The Mechanism of Anti-Viral Activity of a Novel,Hydroponically Selenium-Enriched Garlic Powder (SelenoForce ® ) Against SARS-CoV-2 Virus

Abstract

The pandemic caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is far from over as new strains are emerging all over the world. Selenium as a micronutrient is important for immunity and also has anti-viral activity.

Objective

The study evaluated the activity of a Selenium enriched garlic powder (SeGP or SelenoForce^®) against SARS-CoV-2 viral replication in vitro and explored its possible mechanism of action.

Methods

The anti-SARS-CoV-2 activity assay was carried out in Vero E6 cells in vitro. Human lung carcinoma A549 cells were used to study the antioxidant activity, expression of angiotensin converting enzyme (ACE), transmembrane protease, serine 2 (TMPRSS2) and the activity of proprotein convertase, and furin. Anti-inflammatory activity was evaluated in lipopolysaccharide-activated RAW 264.7 cells.

Results

SeGP inhibited the replication of SARS-CoV-2 in Vero E6 cells with an IC₅₀ of 19.59 μg/ml. It exhibited significant antioxidant activity in vitro with IC₅₀ value determined as 43.45 μg/ml. The Selenium enriched product inhibited the expression of ACE and TMPRSS2 and also showed inhibition of furin protease activity. In the presence of SeGP, the secretion of nitric oxide, interleukin −6 and TNF-α were reduced in activated RAW 264.7 macrophages.

Conclusion

The results of the study suggest that Selenium enriched garlic powder could inhibit SARS-CoV-2 multiplication in vitro, reduce oxidative stress and inflammatory mediators suggesting that it could be developed as an effective supplement or adjunct therapy to combat viral infections.

Keywords

selenium micronutrient SARS-CoV-2 inflammation oxidative stress

Introduction

Infectious viral diseases pose a massive threat to public health and remain as one of the major causes of death all over the world. Viruses are called “acellular parasites of cellular hosts” as they utilize the host cellular mechanisms for propagation and replication which make it difficult to destroy them without affecting the host cell.¹ Immunization with effective vaccines has led to the eradication of few viral diseases like polio and smallpox and is effective to combat other viral diseases including, hepatitis virus, herpes simplex virus (HSV), respiratory syncytial virus (RSV), and influenza virus.² However, the emergence, resurgence and spreading of animal viruses have become serious public concern in the past few decades despite the tremendous progress in human medicine. The scenario got worsened when the world population was adversely affected by novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), responsible for the pandemic, Coronavirus disease-2019 (COVID-19). SARS-CoV-2 infection primarily induces pro-inflammatory cytokines (eg, IL-1 and IL- 6) and lung inflammation. It ultimately affects the normal functioning of vital organs enhancing comorbidities and mortality.³ Till now, the SARS-CoV-2 virus has infected around 7 billion people and caused over 6 million deaths around the world (https://www.worldometers.info/coronavirus).

In addition to vaccines, drugs also become life-saver at the time of the pandemic. A treatment strategy combining the pharmaceutical drugs and herbal medicines as an adjunct therapy was found effective in managing the COVID-19 infection.⁴ Natural products, especially plants are a rich source of pharmacologically active substances and become excellent candidates for drug discovery due to their chemical diversity and safety. Several clinical studies provide evidence for the efficacy and safety of herbal extracts and phytochemicals as potential immune boosters to defend against SARS-CoV-2 infection.^5-10 Additionally, novel formulations of natural products were found to be targeting multiple signaling pathways of SARS-CoV-2 infection and were suggested as supportive therapy to hasten recovery and reduce severe morbidity and mortality in patients.¹¹ An understanding of the molecular mechanisms of viral invasion and replication will enable us to design anti-viral drugs from natural products targeting the different stages of the viral replication cycle. Inhibitors of angiotensin-converting enzyme 2 (ACE2), transmembrane protease, serine 2 (TMPRSS2) and furin, the protease that activates the spike protein of SARS-CoV-2 virus were found to be effective in reducing viral load which make it a potent therapeutic approach for treatment of SARS-CoV-2 infection.¹² Further, antioxidant and anti-inflammatory activities are beneficial in preventing the secondary complication of the infection.^13,14

Micronutrients like vitamins and essential minerals are crucial in every stages of the immune response. Micronutrient deficiencies were found associated with immunosuppression and increased susceptibility to infections.¹⁵ Selenium (Se), an essential micronutrient has a long history of lowering the severity of viral infections.^16,17 The source and chemical form of Selenium in food are important factors affecting its bioavailability in humans. Generally, organic Selenium compounds are more bioavailable than inorganic Selenium compounds and Selenium from plant sources shows better bioavailability than that of animal sources.^18,19 The physiological functions of Selenium are mainly executed by selenoproteins that are crucial for maintaining the redox balance in cells, and controling other functions such as cell proliferation, differentiation, apoptosis, cytokine expression, and anti-viral activities.^20,21 Selenium is known to lower the susceptibility and severity of viral infections and consequently, its deficiency impacts immune response to viruses, expression of viral proteins and antioxidant response.^22-24 Selenium status was reported to have a positive correlation with the survival of patients with COVID-19 compared with non-survivors suggesting that Selenium supplementation may be helpful in reducing the comorbidities associated with COVID-19.^25-27

