lin

Qian

Zhou

Chen

and Huang

, Long non-coding RNA growth arrest specific transcript 5 acts as a tumour suppressor in colorectal cancer by inhibiting interleukin-10 and vascular endothelial growth factor expression, Oncotarget 8 (2017), 13690–13702.

20.

Qin

and Luo

, MicroRNA-221 promotes colorectal cancer cell invasion and metastasis by targeting RECK, FEBS Lett 588 (2014), 99–104.

21.

Liu

Fan

Diao

and Li

, Increased Expression of MicroRNA-221 in gastric cancer and its clinical significance, J Int Med Res 40 (2012), 467–474.

22.

Yau

T.O.

C.W.

Dong

Tang

C.M.

S.S.

Chan

F.K.

Sung

J.J.

and Yu

, microRNA-221 and microRNA-18a identification in stool as potential biomarkers for the non-invasive diagnosis of colorectal carcinoma, Br J Cancer 111 (2014), 1765–1771.

23.

X.X.

Huang

G.L.

Guo

H.Q.

Guo

C.C.

Ling

Jiang

Tian

and Lin

T.Y.

, Circulating miR-221 directly amplified from plasma is a potential diagnostic and prognostic marker of colorectal cancer and is correlated with p53 expression, J Gastroenterol Hepatol 25 (2010), 1674–1680.

24.

Wei

Lai

Chen

Zhang

Zhu

Yao

and Zhang

, Exosomal miR-221/222 enhances tamoxifen resistance in recipient ER-positive breast cancer cells, Breast Cancer Res Treat 147 (2014), 423–431.

25.

Chen

Liu

Xie

Deng

Shang

Wang

Xia

and Zuo

, miRNA-221 of exosomes originating from bone marrow mesenchymal stem cells promotes oncogenic activity in gastric cancer, Onco Targets Ther 10 (2017), 4161–4171.

26.

Yang

J.K.

Yang

J.P.

Tong

Jing

S.Y.

Fan

Wang

Sun

G.Z.

and Jiao

B.H.

, Exosomal miR-221 targets DNM3 to induce tumor progression and temozolomide resistance in glioma, J Neurooncol 131 (2017), 255–265.

27.

Zhao

Wang

Liu

Zheng

Liu

Chen

and Xue

, Gas5 Exerts Tumor-suppressive Functions in Human Glioma Cells by Targeting miR-222, Mol Ther 23 (2015), 1899–1911.

28.

Wang

Chen

and Luo

, Expression of serum miR-221 in human hepatocellular carcinoma and its prognostic significance, Biochem Biophys Res Commun 406 (2011), 70–73.

29.

Q.Y.

Luo

C.Q.

and Qian

L.Y.

, Circulating miR-221 expression level and prognosis of cutaneous malignant melanoma, Med Sci Monit 20 (2014), 2472–2477.

30.

Kawaguchi

Komatsu

Ichikawa

et al., Clinical impact of circulating miR-221 in plasma of patients with pancreatic cancer, Br J Cancer 108 (2013), 361–369.

31.

Gimenes-Teixeira

H.L.

Lucena-Araujo

A.R.

Dos Santos

G.A.

Zanette

D.L.

Scheucher

P.S.

Oliveira

L.C.

Dalmazzo

L.F.

Silva-Junior

W.A.

Falcao

R.P.

and Rego

E.M.

, Increased expression of miR-221 is associated with shorter overall survival in T-cell acute lymphoid leukemia, Exp Hematol Oncol 2 (2013), 10.

32.

Zhang

Zhu

Watabe

Zhang

Bai

and Mo

Y.Y.

, Negative regulation of lncRNA GAS5 by miR-21, Cell Death Differ 20 (2013), 1558–1568.

33.

Chen

Yang

Xiao

Tang

Han

Yang

and Zhu

, LncRNA GAS5 is a critical regulator of metastasis phenotype of melanoma cells and inhibits tumor growth in vivo/, Onco Targets Ther 9 (2016), 4075–4087.

34.

le Sage

Nagel

Egan

D.A.

Schrier

Mesman

Mangiola

Anile

Maira

Mercatelli

Ciafre

S.A.

Farace

M.G.

and Agami

, Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation, EMBO J 26 (2007), 3699–3708.

Prognostic and predictive value of long non-coding RNA GAS5 and mircoRNA-221 in colorectal cancer and their effects on colorectal cancer cell proliferation,migration and invasion

Abstract

BACKGROUND:

METHODS:

RESULTS:

1. Introduction

2. Subjects and methods

2.1 Ethics statement

2.2 Study subjects

2.3 Sample collection

2.4 Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Table 1 RT-qPCR primer sequences

2.6 Lentivirus packaging, infection and identification

2.8 Cell counting kit-8 (CCK-8) assay

2.9 Transwell assay

2.10 Statistical analysis

3. Results

3.1 lncRND GAS5 is upregulated while the miR-221 is reciprocal in tissues, plasma and exosomes of patients with CRC

Table 2 The expression of lncRNA GAS5 is associated with TNM stage, Dukes stage, differentiation and LNM in patients with CRC

3.3 The expression of miR-221 is associated with tumor size, TNM stage, Dukes stage, differentiation and LNM in patients with CRC

3.4 Tumor size, TNM stage, LNM, lncRNA GAS5 and miR-221 expression in tissues, plasma and exosomes are independent prognostic factors for patients with CRC

3.5 lncRNA GAS5 expression and miR-221 expression in exosomes are independent prognostic factors for CRC

3.7 Overexpression of lncRNA GAS5 inhibits the expression of miR-221

3.8 Overexpression of lncRNA GAS5 inhibits SW480 cell proliferation, migration and invasion

4. Discussion

Footnotes

Acknowledgments

Conflict of interest

References

Table 1
RT-qPCR primer sequences

Table 2
The expression of lncRNA GAS5 is associated with TNM stage, Dukes stage, differentiation and LNM in patients with CRC