Sage Journals: Discover world-class research

Abstract

Background

Interleukin 7R (IL-7R), a cytokine receptor gene, plays an important role in the development of innate and adaptive inflammatory response in asthma etiology.

Objective

IL-7R is a heterodimeric protein composed of α chain and γ chain. The α chain of IL-7R has a range of single nucleotide polymorphisms, which give rise to nonsynonymous amino-acid substitutions that might result in an increased production of inflammatory cytokines and cause asthma.

Methods

A case-control study was conducted with a total of 964 subjects, including 483 healthy controls and 481 patients with asthma. DNA samples were extracted from blood, and genotyping was done by using sequence-specific-primer–polymerase chain reaction.

Results

Statistical analysis revealed that IL-7R + 1237A/G (rs1494555) gene polymorphism shows a highly protective association toward asthma (odds ratio [OR] 0.56, p < 0.001) in AG genotype as well as in mutant GG genotype (OR 0.64, p = 0.029). However, IL-7R + 2087T/C (rs6897932) polymorphism showed an increased risk toward asthma in TC genotype (OR 1.70, p = 0.002) as well as in the CC genotype (OR 1.68, p = 0.002). Furthermore, the GT and AC haplotypes in the IL-7R polymorphisms were also found to be significantly associated with asthma (p = 0.001 and p = 0.037, respectively).

Conclusions

The study conducted in a north Indian population indicated that the protective association was observed for the + 1237A/G position, and a significant risk was observed for the + 2087T/C position in asthma.

Inflammation is the pivotal cause of many lung diseases, including asthma, cystic fibrosis, chronic bronchitis, and emphysema. The risk of disease occurs due to interactions among >100 susceptibility genes and multiple environmental factors.^1,2 It also has strong genetic components because its heritability has been estimated to vary from 40 to 60%.³ Genetic factors associated with asthma offered a great challenge for the researchers worldwide to understand the mechanism of asthma pathogenesis.

Interleukin (IL) 7, a 25-kDa glycoprotein, is a well-known essential factor for the development and maintenance of the immune system. IL-7 function is mediated through its receptor, IL-7R receptor, which is a heterodimeric protein composed of a 60–90 kDa α chain and 72 kDa γ chain that regulate signaling of IL-7 as well as type 2 T-helper cell cytokine viz. IL-2, IL-4, IL-9, IL-15, and IL-21 receptors.⁴ They are mostly expressed on immature B and T cells, and transduce transmembrane signals through the cytoplasmic tail.⁵ In addition, mutation of IL-7Rα (encoded as IL-7R) has been implicated in the development of autosomal recessive severe combined immunodeficiency.⁶ Functionally, IL-7R plays an important role in the development of innate and adaptive inflammatory as well as immunologic response. This signaling is critical for the development, survival, and homeostatic proliferation of T cells,⁷ production of several proinflammatory (IFN γ, IL-2) and anti-inflammatory cytokines (IL-4).⁸ The thymic stromal lymphopoietin (TSLP) cytokine also acts through IL-7R, which is associated with allergy⁹ and regulation of inflammatory processes.¹⁰

The human IL-7R gene is present on chromosome 5p13, and by using the positional cloning method, it was identified that this region harbors at least two asthma susceptibility loci.¹¹ Sequencing of the IL-7R has revealed the existence of a range of single nucleotide polymorphisms (+510C/T, +1237A/G, +2087T/C, and +3110A/ G), which all result in amino-acid substitutions.¹² However, of these single nucleotide polymorphisms, +1237A/ G(rs1494555) and +2087T/C (rs6897932) are related to inhalation allergy.⁹ In addition, the IL-7/IL-7R pathway is also associated with the pathogenesis of various autoimmune diseases, such as multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, sarcoidosis, and psoriasis.^13,14

Because only +1237A/G and +2087T/C polymorphisms in IL-7R are associated with inhalation allergy, this study was conducted to investigate the association of IL-7R polymorphisms to asthma in a north Indian population through a case-control study and to assess its correlation to several disease-associated parameters, e.g., sex, age, disease duration, atopic status, smoking status, family history of asthma, immunoglobulin E (IgE) level, pulmonary function.

Materials and Methods

Ethical Clearance

Ethical clearance, was granted by the Ethics Committee, Postgraduate Institute of Medical Education and Research, Chandigarh, India, for conducting the research work on human blood samples (memo no. PG-1Trg-10 on September 21, 2010). After the physician's diagnosis, only patients who fulfilled the criteria of the Global Initiative for Asthma guidelines were recruited for the study.

Inclusion-Exclusion Criteria

Recruitment of patients for this study was from different states of north India, including Chandigarh, Punjab, Haryana, Himachal Pradesh, Uttaranchal, Jammu and Kashmir, Rajasthan, Uttar Pradesh, and New Delhi. A total of 481 patients (191 men and 290 women) were enrolled of those who visited the Out Patient Department, Pulmonary Medicine, Postgraduate Institute of Medical Education and Research, Chandigarh, and 483 (189 men and 294 women) agematched, healthy individuals, without any symptoms of atopy, pulmonary disease, any other comorbid disease, or smoking habits were recruited as controls.