Garlic or Allium sativum L. is popular as a functional food and a traditional medicine since ancient time. It contains organosulfur (allicin and alliin) compounds and flavonoids like quercetin which are found to be responsible for anti-viral activities via immune modulation.³ Selenium enriched garlic powder (SeGP) is manufactured using a proprietary soil-less culture technique containing a unique composition of organoSelenium compounds. In this process, garlic bulbs are naturally enriched with selenoamino acids, L-methyl selenocysteine (MSC) and l-selenomethionine (LSM) and dipeptides,γ-glutamyl Se-methyl-l-selenocysteine (GGMSC) and γ-glutamyl-selenomethionine (GGLSM). In the present study, we explored the anti-viral activity of SeGP (marketed as SelenoForce^®), containing 1000 μg/g of total Selenium in the form of GGLSM (65.2%), LSM (26.4%), MSC (4.6%) and GGMSC (3.8%). Apart from Selenium compounds, the garlic powder also contained Alliin at 399.2 μg/g.

Materials

SeGP (marketed as SelenoForce^®) was obtained from Sami-Sabinsa Group Limited. Dulbecco’s modified minimal essential medium (DMEM) from Life Technologies (CA, United States) and fetal bovine serum (FBS) from GIBCO/Invitrogen (Carlsbad, CA, United States), Trizol reagent^® from Invitrogen (Carlsbad, CA, United States), Revert-aid First Strand cDNA synthesis kit from Thermo Fisher Scientific and ELISA kits from R&D Systems (Minneapolis, MN, United States) were used in the study. pERTKR-AMC (L-pyroglutamyl-Arg-Thr-Lys-Arg-7-amino-4-methylcoumarin) was purchased from R&D Systems (Minneapolis, MN, United States).

Methodology

Cell Culture

In vitro experiments in Vero E6 cells (derived from the kidney of African green monkey) were carried out at the Institute of Life Sciences, Bhubaneswar, an autonomous institute of the Department of Biotechnology, Govt. of India.

Human lung carcinoma A549 and RAW 264.7 macrophage cells were procured from the National Center for Cell Sciences (NCCS), Pune, India and maintained at 37°C in a 5% CO₂ atmosphere, in complete Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% of fetal bovine serum (FBS) and 40 μg/ml gentamycin.

Preparation of SeGP for in vitro Experiments

SeGP was dissolved in dimethyl sulphoxide (DMSO) at a concentration of 10 mg/mL, sonicated in a water bath sonicator at room temperature for 5 min and centrifuged at 2000 r/min for 5 min to remove the insoluble particles from garlic bulb. The stock was used for the preparation of different dilutions in culture media or buffers for in vitro experiments. The in vitro activities were studied at 50, 25, 12.5 and 6.2 μg/ml of SeGP which correspond to approximately 50, 25, 12.5 and 6.5 ng/mL of selenoamino acids respectively.

In vitro Anti-SARS-CoV-2 Activity

In vitro anti-SARS-CoV-2 activity assay was carried out in Vero E6 cells (derived from the kidney of an African green monkey) at the Institute of Life Sciences (ILS) Bhubaneswar, an autonomous institute of the Department of Biotechnology, Govt. of India, with established platforms for drug screening for viral diseases. SARS-CoV-2 strain ILS-03 (Accession no. EPI_ISL_1196305) successfully adapted and isolated in Vero cells at ILS, Bhubaneswar was used for this study. No animals/humans were used in the study.

Cytotoxicity Assay

Briefly, Vero E6 cells were seeded in the 96 well plate at 80% confluency and treated with various concentrations of SeGP. For toxicity determination, minimum of 3 concentrations were used. Cytotoxicity was determined 24 h post-treatment using (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) assay (MTT assay). 100 μl of MTT solution (5 mg/mL) was added to 96 wells and incubated for 2-3 h at 37°C. After incubation, 100 μL of DMSO was added to each well to solubilize the formazan crystals, under shaking conditions. The absorbance was recorded at 570 nm. Each concentration was assayed in triplicates and the percentage cell viability was calculated with respect to vehicle control.

Anti SARS-CoV-2 Activity Assay

Vero E6 cells seeded in 96-well plates at 80% confluency were infected with SARS-CoV-2 isolate at multiplicity of infection (MOI) of 0.1 for 2 h. Subsequently, the inoculum was aspirated and fresh media containing different concentrations of the SeGP was added to the cells. The supernatant of 24 h post-infection was subjected to viral RNA isolation followed by qRT-PCR for determining the SARS-CoV-2 viral load in the cells (cell associated) and culture supernatants (released virus particles). The qRT-PCR was performed using primers specific for the viral spike, nucleocapsid and ORF1a for both released and cell-associated virus. Percentage reduction of viral loads in cells and culture supernatants was plotted in comparison to vehicle treated controls. Remdesivir was used as a positive control.

In vitro Assays in Human Lung Carcinoma A549 Cells and RAW 264.7 Cells

Cytotoxicity/Selection of Nontoxic Concentrations for Cell Assays

Human lung carcinoma A549 cells and RAW 264.7 cells (5 × 10⁴ cells/well) were exposed to varying concentrations of SeGP for 24 h. Cytotoxicity/cell viability of SeGP was analyzed by using MTT colorimetric assay according to the standard method described previously.²⁸

H₂O₂ Induced Reactive Oxygen Species Scavenging Activity

Human lung carcinoma A549 cells were seeded at 5 × 10⁴ cells/well in 96 well black plates and allowed to grow as a monolayer for 24 hours. Cells were exposed to 25 mM hydrogen peroxide (H₂O₂) with or without the test sample for 4 hours in DMEM supplemented with 2% FBS. Freshly prepared dichlorodihydrofluorescein diacetate (DCFH-DA) reagent was added to all the wells (1 μg/well). The plate was incubated at 37°C for 30 min and fluorescence was recorded at 485:520, Ex:Em wavelength in microplate reader (FLUOstar Optima, BMG Labtech, Germany).²⁹

Furin Inhibition Assay

Human lung carcinoma A549 cells were seeded at 5 × 10⁴ cells/well in 96 well black plates and allowed to grow as a monolayer for 24 h. Cells were treated with samples for 24 h in DMEM containing 2% FBS. Wells with only DMEM +2% FBS media served as control. After 24 h of incubation, media was replaced with 25 μM fluorogenic peptide substrate, pERTKR-AMC (L-pyroglutamyl-Arg-Thr-Lys-Arg-7-amino-4-methylcoumarin) as substrate in 25 mM Tris buffer (pH-9, 1 mM CaCl₂, 0.5% (w/v) Brij-35, 0.1% BSA) for 1 h. The fluorescence was recorded at 380:460, Ex:Em wavelength in microplate reader (FLUOstar Optima, BMG Labtech, Germany). Furin activity was calculated in comparison to control.

ACE-2 and TMPRSS2 Inhibition Assay

The expression of Angiotensin converting enzyme (ACE) and Transmembrane protease, serine 2 (TMPRSS2) were studied in human lung carcinoma A549 cells. The cells were seeded at 4 × 10⁵ cells per well in 6 well plates and allowed to grow as a monolayer for 24 h. Cells were treated with test samples for 24 h in DMEM 2% FBS. Wells with only DMEM 10% FBS media served as control. After 24 h of incubation, the supernatants were collected and the total cellular RNA was isolated using Trizol reagent^® according to the manufacturer’s instructions, followed by RNase-free DNase I treatment (Thermo Fisher Scientific) to remove any genomic DNA. Messenger RNA quality and concentration were analyzed spectrophotometrically (NanoDrop Lite, Thermo Fisher Scientific). One microgram of total RNA was reverse transcribed into cDNA using Revert-aid First Strand cDNA synthesis kit (Thermo Fisher Scientific), according to the manufacturer’s instructions, and stored at −80°C until use. Quantitative real-time PCR (qRT-PCR) was performed using SYBR Green qPCR master mix fluorescent dye using Light cycler 96 (Roche Life Science) according to the manufacturer’s instructions (Thermo Scientific). The primer sequence is provided in Table 1.

Table 1.

List of Primer Sequences.

h- ACE2 F	AAACATACTGTGACCCCGCAT
h- ACE2 R	CCAAGCCTCAGCATATTGAACA
h-TMPRSS2 F	AATCGGTGTGTTCGCCTCTAC
h-TMPRSS2 R	CGTAGTTCTCGTTCCAGTCGT
h-18SrRNA f	GGCGTTCTTAGTTGGTGGAGCG
h-18SrRNA r	CTGAACGCCACTTGTCCCTC

Anti-Inflammatory Assay

RAW 264.7 cells (0.5 × 10⁵ cells/well) were seeded into 96 well cell culture plates in growth media. The cells were stimulated with 100 ng/mL lipopolysaccharides (LPS) along with different concentrations of sample and incubated for 24 h at 37°C, in a CO₂ (5%) incubator. The wells without LPS (100 ng/mL) served as control. The supernatants were collected to detect the levels of inflammatory markers. The inducible nitric oxide (NO) level is detected based on the Griess reaction. Briefly, 50 μL of cell culture medium was mixed with 50 μL of Griess reagent I [1% (w/v) sulfanilamide in 5% (v/v) phosphoric acid] and 50 μL Griess reagent II [0.1% (w/v) N-(1-Naphthyl) ethylenediamine dihydrochloride], incubated at room temperature for 10 min, and then, the absorbance was taken at 540 nm. The inflammatory markers like tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) were quantified using ELISA kits as per the manufacturer’s instruction (R & D Systems, Minneapolis, MN, United States).

Statistical Analyses

All data are presented as the mean ± standard deviation (SD) of the triplicates. P values were determined by one-way analysis of variance (ANOVA) using GraphPad prism software version 10.0.2 (GraphPad Software, Inc, La Jolla, CA, USA). Significance was defined at 5% level.

Results

Selenium Compounds Present in SeGP

Garlic powder, naturally enriched with Selenium contained selenoamino acids and dipeptides as major Selenium compounds (Figure 1).

Figure 1.

Selenoamino acids and dipeptides present in SeGP.