Lung Function Test

Spirometry tests were performed according to the Association of Respiratory Technician and Physiologists guidelines¹⁵ for generating pneumotachographs, which are helpful in assessing conditions such as asthma, chronic obstructive pulmonary disease, etc., by using Spiro 233 (PK Morgan, Rainham, Kent, U.K.). Of 481 patients with asthma, spirometry was done in 377 patients with asthma, who were further categorized according to asthma severity. The frequency of mild obstruction and heterozygous alleles in both polymorphisms was found to be higher in the studied population (Table 1).

Table 1

Characteristic of the study population

Phenotypic Trait	Patients with Asthma	Controls	p
Sex, no. (%)	481	483
Men	191 (39.7)	189 (39.1)	0.854
Women	290 (60.3)	294 (60.9)	χ² = 0.034
Age, mean ± SD (years)	37.22 ± 14.1 (18-57)	34.29 ± 12.2 (18-60)	0.001^; t =* 3.43
Disease duration, years	9.23	0
Rhinitis, no. (%)			0.000^*
Allergic rhinitis	397 (82.5)	0	χ² = 674.37
No rhinitis	84 (17.5)	483
Allergy, no. (%)			0.000^*
Allergic to at least 2 provoking factors	400 (83.5)	0	χ² = 683.11
Nonallergic	81 (16.8)	483
Smoking status, no. (%)			0.000^*
Ever-smoker	56 (11.6)	0	χ² = 57.59
Nonsmoker	425 (88.5)	483
Spirometry data, total no.^#	377	nd
FVC observed, mean ± SD	2.94 ± 1.1
FVC predicted, mean ± SD	2.23 ± 1.6
FEV1 observed, mean ± SD	2.74 ± 1.1
FEV1 predicted, mean ± SD	2.61 ± 0.66
FEV₁:FVC observed, %	68.92
FEV₁:FVC predicted, %	87.81
Family history of asthma, no. (%)	135 (28)	0	0.000^*; χ² = 155.32
BSA, mean ± SD m²	1.61 ± 0.20	1.59 ± 0.28	0.585; t = 0.547
BMI, mean ± SD kg/m²	23.7 ± 2.1	23.96 ± 12.3	0.606
Underweight (≤18.5 kg/m²)	16.6	17.4	t = 0.516
Normal weight (18.5–24.9 kg/m²)	21.15	21.3
Overweight (25–29.9 kg/m²)	26.85	26.7
Obesity (≥30 kg/m²)	33.7	30.8
IgE, average, IU/mL^§	2651.7	776.1	0.012^*
Asthma severity, total no.^#	n = 377	nd
Normal, no.	126
Mild obstruction (FEV₁%pred >60%), no.	153
Moderate obstruction (40% < FEV₁%pred >60%), no.	65
Severe obstruction (FEV₁%pred <40%), no.	33

SD = standard deviation; nd = not done; FVC = forced vital capacity; FEV₁ = forced expiratory volume in 1 second; BSA = body surface area; t = Student's t-test; BMI = body mass index; IgE = immunoglobulin E; %pred = frequency predicted.

Significant.

Spirometry test was conducted for 377 patients with asthma.

IgE levels were confirmed for 213 patients with asthma and 125 controls.

Total Immunoglobulin IgE Measurement

Total immunoglobulin E (IgE) was measured by using ImmunoCAPS with Phadia 100 IDM version 5.43 (Thermo Fisher Scientific Inc., Waltham, MA) in serum samples of both controls and patients with asthma to screen for allergy. Skin-prick and serum-specific IgE testing against Aspergillus fumigatus were also done in some patients to distinguish asthma and allergic bronchopulmonary aspergillosis. Only patients with negative skin-prick test results with specific IgE of <0.35 kUA/L were recruited for the study. The usually accepted upper limit is between 150 and 300 IU/mL but can range from 150 to 1000 IU/mL.¹⁶ These variations in the range are due to changes in diet, genetic background, geographic location, and other factors.¹⁷

Blood Sample Collection

Approximately 5 mL of blood was collected from both the patients and the control subjects into EDTA coated vials and stored at −80°C until extraction of genomic DNA was done. DNA was isolated from frozen whole blood samples by using the saline sodium citrate buffer method¹⁸ and assessed on 0.8% agarose gel before storage at −20°C for further use.

Genotyping

The IL-7R +1237A/G and +2087T/C polymorphisms were detected by using sequence-specific primer polymerase chain reaction (SSP-PCR), with specific primers,¹⁹ shown in Table 2. Briefly, PCR was carried out in a thermal cycler (Eppendorf Mastercycler gradient; USA Scientific, Inc., Ocala, FL) in a total volume of 25 μL that contained 10× PCR Buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl), 3 mM MgCl₂, 1 mg/mL nuclease free bovine serum albumin, 50 pmol of each primer, 10 mM of each deoxynucleotide, 0.125 U Taq polymerase and 2 μL genomic DNA. To assess the success of PCR, an internal control (human growth hormone) of 426 base pairs (bp) was used (Table 2). The PCR conditions for both the positions were 94°C for 5 minutes, followed by 35 cycles of 94°C for 60 seconds, 58°C (annealing temperature) for 60 seconds, 72°C for 60 seconds, and 72°C for 10 minutes for final extension.