SeGP Showed Anti-SARS-CoV-2 Activity in vitro

The inhibitory efficacy of SeGP towards viral replication in living cells was investigated using Vero cell line. Initially, the maximum non-cytotoxic concentration of SeGP in Vero cells was detected by incubating the cells for 24 h followed by MTT assay. After treating with 25 μg/ml of SeGP, 89% of the cells were viable and it was considered as the highest permissible non-cytotoxic concentration to be taken forward for assessing anti-SARS-CoV-2 efficacy in vitro. SeGP (10, 15, 20 and 25 μg/ml) treatment dose dependently reduced the viral load in Vero cells. SeGP at concentrations of 20 and 25 μg/ml significantly reduced the viral load by 53 and 85% respectively whereas 10 and 15 μg/ml did not show any detectable reduction in viral load (Table 2). The lC₅₀ value of SeGP against SARS-CoV-2 was found to be 19.59 μg/ml. The cell viability experiments were performed simultaneously under the same conditions in the absence of virus which revealed no effects on cell viability at concentrations where the compounds showed anti-viral activity.

Table 2.

Anti-SARS-CoV2 Activity of SeGP in Vero Cells.

Sample	Ct values	Viral Copy Number/Ml	% Reduction
Control	25.625	37573.77
SeGP (10 μg/ml)	25.25	48047.27	No reduction
SeGP (15 μg/ml)	25.332	45555.59	No reduction
SeGP (20 μg/ml)	26.803	17319.84	53
SeGP (25 μg/ml)	28.563	5445.427	85
Remdesivir (positive control)	32.096	533.69	98.5%

Cytotoxicity/Viability Assay in Human Lung Carcinoma A549 and RAW 264.7 Macrophages

Non-cytotoxic concentrations of SeGP towards different cell lines, human lung carcinoma A549 and RAW 264.7 macrophages were detected after 24 h of exposure followed by MTT assay. Both the cells showed significant cytotoxic response only at 100 μg/ml of SeGP (Figure 2) and the noncytotoxic concentrations of 12.5, 25 and 50 μg/ml of SeGP were used for subsequent studies.

Figure 2.

Cytotoxicity of SeGP in A549 and RAW264.7 cells by MTT assay.

SeGP Showed Significant Inhbition of Furin Activity in Human Lung Carcinoma A549 Cells

Human furin inhibition activity of SeGP was measured using fluorogenic peptide pERTKR-AMC as substrate. Furin hydrolyzes the Arg-AMC amide bond and releases 7-amino-4-methylcoumarin (AMC), a highly fluorescent group detectable with the fluorescence reader. SeGP dose-dependently reduced the activity of furin compared to the normal lung carcinoma cells. At concentrations of 12.5, 25 and 50 μg/ml, SeGP, inhibited the activity of furin by 7 %, 10 % and 14% respectively compared to the normal cells and the changes were found statistically significant. The treatment with 6.25 μg/ml of SeGP did not induce a significant change in furin activity (Figure 3).

Figure 3.

Effect of SeGP on furin activity. Data are expressed as mean ± SD. *P < 0.05 and **P < 0.005 vs control cells.

SeGP Down Regulated the Expression of ACE2 and TMPRSS2 in Human Lung Carcinoma A549 Cells

SeGP treatment reduced the expression of ACE2 and TMPRSS2 in human lung carcinoma A549 cells. At a concentration of 12.5 μg/ml the relative mRNA of ACE2 and TMPRSS2 expression were reduced by 24.4% and 20.7% respectively compared to the untreated control (Figure 4).

Figure 4.

Relative expression of ACE2 and TMPRSS2 genes in SeGP (12.5 μg/ml) treated cells compared to untreated control.

SeGP Reduced Oxidative Stress in Human Lung Carcinoma A549 Cells

The antioxidant activity of SeGP was observed in H₂O_2-induced ROS in lung carcinoma A549 cells using fluorescent probe 2′, 7′-dichlorodihydrofluorescein (DCFH). SeGP at concentrations of 12.5, 25 and 50 μg/ml reduced ROS levels to 72.7% (P < 0.05), 61.3% (P < 0.005) and 49.3% (P < 0.0005) respectively whereas treatment with 6.25 μg/ml did not show any significant reduction in ROS level (96%) compared to the lung cells induced with H₂O₂ (Figure 5). Thus, the sample showed a dose-dependent reduction in ROS levels with an IC₅₀ value of 43.45 μg/ml.

Figure 5.

Effect of SeGP on H₂O₂-induced reactive oxygen species (ROS) generation in A549 cells. Data are expressed as mean ± SD. ^#P < 0.0001 vs Control, and *P < 0.05, **P < 0.005 and ***P < 0.0005 vs H₂O₂ treated cells.

SeGP Showed Significant Anti-Inflammatory Activities in RAW 264.7 Macrophages

The inducible secretion of NO by the activated macrophages were detected using Griess reaction. The treatment with SeGP showed a significant reduction in the concentration of NO dose dependently indicating its anti-inflammatory activity. Nitric oxide production was reduced from 26.48 μM to 21.5 μM (18.8% reduction) when LPS induced RAW 264.7 macrophages were treated with SeGP at a concentration of 50 μg/ml (Figure 6A).

Figure 6.

Effect of SeGP on inflammation. (A) NO, (B) TNF-α and (C) IL-6. Data are expressed as mean ± SD. *P < 0.05, **P < 0.005 and **P < 0.0005 vs LPS induced cells.