Table 2

Primer sequence and the polymerase chain reaction product size

SNP Position	Primer Name	Sequence, 5′-3′	Product Size, bp
+ 1237A/G (rsl494555)	IL-7Rex4F2	GTGACTTGCAGAGGAGATGA	139
	IL-7Rex42c	TGGCTCCTTCCCGATAGAC
	IL-7Rex41t	TTGGCTCCTTCCCGATAGAT
+2087T/C (rs6897932)	IL-7Rex6Rla	GAAAAAACTCAAAATGCTGATGA	1000
	IL-7Rex6R2g	GAAAAAACTCAAAATGCTGATGG
	L7-Rex6F	AAC CGG CAG CAA TGT ATG AG
Internal control	Human growth hormone	F-CCTTCCAACCATTCCCTTA R-TCACGGATTTCTGTTGTGTTTC	426^*

SNP = single nucleotide polymorphism; IL = interleukin; rs = seference SNP.

Ref. 20.

PCR was carried out separately for both the alleles of one single nucleotide polymorphism, and the results then were observed directly by electrophoresis on 2% agarose gels stained with ethidium bromide and visualized by ultraviolet transillumination (Figs. 1 and 2). For Fig. 1, if allele (A/G) specific band (139 bp) in sample 1 was absent, then it was GG genotype (A^–G⁺; homozygous as in lanes 1A and 1G). Similarly, if the reverse was present (A^–G⁺ in sample 2), then it indicated AA genotype (homozygous as in Fig. 1, lanes 2A and 2G). However, if both the allele specific bands (139 bp) were present (A^–G⁺ in sample 3), then it was AG genotype (heterozygous as in Fig. 2, lanes 3A and 3G). The same pattern was followed in Fig. 2 for allele T/C specific band (1000 bp).

Figure 1.

SSP-PCR products of IL-7R (+1237 A/G) polymorphism on 2% Agarose gel. Lanes 1A&1G, 4A&4G: homozygous mutant GG genotype (426 and 139 bp), lanes 2A&2G: Homozygous wild AA (426 and 139 bp), lanes 3A&3G: heterozygous AG genotype (426 and 139 bp), lane M:100 bp ladder.

Figure 2.

SSP-PCR products of IL-7R (+2087 T/C) polymorphism on 2% Agarose gel. Lane M:100 bp ladder, lanes 1T&1C, 4T&4C: heterozygous TC genotype (1000 and 426 bp), lanes 2T&2C: Homozygous wild TT (1000 and 426 bp), lanes 3T&3C: homozygous mutant CC genotype (1000 and 426 bp).

Statistical Analysis

All the statistical analyses were performed by using the SPSS software for Windows version 20.0 (SPSS, Inc., Chicago, IL) and Epi Info version 3.4.7 (Centers for Disease Control and Prevention, Atlanta, GA). A χ² analysis was used to check the deviation from the Hardy-Weinberg equilibrium and to compare the genotype and allele frequency between asthma and control groups. Odds ratio (OR) and 95% confidence interval were used for the assessment of risk factors, and a p value <0.05 was considered as statistically significant. PLINK v1.07²¹ was used for the calculation of haplotype frequencies.

Results

Demographic Characteristics

In this study, IL-7R +1237A/G (rs1494555) and +2087T/C (rs6897932) polymorphisms were genotyped in a total of 964 subjects, including 483 healthy controls and 481 patients with asthma. Various characteristics, e.g., sex, age, disease duration, atopic status, IgE level, smoke exposure, family history of asthma, spirometry diagnosis, cough, severity, body mass index, were examined. The mean age for patients with asthma was found to be 37.22 years and for healthy adults was 34.29 years. Also, women outnumbered the men in both the patient and the control groups. The mean disease duration was >9 years, and 28% of patients with asthma had a family history of asthma. The total serum IgE concentration (IU/mL) was assessed for 213 of patients with asthma and 125 control subjects, and the average total IgE was found to be higher in the patients with asthma (2651.7 IU/mL) than in the controls (776.1 IU/mL) (Table 1).

Prevalence of Allelic and Genotypic Frequencies in IL-7R + 1237A/G and + 2087T/C Polymorphisms

Statistical analysis of the allelic frequencies for IL-7R +1237A/G indicated that the mutant G allele was more prevalent among the controls (46.6%) than in the patients with asthma (40.6%), having protective association toward the disease (OR 0.79, p = 0.009). However, the mutant C allele of IL-7R +2087T/C was more prevalent among the asthmatics (54.9%) than in the controls (49.9%) and had a significant association for the disease (OR 01.23, p = 0.025) (Table 3). When comparing the genotypic frequencies, the results revealed that, for IL-7R +1237A/G polymorphism, the heterozygous genotype AG (OR 0.56, p = 0.001) and homozygous mutant GG genotype (OR 0.64, p = 0.029) showed a highly protective association. The AG+GG genotypic combination again conferred protection from asthma (OR 0.58, p = 0.001) (Table 3).

Table 3

Genotypic and allelic frequencies of polymorphisms at IL-7R +1237A/G (rs1494555) and + 2087T/C (rs6897932)

Polymorphism	Patients with Asthma, No. (%)	Controls, No. (%)	χ²	OR (95% CI)	p
	481	483
Genotypic frequencies
IL-7R +1237A/G (rsl494555)
Wild (AA)	164 (34.1)	111 (23.0)		Ref (1.0)
Heterozygous (AG)	243 (50.5)	294 (60.9)	15.05	0.56 (0.41–0.76)	0.000^*
Mutant (GG)	74 (15.4)	78 (16.1)	4.76	0.64 (0.42–0.98)	0.029^*
AA vs AG+GG	317 (65.9)	372 (77.0)	14.60	0.58 (0.43–0.77)	0.000^*
IL-7R +2087T/C (rs6897932)
Wild (TT)	72 (15.0)	111 (23.0)		Ref (1.0)
Heterozygous (TC)	289 (60.1)	262 (54.2)	9.44	1.70 (1.19–2.43)	0.002^*
Mutant (CC)	120 (24.9)	110 (22.8)	6.74	1.68 (1.11–2.54)	0.009^*
TT vs TC + CC	409 (85.0)	372 (77.0)	10.06	1.70 (1.21–2.39)	0.002^*
Allelic frequencies
IL-7R + 1237A/G (rsl494555)
Wild (A)	571 (59.4)	516 (53.4)		Ref (1.0)
Mutant (G)	391 (40.6)	450 (46.6)	6.91	0.79 (0.65–0.94)	0.009^*
IL-7R + 2087T/C (rs6897932)
Wild (T)	433 (45.1)	484 (50.1)		Ref (1.0)
Mutant (C)	529 (54.9)	482 (49.9)	5.01	1.23 (1.02–1.47)	0.025^*

IL = interleukin; OR = odds ratio; CI = confidence interval; Ref = reference; % = frequency.

Significant.

Statistical data for the genotypic frequencies in IL-7R +2087T/C revealed that the heterozygous genotype TC (OR 1.70, p = 0.002) and the homozygous mutant CC genotype (OR 1.68, p = 0.009) was more prevalent among asthmatics with a highly significant risk toward the disease. The TC+CC genotypic combination again conferred significant risk in asthmatics (OR 1.70, p = 0.002) (Table 3). Both the polymorphisms (IL-7R +1237A/G and +2087T/C) in the studied population followed the Hardy-Weinberg equilibrium. In addition, the GT and AC haplotypes in the IL-7R polymorphisms were found to be highly significant for asthma, with p < 0.001 and p = 0.037, respectively (Table 4).

Table 4

Haplotype frequency of polymorphisms at IL-7R + 1237A/G and + 2087T/C

Haplotype	Frequency (patients with asthma)	Frequency (controls)	χ²	p
GT	0.167	0.234	13.6	0.000^*
AT	0.283	0.267	0.647	0.421
GC	0.239	0.232	0.167	0.682
AC	0.311	0.267	4.345	0.037^*

IL = interleukin.

Significant.

Phenotypic Characteristics of IL-7R + 1237A/G and + 2087T/C Polymorphisms in Asthma

Further categorizing the patients with asthma based on the phenotypic characteristics of the disease (Table 5), data obtained from the proforma of patients filled during the collection of blood sample, a protective association was found between IL-7R +1237A/G polymorphism and asthma when comparing mutant allele against the wild-type allele of controls and patients with asthma in the clinical parameters, e.g., female sex (OR 0.79, p = 0.042), throughout the year occurrence of the symptoms (OR 0.72, p = 0.007), wheeze at rest (OR 0.76, p = 0.005), no family history of asthma (OR 0.77, p = 0.008), allergy (OR 0.78, p = 0.009), rhinitis (OR 0.77, p = 0.006), nonsmoker (OR 0.79, p = 0.016), long-standing cough for 3–8 weeks (OR 0.76, p = 0.031), and the patient without cough (OR 0.76, p = 0.032).