The levels of inflammatory markers in the supernatant of RAW 264.7 macrophages activated with LPS were detected by ELISA. It was found that the secretions of inflammatory cytokines TNF-α and IL-6 were inhibited in a dose-dependent manner by SeGP treatment in LPS activated RAW 264.7 macrophage cells. Treatment with LPS induced the secretion of 24 476 ± 1506 pg/mL of TNF-α. At the concentrations of 12.5, 25 and 50 μg/ml, SeGP reduced the TNF-α in culture supernatants to 20 722 ± 355 pg/mL (84.6%), 20 231 ± 48 pg/mL (82.7%) and 16 908 ± 1147 pg/mL (69.1%) respectively (Figure 6B). The IL-6 levels were significantly reduced from 1995 ± 225 pg/mL to 1146 ± 288 pg/mL (57.4%), 911 ± 11.5 pg/mL (45.6%) and 540 ± 41.4 pg/mL (27.1%) at 12.5, 25 and 50 μg/ml respectively (Figure 6C).

Discussion

Selenium, an important micronutrient, is incorporated into selenoproteins, which are indispensable for the normal functioning of our body. Selenium is known to lower the susceptibility and severity of viral infections and consequently, its deficiency impacts immune response to viruses, expression of viral proteins and antioxidant response.^22-24 Several preclinical and clinical studies suggested that selenoproteins are involved in reducing oxidative stress, inflammation, ferroptosis and endoplasmic reticulum (ER) stress associated with viral infections including COVID-19.^26,27,30 Hence, Selenium supplementation is suggested to be beneficial in severely diseased and Selenium-deficient COVID-19 patients.³¹

However, excessive as well as deficient consumption of Selenium induces health risks. The World Health Organization (WHO) recommends a Selenium intake level of 55 μg/day for adults, with the tolerable upper limit set at 400 μg/day and plasma/blood levels in the general population lie around 100 μg Selenium/l.^32,33 SeGP is a novel extract of organoselenium enriched extract of garlic, containing approximately 1000 μg of Selenium per gram of the extract. The dose of this supplement is fixed at not more than 100 mg/day equivalent to 100 μg of organoselenium. In the present sudy, we demonstrate the anti-viral, antioxidant and anti-inflammatory activities of SeGP in vitro.

As per the recent report by the WHO, there is a resurgence of SARS-CoV-2 infection globally, with a 52% increase in new cases during the 28-day period of 20 November to 17 December 2023 as compared to the previous 28-day period.³⁴ Hence, COVID-19 is still a concern due to its emerging variants, breakthrough infections and a general relaxation restrictions. Understanding the mechanisms of Coronavirus infections are crucial in developing new treatment strategies to attenuate the impact of the disease.

SARS-CoV-2 entry into the host cells is mediated by the binding of the viral spike protein to ACE2 and the activation of this spike protein by the proprotein convertases.³⁵ The capacity of SARS-CoV-2 to infect the cells is mediated by 2 indispensable cleaving steps of the viral spike protein. This protein is cleaved into S1 and S2 subunits, by the TMPRSS2 protease.³⁶ The S1 domain is responsible for receptor binding and the S2 domain initiates the membrane fusion.³⁷ Following endocytosis of the virus, lysosomal proteases further cleave the S2 subunit to release the hydrophobic fusion peptide to fuse with the cell membrane. Furin, is a proprotein convertase, located in the trans-Golgi network which cleaves precursor proteins with specific motifs (The first and fourth amino acids at the N terminus of the substrate cleavage site must be arginine “Arg-X-X-Arg ↓”) to produce mature proteins with biological activity.³⁸ One of the reasons for high infectivity of SARS-CoV-2 was proposed to be due to the presence of redundant furin cleavage site in its spike protein.³⁹ The reduced expressions of furin, ACE-2 and TMPRSS2 in lung cells and other tissues could be exploited by anti-viral compounds to ameliorate the spread of the virus. We observed that SeGP could inhibit the expression of all these proteins in vitro. These findings are consistent with earlier studies demonstrating the anti-viral properties of plant extracts and Selenium derivatives. Resveratrol, was reported to reduce the expression of nucleocapsid (N) protein essential for MERS-CoV replication in Vero cells.⁴⁰ Several phytochemicals have been shown to interfere with SARS-CoV-2 viral entry and replication proteins by docking studies.⁴¹ Ebselen, a synthetic organoSelenium drug molecule and its derivative were shown to inhibit the SARS-CoV-2 main protease (Mpro), critical for viral replication.⁴²

SARS-CoV-2 infection involves complex interactions between the viruses and target cells where oxidative stress plays a crucial role. ROS induces tissue damage, thrombosis, and red blood cell dysfunction, contributing to the severity of SARS-CoV-2 infection.⁴³ SARS-CoV-2 infected patients have reported that excessive level of ROS is associated with severity of illness which promotes a cascade of biological events to drive host pathological responses.^44,45 Increased oxidative stress significantly reduced anti-viral host responses and increased virus-induced inflammation leading to multi-organ damage.⁴⁶ Hence, the compounds with antioxidant activity are expected be an active drug candidate in COVID-19 therapy. SeGP was effective in reducing oxidative stress in H₂O₂ induced A549 cells with an IC₅₀ value of 43.45 μg/ml.