Table 5

Phenotypic characteristics and IL-7R + 1237A/G polymorphism

Phenotypic Trait	No. (%)	Wild (AA), no. (%)	Heterozygous (AG), no. (%)	Mutant (GG), no. (%)	Wild (A), no. (%)	Mutant (G), no. (%)	χ²	OR (95% CI)	p
Controls	483	111 (23.0)	294 (60.9)	78 (14.5)	516 (53.4)	450 (46.6)		Ref (1.0)
Men	189 (39.1)	43 (22.8)	115 (60.8)	31 (16.4)	201 (53.2)	177 (46.8)
Women	294 (60.9)	68 (23.1)	179 (60.9)	47 (16.0)	315 (53.6)	273 (46.4)
Patients with asthma	481
Sex
Men	191 (39.7)	63 (33.0)	100 (52.4)	28 (14.7)	226 (59.2)	156 (40.8)	2.77	0.78 (0.58–1.06;	0.096
Women	290 (60.3)	101 (34.8)	143 (49.3)	46 (15.9)	345 (59.5)	235 (40.5)	4.15	0.79 (0.62–1.00;	0.042^*
Occurrence
Seasonal	295 (61.3)	92 (31.2)	158 (53.6)	45 (15.2)	342 (58.0)	248 (42.0)	3.07	0.83 (0.67–1.03;	0.080
Throughout year	186 (38.7)	72 (38.7)	85 (45.7)	29 (15.6)	229 (61.6)	143 (38.4)	7.22	0.72 (0.56–0.92;	0.007^*
Severity
Wheeze on exertion	126 (26.2)	39 (30.9)	65 (51.6)	22 (17.5)	143 (56.7)	109 (43.3)	0.89	0.87 (0.65–1.17;	0.345
Wheeze at rest	355 (73.8)	125 (35.2)	178 (50.2)	52 (14.6)	428 (60.3)	282 (39.7)	7.84	0.76 (0.62–0.92;	0.005^*
Family history of asthma
Nil	346 (71.9)	121 (35.0)	173 (50.0)	52 (15.0)	415 (60.0)	277 (40.0)	7.04	0.77 (0.62–0.94;	0.008^*
+ve	135 (28.1)	43 (31.9)	70 (51.9)	22 (16.3)	156 (58.0)	114 (42.0)	1.62	0.84 (0.63–1.11;	0.203
Rhinitis
Nil	84 (17.5)	25 (29.8)	45 (53.6)	14 (16.7)	95 (56.5)	73 (43.5)	0.56	0.88 (0.62–1.24;	0.452
+ve	397 (82.5)	139 (35.0)	198 (49.9)	60 (15.1)	476 (60.0)	318 (40.0)	7.56	0.77 (0.63–0.93;	0.006^*
Allergy
Nil	81 (16.8)	24 (29.6)	46 (56.8)	11 (13.6)	94 (58.0)	68 (42.0)	1.19	0.83 (0.58–1.18;	0.276
+ve	400 (83.2)	140 (35.0)	197 (49.2)	63 (15.8)	477 (59.6)	323 (40.4)	6.85	0.78 (0.64–0.94;	0.009^*
Smoking status
Nonsmoker	425 (88.4)	143 (33.6)	216 (50.8)	66 (15.5)	502 (59.1)	348 (40.9)	5.84	0.79 (0.66–0.96;	0.016^*
Ever-smoker (>100 cigarettes in lifetime)	56 (11.6)	21 (37.8)	27 (48.2)	8 (14.3)	69 (61.6)	43 (38.4)	2.71	0.71 (0.47–1.09;	0.100
Cough
Nil	302 (62.8)	102 (33.8)	152 (50.3)	48 (15.9)	356 (58.9)	248 (41.1)	4.59	0.80 (0.65–0.99;	0.032^*
Long lasting	179 (37.2)	62 (34.6)	91 (50.8)	26 (14.5)	215 (60.1)	143 (39.9)	4.66	0.76 (0.59–0.98;	0.031^*

IL = interleukin; OR = odds ratio; CI = confidence interval; Ref = reference; % = frequency; Nil = absent; +ve = present.

Significant.

In addition, a significant risk was found between IL-7R +2087T/C and asthma when comparing the mutant allele with the wild-type allele of controls and patients with asthma in the clinical parameters such as seasonal (summer, winter, spring, and autumn) occurrence of the symptoms (OR 1.27, p = 0.025), wheeze on exertion (OR 1.34, p = 0.040), family history of asthma (OR 1.42, p = 0.012), allergy (OR 1.23, p = 0.029), rhinitis (OR 1.41, p = 0.043), and patient without cough (OR 1.26, p = 0.027) (Table 6).

Table 6

Phenotypic characteristics and IL-7R + 2087 T/C polymorphism

Phenotypic Trait	No. (%)	Wild (TT), no. (%)	Heterozygous (TC), no. (%)	Mutant (CC), no. (%)	Wild (T), no. (%)	Mutant (C), no. (%)	χ²	OR (95% CI)	p
Controls	483	111 (23.0)	262 (54.2)	110 (22.8)	484 (50.1)	482 (49.9)		Ref (1.0)
Men	189 (39.1)	42 (22.2)	96 (50.8)	51 (27.0)	180 (47.6)	198 (52.4)
Women	294 (60.9)	69 (23.5)	166 (56.5)	59 (20.1)	304 (51.7)	284 (48.3)
Patients with asthma	481
Sex
Men	191 (39.7)	23 (12.0)	118 (61.8)	50 (26.2)	164 (42.9)	218 (57.1)	1.68	1.21 (0.90–1.63;	0.194
Women	290 (60.3)	49 (16.9)	171 (59.0)	70 (24.1)	269 (46.4)	311 (53.6)	3.31	1.24 (0.98–1.57;	0.069
Occurrence
Seasonal	295 (61.3)	39 (13.2)	183 (62.1)	73 (24.7)	261 (44.2)	329 (55.8)	5.05	1.27 (1.02–1.56;	0.025^*
Throughout year	186 (38.7)	33 (17.7)	106 (57.0)	47 (25.3)	172 (46.2)	200 (53.8)	1.61	1.17 (0.91–1.49;	0.205
Severity
Wheeze on exertion	126 (26.2)	18 (14.3)	72 (57.1)	36 (28.6)	108 (42.9)	144 (57.1)	4.20	1.34 (1.00–1.79;	0.040^*
Wheeze at rest	355 (73.8)	54 (15.2)	217(61.1)	84 (23.7)	325 (45.8)	385 (54.2)	3.07	1.19 (0.97–1.45;	0.080
Family history of asthma
Nil	346 (71.9)	59 (17.1)	203 (58.7)	84 (24.3)	321 (46.4)	371 (53.6)	2.23	1.16 (0.95–1.42;	0.135
+ve	135 (28.1)	13 (9.6)	86 (63.7)	36 (26.7)	112 (41.5)	158 (58.5)	6.28	1.42 (1.07–1.88;	0.012^*
Rhinitis
Nil	84 (17.5)	11 (13.1)	48 (57.1)	25 (29.8)	70 (41.7)	98 (58.3)	4.08	1.41 (1.00–1.99;	0.043^*
+ve	397 (82.5)	61 (15.4)	241 (60.7)	95 (23.9)	363 (45.7)	431 (54.3)	3.36	1.19 (0.98–1.45;	0.067
Allergy
Nil	81 (16.8)	15 (18.5)	44 (54.2)	22 (27.2)	74 (45.7)	88 (54.3)	1.09	1.19 (0.84–1.69;	0.297
+ve	400 (83.2)	57 (14.2)	245 (61.2)	98 (24.5)	359 (44.9)	441 (55.1)	4.79	1.23 (1.02–1.50;	0.029^*
Smoking status
Nonsmoker	425 (88.4)	64 (15.1)	259 (60.9)	102 (24.0)	387 (45.5)	463 (54.5)	3.79	1.20 (0.99–1.45;	0.052
Ever-smoker (>100 cigarettes in lifetime)	56 (11.6)	8 (14.3)	30 (53.6)	18 (32.1)	46 (41.2)	66 (58.9)	3.28	1.44 (0.95–2.18;	0.070
Cough
Nil	302 (62.8)	43 (14.2)	182 (60.3)	77 (25.5)	268 (44.4)	336 (55.6)	4.89	1.26 (1.02–1.55;	0.027^*
Long lasting	179 (37.2)	29 (16.2)	107 (59.8)	43 (24.0)	165 (46.1)	193 (53.9)	1.68	1.17 (0.91–1.51;	0.194

IL = interleukin; OR = odds ratio; CI = confidence interval; Ref = reference; % = frequency; Nil = absent; +ve = present.

Significant.

Discussion

This is the first report on evaluation of the genetic association of IL-7R +1237A/G (rs1494555) and +2087T/C (rs6897932) gene polymorphisms toward asthma etiology in a north Indian population, and allelic as well as genotypic frequencies revealed that the +1237A/G polymorphism confers protection whereas the +2087T/C position increases the risk of the disease, as presented in Table 3. The phenotypic characteristics of +1237A/G polymorphism also conferred protection, as shown in Table 5, whereas +2087T/C polymorphism was associated with risk toward asthma, as observed in Table 6 with p = 0.05. The total serum IgE level was also found to be highly elevated in patients with asthma than in the healthy controls. Spirometry data was only available for patients with asthma so we are unable to apply the statistics in Table 1.

The crucial role of the IL-7R +1237A/G and +2087T/C polymorphisms in asthma is still not known. It is possible that these polymorphisms result in amino-acid substitution in the receptor, which may be associated with changes in the folded protein that affect intracellular signaling pathways.²² IL-7 mainly induces T-cell activation but can also directly stimulate monocytes to produce a number of proinflammatory cytokines,^23,24 and its function is mediated by IL-7R. A current scenario shows that the thymic stromal lymphopoietin (TSLP), considered as an IL-7–related cytokine, has emerged as a crucial contributor to allergic inflammation, e.g., asthma.^25,26 The receptor for TSLP is a heterodimeric complex and composed of both the TSLP receptor and the IL-7R chain, which increases their binding affinity.^27–29 TSLP is predominantly expressed on lung airway epithelial cells and are also involved in the differentiation and production of type 2 T-helper cell cytokines, such as IL-4, IL-5, IL-9, and IL-13, from naive T cells.^30,31 It is also associated with allergic rhinitis, which exacerbates asthma in children.³² These factors indicate that IL-7R and/or TSLP might trigger the inflammatory cascade in asthma.