Although hyper-inflammation is a key characteristic of SARS-CoV-2 infection, no therapy has succeeded to reduce the exacerbated immune response associated with severe SARS-CoV-2 infection.^47,48 Hence apart from preventing viral entry, attenuation of SARS-CoV-2 -induced hyper-inflammation also remains as a prime focus in the therapeutic modality of SARS-CoV-2 infection. The anti-inflammatory potential of SeGP was evaluated in activated macrophages in vitro. Nitric oxide (NO) serves as a pro-inflammatory mediator that induces several downstream inflammatory pathways⁴⁹ which was reduced significantly by SeGP treatment. SeGP also significantly reduced the levels of TNF-α and IL-6 in the culture supernatant of activated macrophages. Several studies have suggested that elevated levels of IL-6 are associated with cytokine storm and longer hospital stays.⁵⁰ In a systematic review and meta-analyses, including 1798 patients, patients with COVID-19 were found to have elevated levels of IL- 6 in serum.⁵¹ Thus, a reduction in IL-6 may have multiple benefits in patients with viral infection. Downregulation of these inflammatory components, consequently, reduces the severity and progression of the disease suggesting that SeGP could be a beneficial supplement to be used as an adjunct therapy for viral infections.

The molecular basis for this antiviral effect still needs to be completely elucidated. Further, the product also contained Alliin (S-allyl cysteine sulfoxide), at 0.04% w/w. Alliin is known to have antioxidant activity, which could have also influenced the overall activity of SeGP, which needs to be independently evaluated in future studies. However, it may be conceivable that the antiviral activity of SeGP may be mediated by multiple pathways viz inhibiting furin, ACE2 receptor and TMPRSS2. SeGP is also effective as an antioxidant and anti-inflammatory extract, which are beneficial in controlling the comorbidities associated with SARS-CoV-2 infection.

Conclusions

In conclusion, the results of this study demonstrate that Selenium enriched garlic powder inhibited SARS-CoV-2 multiplication in vitro, probably by interfering with the virus and host cell interactions. Further the Selenium product was also effective in reducing oxidative stress and inflammatory mediators, which will augment the effect of the product as an adjunct therapy for viral infection. Further studies are warranted to enumerate the detailed pathways of viral replication influenced by the product and to evaluate the efficacy in clinical settings.

Footnotes

Acknowledgments

The authors thank the Institute of Life Sciences, Bhubaneswar, Odisha, India for their help in studies with antiviral activity against SARS-CoV 2 virus. The help from the staff of Department of biotechnology- Institute of Life Sciences BIOINCUBATOR (An Autonomous Institute of Department of Biotechnology, Government of India),is gratefully acknowledged.

Author Contributions

Conceptualization, Muhammed Majeed and Kalyanam Nagabhushanam; Formal analysis, Lincy Lawrence and Lakshmi Mundkur; Investigation, Lincy Lawrence and Priji Prakasan; Methodology, Lincy Lawrence and Lakshmi Mundkur; Project administration, Kalyanam Nagabhushanam; Resources, Muhammed Majeed; Supervision, Lakshmi Mundkur; Writing – original draft, Lincy Lawrence and Priji Prakasan; Writing – review & editing, Muhammed Majeed, Kalyanam Nagabhushanam, and Lakshmi Mundkur. All authors have read and agreed to the published version of the manuscript.

Declaration of Conflicting Interests

The author(s) declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: All the authors are employees of Sami-Sabinsa Group Limited or Sabinsa Corporation, which markets SelenoForce^®.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Patents

The following patents are granted for SelenoForce. WO2007067600A2, NZ568233A, EP06839082A, PT06839082T.

ORCID iD

Lakshmi Mundkur

Data Availability Statement

All data associated with the study are available in the manuscript. Any additional data may be provided on request to the corresponding author.*

References

Chattopadhyay

Sarkar

Chatterjee

, et al. Recent advancements for the evaluation of anti-viral activities of natural products. N Biotech. 2009;25(5):347-368.

Kitazato

Wang

Kobayashi

. Viral infectious disease and natural products with antiviral activity. Drug Discov Ther. 2007;1(1):14-22.

Khubber

Hashemifesharaki

Mohammadi

Gharibzahedi

SMT

. Garlic (Allium sativum L.): a potential unique therapeutic food rich in organosulfur and flavonoid compounds to fight with COVID-19. Nutr J. 2020;19:1-3.

Raman

Rajagopal

Ramesh

, et al.

Drug target of natural products and COVID-19: how far has science progressed?

Ann Med Surg. 2023;85(6):2731-2742.

Nile

Kai

. Recent clinical trials on natural products and traditional Chinese medicine combating the COVID-19. Indian J Microbiol. 2021;61:10-15.

Verma

Rawat

Rani

, et al. Adhatoda vasica and Tinospora cordifolia extracts ameliorate clinical and molecular markers in mild COVID-19 patients: a randomized open-label three-armed study. Eur J Med Res. 2023;28(1):556. doi:10.1186/s40001-023-01507-7

Ahmadpour

Toulabi

Yadegarinia

Yarahmadi

Mohammadi

Keyvanfar

. Efficacy of olive leaves extract on the outcomes of hospitalized covid-19 patients: a randomized, triple-blinded clinical trial. Explore. 2023;19(4):536-543. doi:10.1016/j.explore.2022.10.020

Kosari

Khorvash

Sayyah

, et al. The influence of propolis plus Hyoscyamus niger L. against COVID-19: a phase II, multicenter, placebo-controlled, randomized trial. Phytother Res. 2024;38(1):400-410. doi:10.1002/ptr.8047

Koshak

Mobeireek

, et al. Nigella sativa for the treatment of COVID-19: an open-label randomized controlled clinical trial. Compl Ther Med. 2021;61:102769. doi:10.1016/j.ctim.2021.102769

10.