In our study, we found that +2087T/C was significantly associated and that +1237A/G had decreased risk of the disease. This result is in accordance with the study conducted with a Danish population that reported IL-7R +1237A/G and +2087T/C as candidate genes for inhalation allergy, in which patients with allergy compared with controls showed a significant association.⁹ When comparing the genotypic frequencies of wild, hetero, and mutant in the Danish population with the present study, the same order was observed for +1237A/G polymorphism, whereas a wide difference was observed for +2087T/C polymorphism.⁹ A fine mapping and positional candidate studies on Hutterites from Germany was done to identify a 5p-linked asthma or bronchial hyperresponsiveness locus. Hutterites from Germany also revealed that the region on chromosome 5p13 that encodes IL-7R harbors at least two asthma or bronchial hyperresponsiveness susceptibility loci.¹¹

The present study also found phenotypic parameters to be protective in asthma for IL-7R +1237A/G polymorphism when comparing the following versus controls: female sex, throughout the year occurrence of the symptoms, wheeze at rest, no family history of asthma, allergy, rhinitis, nonsmoker, long-standing cough that lasted for 3–8 weeks, and no cough problem (Table 5). However, a significant risk was found between IL-7R +2087T/C and asthma when comparing patients versus controls for the following: seasonal (summer, winter, spring, and autumn) occurrence of the symptoms, wheeze on exertion, family history of asthma, allergy, rhinitis, and no cough problem (Table 6).

The present study indicated that IL-7R +1237A/G and +2087T/C polymorphisms have a significant association with asthma in a north Indian population. One study, conducted with 282 Taiwanese children (82 controls and 200 patients with allergic asthma) of revealed that IL-7R is a potential candidate gene that confers susceptibility to mite-sensitized asthma.³³ Although the authors could not find any direct evidence among the genetic polymorphisms of IL-7R and the immunologic function of IL-7 and/or TSLP, the author indicated that IL-7R might trigger the early allergic immune cascade when in contact with mite allergens.³³ These results mark IL-7R +1237A/G and +2087T/C polymorphisms as a potential candidate gene in asthma.

With the development of molecular genetics, the field of genetics has evolved to better understand the human genome and its regulation, and to enlighten the contribution of single sequence variance to the progression of diseases.³⁴ The asthma-related gene polymorphisms are poorly understood, and, due to complex interplay of genetic and environmental factors in asthma, this field has become very challenging for the researchers.

Conclusions

The genetic findings of this study aimed to shed light on the association of IL-7R +1237A/G and +2087T/C polymorphisms and asthma in a north Indian population. Our results showed a highly significant association of asthma in heterozygous and in mutant genotype, together with the phenotypic parameters in +2087T/C polymorphism and protection from asthma in +1237A/G polymorphism, which indicated that both the polymorphisms of IL-7R might act as a predictive marker in the disease pathogenesis.

Footnotes

The authors have no conflicts of interest to declare pertaining to this article

References

Umetsu

D.T.

, McIntire

J.J.

, Akbari

Asthma: An epidemic of dysregulated immunity. Nat Immunol 3: 715–720, 2002.

von Mutius

Gene-environment interactions in asthma. J Allergy Clin Immun 123: 3–11, quiz, 12–13, 2009.

Obeidat

, and Hall

I.P.

Genetics of complex respiratory diseases: Implications for pathophysiology and pharmacology studies. Br J Pharmacol 163: 96–105, 2011.

Jiang

, Li

W.Q.

, Aiello

F.B.

Cell biology of IL-7, a key lymphotrophin. Cytokine Growth Factor Rev 16: 513–533, 2005.

S.K.

, Maki

, Kitamura

Induction of germline transcription in the TCRgamma locus by Stat5: Implications for accessibility control by the IL-7 receptor. Immunity 11: 213–223, 1999.

Shochat

, Tal

, Bandapalli

O.R.

Gain-of-function mutations in interleukin-7 receptor-α (IL 7R) in childhood acute lymphoblastic leukemias. J Exp Med 208: 901–908, 2011.

Gregory

S.G.

, Schmidt

, Seth

Interleukin 7 receptor alpha chain (IL 7R) shows allelic and functional association with multiple sclerosis. Nat Genet 39: 1083–1091, 2007.

van Roon

J.A.

, Glaudemans

K.A.

, Bijlsma

J.W.

, and Lafeber

F.P.

Interleukin 7 stimulates tumour necrosis factor alpha and Th1 cytokine production in joints of patients with rheumatoid arthritis. Ann Rheum Dis 62: 113–119, 2003.

Shamim

, Muller

, Svejgaard

Association between genetic polymorphisms in the human interleukin-7 receptor alpha-chain and inhalation allergy. Int J Immunogenet 34: 149–151, 2007.

10.

Rochman

, and Leonard

W.J.

Thymic stromal lymphopoietin: A new cytokine in asthma. Curr Opin Pharmacol 8: 249–254, 2008.

11.

Kurz

, Hoffjan

, Hayes

M.G.

Fine mapping and positional candidate studies on chromosome 5p13 identify multiple asthma susceptibility loci. J Allergy Clin Immunol 118: 396–402, 2006.

12.

Booth

D.R.

, Arthur

A.T.

, Teutsch

S.M.

Gene expression and genotyping studies implicate the interleukin 7 receptor in the pathogenesis of primary progressive multiple sclerosis. J Mol Med (Berl) 83: 822–830, 2005.

13.

Sun

L.Y.

, Zhang

H.Y.

, Feng

X.B.

Abnormality of bone marrow-derived mesenchymal stem cells in patients with systemic lupus erythematosus. Lupus 16: 121–128, 2007.

14.

van Roon

J.A.

, Hartgring

S.A.

, Wenting-van Wijk

Persistence of interleukin 7 activity and levels on tumour necrosis factor alpha blockade in patients with rheumatoid arthritis. Ann Rheum Dis 66: 664–669, 2007.

15.

Miller

M.R.

, Hankinson

, Brusasco

Standardisation of spirometry. ATS/ERS Task Force. Eur Respir J 26: 319–338, 2005.

16.

Laurent

, Noirot

, Ansquer

J.C.

How to define the normal level of serum IgE in adults [in French with English abstract]?

Ann Med Interne (Paris) 136: 419–422, 1985.

17.

Chowdary

V.S.

, Vinaykumar

E.C.

, Rao

J.J.

A study on serum IgE and eosinophils in respiratory allergy patients. Indian J Allergy Asthma Immunol 17: 21–24, 2003.

18.

Roe

B.A.

, Crabtree

J.S.

, and Khan

A.S.

DNA isolation and sequencing. In Essential Techniques Series. Rickwood

(Ed). New York: John Wiley and Sons, 85–86, 116–117, 1996.

19.

Shamim

, Ryder

L.P.

, Heilmann

Genetic polymorphisms in the genes encoding human interleukin-7 receptor-α: Prognostic significance in allogeneic stem cell transplantation. Bone Marrow Transplant 37: 485–491, 2006.

20.

Sen

, Paine

S.K.

, Chowdhury

I.H.

Association of interferon-gamma, interleukin-10, and tumor necrosis factor-alpha gene polymorphisms with occurrence and severity of Eales' disease. Invest Ophthalmol Vis Sci 52: 171–178, 2011.

21.

Purcell

, Neale

, Todd-Brown

PLINK: A tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 81: 559–575 2007.

22.

Y.W.

, and Malek

T.R.

The structure and function of gamma c-dependent cytokines and receptors: Regulation of T lymphocyte development and homeostasis. Crit Rev Immunol 18: 503–524, 1998.

23.

Standiford

T.J.

, Strieter

R.M.

, Allen

R.M.

IL-7 up-regulates the expression of IL-8 from resting and stimulated human blood monocytes. J Immunol 149: 2035–2039, 1992.

24.

Ziegler

S.F.

, Tough

T.W.

, Franklin

T.L.

Induction of macrophage inflammatory protein-1 beta gene expression in human monocytes by lipopolysaccharide and IL-7. J Immunol 147: 2234–2239, 1991.

25.

Nguyen

K.D.

, Vanichsarn

, and Nadeau

K.C.

TSLP directly impairs pulmonary Treg function: Association with aberrant tolerogenic immunity in asthmatic airway. Allergy Asthma Clin Immunol 6: 4, 2010.

26.

Zhang

, and Zhou

Functions of thymic stromal lymphopoietin in immunity and disease. Immunol Res 52: 211–223, 2012.

27.

Reche

P.A.

, Soumelis

, Gorman

D.M.

Human thymic stromal lymphopoietin preferentially stimulates myeloid cells. J Immunol 167: 336–343, 2001.

28.

Pandey

, Ozaki

, Baumann

Cloning of a receptor subunit required for signaling by thymic stromal lymphopoietin. Nat Immunol 1: 59–64, 2000.

29.

Park

L.S.

, Martin

, Garka

Cloning of the murine thymic stromal lymphopoietin (TSLP) receptor: Formation of a functional heteromeric complex requires interleukin 7 receptor. J Exp Med 192: 659–670, 2000.

30.

Soumelis

, Reche

P.A.

, Kanzler

Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat Immunol 3: 673–680, 2002.

31.

Bloemen

, Verstraelen

, Van Den Heuvel

The allergic cascade: Review of the most important molecules in the asthmatic lung. Immunol Lett 113: 6–18, 2007.

32.

Bunyavanich

, Melen

, Wilk

J.B.

Thymic stromal lymphopoietin (TSLP) is associated with allergic rhinitis in children with asthma. Clin Mol Allergy 9: 1, 2011.

33.

Wang

J-Y

, Lin

C-C

, Lin

C.G-J.

Polymorphisms of interleukin 7 receptor are associated with mite-sensitive allergic asthma in children in Taiwan. Tzu Chi Med J 22; 1: 18–23, 2010.

34.

Postma

D.S.

, Kerkhof

, Boezen

H.M.

, and Koppelman

G.H.

Asthma and chronic obstructive pulmonary disease common genes, common environments?

Am J Respir Crit Care Med 183: 1588–1594, 2011.

Association of Interleukin 7 Receptor (rs1494555 and rs6897932) Gene Polymorphisms with Asthma in a North Indian Population

Abstract

Background

Objective

Methods

Results

Conclusions

Materials and Methods

Ethical Clearance

Inclusion-Exclusion Criteria

Lung Function Test

Total Immunoglobulin IgE Measurement

Blood Sample Collection

Genotyping

Statistical Analysis

Results

Demographic Characteristics

Prevalence of Allelic and Genotypic Frequencies in IL-7R + 1237A/G and + 2087T/C Polymorphisms

Phenotypic Characteristics of IL-7R + 1237A/G and + 2087T/C Polymorphisms in Asthma

Discussion

Conclusions

Footnotes

References