Pawar

Mastud

Pawar

, et al. Oral curcumin with piperine as adjuvant therapy for the treatment of COVID-19: a randomized clinical trial. Front Pharmacol. 2021;12:669362. doi:10.3389/fphar.2021.669362

11.

Majeed

Nagabhushanam

Shah

Mundkur

. A randomized, double-blind, placebo-controlled study to assess the efficacy and safety of a nutritional supplement (ImmuActive TM) for COVID-19 patients. Evid Based Complement Alternat Med. 2021;2021:8447545.

12.

Bestle

Heindl

Limburg

, et al. TMPRSS2 and furin are both essential for proteolytic activation of SARS-CoV-2 in human airway cells. Life Sci Alliance. 2020;3(9).

13.

Pisoschi

Pop

Iordache

, et al. Antioxidant, anti-inflammatory and immunomodulatory roles of vitamins in COVID-19 therapy. Eur J Med Chem. 2022;232:114175.

14.

Beltrán-García

Osca-Verdegal

Pallardó

, et al. Oxidative stress and inflammation in COVID-19-associated sepsis: the potential role of anti-oxidant therapy in avoiding disease progression. Antioxidants. 2020;9(10):936.

15.

Pecora

Persico

Argentiero

Neglia

Esposito

. The role of micronutrients in support of the immune response against viral infections. Nutrients. 2020;12(10):3198.

16.

Guillin

Vindry

Ohlmann

Chavatte

. Selenium, selenoproteins and viral infection. Nutrients. 2019;11(9):2101.

17.

Martinez

Huang

Acuna

, et al. Role of selenium in viral infections with a major focus on SARS-CoV-2. Int J Mol Sci. 2021;23(1):280.

18.

Finley

. Bioavailability of selenium from foods. Nutr Rev. 2006;64(3):146-151.

19.

Zhang

Wei

. Selenium and selenoproteins in health. Biomolecules. 2023;13(5):799.

20.

Fairweather-Tait

Bao

Broadley

, et al. Selenium in human health and disease. Antioxidants Redox Signal. 2011;14(7):1337-1383.

21.

Zhang

Saad

Taylor

Rayman

. Selenium and selenoproteins in viral infection with potential relevance to COVID-19. Redox Biol. 2020;37:101715.

22.

Beck

Levander

Handy

. Selenium deficiency and viral infection. J Nutr. 2003;133(5):1463S-1467S.

23.

Avery

Hoffmann

. Selenium, selenoproteins, and immunity. Nutrients. 2018;10(9):1203.

24.

Rayman

. Selenium and human health. Lancet. 2012;379(9822):1256-1268.

25.

Majeed

Nagabhushanam

Gowda

Mundkur

. An exploratory study of selenium status in healthy individuals and in patients with COVID-19 in a south Indian population: the case for adequate selenium status. Nutrition. 2021;82:111053.

26.

Majeed

Nagabhushanam

Prakasan

Mundkur

. Can selenium reduce the susceptibility and severity of SARS-CoV-2? a comprehensive review. Int J Mol Sci. 2022;23(9):4809.

27.

Rayman

Taylor

Zhang

. The relevance of selenium to viral disease with special reference to SARS-CoV-2 and COVID-19. Proc Nutr Soc. 2023;82(1):1-12.

28.

Liu

Huang

, et al. Satb1 promotes Schwann cell viability and migration via activation of PI3K/AKT pathway. Eur Rev Med Pharmacol Sci. 2018;22(13):4268-4277.

29.

Wojtala

Bonora

Malinska

Pinton

Duszynski

Wieckowski

. Methods to monitor ROS production by fluorescence microscopy and fluorometry. Methods Enzymol. 2014;542:243-262. doi:10.1016/b978-0-12-416618-9.00013-3

30.

Khatiwada

Subedi

. A mechanistic link between selenium and coronavirus disease 2019 (COVID-19). Curr Nutr Rep. 2021;10:125-136.

31.

Moghaddam

Heller

Sun

, et al. Selenium deficiency is associated with mortality risk from COVID-19. Nutrients. 2020;12(7):2098.

32.

Hadrup

Ravn-Haren

. Acute human toxicity and mortality after selenium ingestion: a review. J Trace Elem Med Biol. 2020;58:126435.

33.

Levander

Moser

Morris

. Dietary selenium intake and selenium concentrations of plasma, erythrocytes, and breast milk in pregnant and postpartum lactating and nonlactating women. Am J Clin Nutr. 1987;46(4):694-698.

34.

COVID-19 Epidemiological Update – 22 December 2023. World Health Organization; 2023. https://www.who.int/publications/m/item/covid-19-epidemiological-update---22-december-2023. Accessed December 29, 2023.

35.

Villoutreix

Badiola

Khatib

A-M

. Furin and COVID-19: structure, function and chemoinformatic analysis of representative active site inhibitors. Front Drug Discov. 2022;2.

36.

Glowacka

Bertram

Müller

, et al. Evidence that TMPRSS2 activates the severe acute respiratory syndrome coronavirus spike protein for membrane fusion and reduces viral control by the humoral immune response. J Virol. 2011;85(9):4122-4134. doi:10.1128/jvi.02232-10

37.

Belouzard

Chu

Whittaker

. Activation of the SARS coronavirus spike protein via sequential proteolytic cleavage at two distinct sites. Proc Natl Acad Sci U S A. 2009;106(14):5871-5876. doi:10.1073/pnas.0809524106

38.

Feliciangeli

Thomas

Scott

, et al. Identification of a pH sensor in the furin propeptide that regulates enzyme activation. J Biol Chem. 2006;281(23):16108-16116. doi:10.1074/jbc.M600760200

39.

Zheng

Yang

, et al. Furin: a potential therapeutic target for COVID-19. iScience. 2020;23(10):101642. doi:10.1016/j.isci.2020.101642

40.

Lin

Chuo

Wang

Lin

. Effective inhibition of MERS-CoV infection by resveratrol. BMC Infect Dis. 2017;17(1):144. doi:10.1186/s12879-017-2253-8

41.

Limanaqi

Busceti

Biagioni

, et al. Cell clearing systems as targets of polyphenols in viral infections: potential implications for COVID-19 pathogenesis. Antioxidants. 2020;9(11):1105.

42.

Amporndanai

Meng

Shang

, et al. Inhibition mechanism of SARS-CoV-2 main protease by ebselen and its derivatives. Nat Commun. 2021;12(1):3061.

43.

Laforge

Elbim

Frère

, et al. Tissue damage from neutrophil-induced oxidative stress in COVID-19. Nat Rev Immunol. 2020;20(9):515-516.

44.

Muhoberac

. What can cellular redox, iron, and reactive oxygen species suggest about the mechanisms and potential therapy of COVID-19? Front Cell Infect Microbiol. 2020;10:569709.

45.

Cecchini

. SARS-CoV-2 infection pathogenesis is related to oxidative stress as a response to aggression. Med Hypotheses. 2020;143:110102.

46.

Gain

Song

Angtuaco

Satta

Kelesidis

. The role of oxidative stress in the pathogenesis of infections with coronaviruses. Front Microbiol. 2022;13:1111930.

47.

Lariccia

Magi

Serfilippi

Toujani

Gratteri

Amoroso

. Challenges and opportunities from targeting inflammatory responses to SARS-CoV-2 infection: a narrative review. J Clin Med. 2020;9(12):4021.

48.

Zoulikha

Huang

. COVID-19 inflammation and implications in drug delivery. J Contr Release. 2022;346:260-274.

49.

Zamora

Vodovotz

Billiar

. Inducible nitric oxide synthase and inflammatory diseases. Mol Med. 2000;6(5):347-373.

50.

Nikkhoo

Mohammadi

Hasani

, et al. Elevated interleukin (IL)-6 as a predictor of disease severity among Covid-19 patients: a prospective cohort study. BMC Infect Dis. 2023;23(1):311. doi:10.1186/s12879-023-08294-w

51.

Coomes

Haghbayan

. Interleukin-6 in Covid-19: a systematic review and meta-analysis. Rev Med Virol. 2020;30(6):1-9. doi:10.1002/rmv.2141

The Mechanism of Anti-Viral Activity of a Novel,Hydroponically Selenium-Enriched Garlic Powder (SelenoForce ® ) Against SARS-CoV-2 Virus

Abstract

Abstract

Objective

Methods

Results

Conclusion

Keywords

Introduction

Materials

Methodology

Cell Culture

Preparation of SeGP for in vitro Experiments

In vitro Anti-SARS-CoV-2 Activity

Cytotoxicity Assay

Anti SARS-CoV-2 Activity Assay

In vitro Assays in Human Lung Carcinoma A549 Cells and RAW 264.7 Cells

Cytotoxicity/Selection of Nontoxic Concentrations for Cell Assays

H2O2 Induced Reactive Oxygen Species Scavenging Activity

Furin Inhibition Assay

ACE-2 and TMPRSS2 Inhibition Assay

Anti-Inflammatory Assay

Statistical Analyses

Results

Selenium Compounds Present in SeGP

SeGP Showed Anti-SARS-CoV-2 Activity in vitro

Cytotoxicity/Viability Assay in Human Lung Carcinoma A549 and RAW 264.7 Macrophages

SeGP Showed Significant Inhbition of Furin Activity in Human Lung Carcinoma A549 Cells

SeGP Down Regulated the Expression of ACE2 and TMPRSS2 in Human Lung Carcinoma A549 Cells

SeGP Reduced Oxidative Stress in Human Lung Carcinoma A549 Cells

SeGP Showed Significant Anti-Inflammatory Activities in RAW 264.7 Macrophages

Discussion

Conclusions

Footnotes

Acknowledgments

Author Contributions

Declaration of Conflicting Interests

Funding

Patents

ORCID iD

Data Availability Statement

References

H₂O₂ Induced Reactive Oxygen Species Scavenging Activity