Sage Journals: Discover world-class research

Abstract

Background

Cervical cancer is the third most prevalent cancer globally, with high incidence and mortality rates. Current treatments often result in severe side effects and drug resistance. While Solanecio mannii (S. mannii) roots have been traditionally used in cancer treatment, there is a lack of scientific validation of their anticancer potential. Therefore, the present study sought to analyze the metabolomics profile of the extracts and evaluate its anticancer and pro-apoptotic potential.

Methods

S. mannii roots were collected, freeze-dried, and extracted using diethyl-ether: methanol (v:v) for total extraction, and hexane and ethyl acetate for fractionation. This study analyzed the metabolomic profiles of S. mannii root extracts using gas chromatography coupled to mass spectrometry and evaluated their selective cytotoxic effect on human cervical cancer cell lines, specifically Henrietta Lacks (HeLa) cell lines. Moreover, this study investigated the extracts’ potential to modulate autophagy and induce apoptosis. The pro-apoptotic effect of S. mannii was evaluated by analyzing chromatin morphological changes, the expression of Bcl-2 homologous antagonist/killer (BAK) and BCL2-Associated X (BAX) genes, and the activity of caspases.

Results

S. mannii exhibited selective anticancer and anti-proliferative activities against HeLa cells, with IC₅₀ values of 113 ± 0.28 µg/mL for the total extract, 38.94 ± 0.87 µg/mL for the hexane fraction, and 12.16 ± 0.52 µg/mL for the ethyl acetate fraction. Additionally, S. mannii root extracts modulated autophagosome formation and autophagy-related genes. Furthermore, extracts exhibited an intrinsic pro-apoptotic potential by upregulating BAK and BAX and increasing the activity of caspase-9, −3, and −7 in a time- and dose-dependent manner. These effects are attributed to the bioactive phytocompounds identified in the extracts, including syringic acid, 4-coumaric acid, caffeic acid, vanillin, hydroquinone, oleic acid, beta-sitosterol, and stearic acid, among others.

Conclusion

This study showed the selective anticancer and pro-apoptotic activity of S. mannii root for the management of cervical cancer.

Keywords

Cervical cancer cytotoxicity apoptosis

Introduction

Cervical cancer ranked as the third most common cancer (6.5%) and cancer-leading cause of death (7.7%) among women worldwide in 2020.¹ Singh et al (2023) highlight disparities along the geographic, socioeconomic, and temporal axes in cervical cancer incidence and mortality rates.² Within areas and between countries, there was a significant variation in the incidence and death rates, ranging from 40 to 50 times. Oceania, Asia, Latin America, and Sub-Saharan Africa had the highest within-region heterogeneity, with notably high rates of incidence and mortality.² While there has been a decline in the incidence of cervical cancer in many parts of the world over the past three decades, cervical cancer rates and burdens are still high globally, with 604,127 new cases and 341,831 fatalities recorded in 2020.³ Twenty percent of worldwide cases and twenty-two percent of worldwide deaths occurred in Africa. Age-adjusted rates of 40, 36, 31, 23, and 6.2 cases per 100,000 women were recorded in Eastern, Southern, Central, Western, and Northern Africa, respectively.²

Addressing the prevalence of cervical cancer goes beyond symptomatic management or singularly targeting specific signaling pathways and molecular mechanisms with targeted/immune therapy. Existing treatments for cervical cancer, including chemotherapy, targeted, and immunotherapy, result in severe side effects and the development of drug resistance in tumors, which is linked to genomic alterations, dysregulation of apoptosis and cellular homeostasis, efflux transporters, and autophagy.^4–6 Therefore, there is an urgent need for new and improved therapeutic options with enhanced efficiency, where phytopharmaceutical drug discovery could expedite and economize the development of pharmaceuticals, potentially modulating major signaling pathways and enhancing the quality of life of cancer patients.

A potential approach to expedite and economize the development of pharmaceuticals involves the application of phytopharmaceutical drug discovery.⁷ Research has demonstrated the anti-carcinogenic potential of several plant-based compounds,⁸ including paclitaxel, vinblastine, camptothecin, curcumin, and resveratrol,⁹ where major signaling pathways implicated in inducing apoptosis, suppressing cell proliferation, arresting the cell cycle, and inhibiting angiogenesis and invasiveness can be potentially modulated by single/multi-component phytopharmaceuticals.¹⁰ Compounds and single/multi-component plant extracts were reported to enhance the quality of life of cancer patients.¹¹

Even though only 15% of approximately 250,000 species of higher plants that are known to exist underwent phytochemical screening and roughly 6% underwent biological property evaluation, there is undoubtedly a resurgence of scientific interest in natural plant-based pharmaceutical discoveries.¹² The initial, and most crucial, stage in the process of discovering drugs from plants is choosing plant candidates for the extraction of active principles and biological activity screening.¹³ One of these approaches is to rely on ethnomedicine and ethnobotanical surveys. Solanecio mannii, a plant found in tropical and subtropical regions of Africa, has traditionally been utilized for its medicinal properties, as noted in ethnobotanical surveys.¹⁴ Local communities have employed various parts of the plant for treating ailments such as wound healing, pain relief, and infections. Notably, ethnobotanical data suggested its use in traditional cancer treatment, attributing its efficacy to a rich uncharacterized phytochemical profile.¹⁴ While ethnobotanical studies have shown promise regarding its anticancer effects, further rigorous research is essential to validate its efficacy and safety for modern medical applications. This study investigated the metabolomic profile of the roots at a high-throughput level, the attributed selective cytotoxic activity of the total extract and fractions against human cervical cancer cells (HeLa cell lines), and their potential to modulate autophagy and apoptosis, holding promise for developing novel anticancer therapies targeting cervical cancer.

Materials and Methods

Plant Collection, Identification, and Extraction

S. mannii root samples were collected from Kapseret, Kapsabet, Kenya (0°12′06.7″ N 35°05′58.3″ E). The plant samples were identified at the National Museum of Kenya. Dried and ground plant material was soaked in diethyl-ether/methanol (v/v) for total extraction. The resultant extract was filtered with Whatman filter paper number 1 and concentrated under a vacuum (55 °C). The total extract was subjected to sequential fractionation using organic solvents with increasing polarities. Using a separating funnel, the total extract was washed with 250 mL of n-hexane (20 min). The upper part (hexane phase) was collected, filtered, and concentrated at 69 °C, while the lower part was transferred for distilled water/ethyl acetate (v/v) partitioning (24 h). The ethyl acetate extract was recovered, filtered, and concentrated using a rotary evaporator (at 77 °C). Dried extracts were stored at −20 °C for further studies.

Gas Chromatography–Coupled Mass Spectrometry (GC-MS)-Based Metabolomic Profiling of S. mannii Root Extracts

Gas chromatography combined with mass spectrometry was used to analyze the metabolomics profile of the extracts. An Agilent Technologies 7890B gas chromatograph, equipped with a DB-5MS column (30 m × 0.25 mm internal diameter and 0.25 μm film thickness) and a 5977A mass spectrometer, was used for the GC-MS analysis. Hydrogen gas was used as the carrier gas, flowing at 1.0 mL/min, and the injection volume was 1 µL. The temperature was set at 60 °C for 1 min, rising to 320 °C (at 10 °C/min), and then held for 10 min. The injector and detector were held at 300 °C and 320 °C, respectively. Mass spectra were obtained by electron ionization at 70 eV using a spectral range of m/z 50–800 and a solvent delay of 6 min. The temperatures of the mass and quad were 230 °C and 150 °C, respectively. Identification of phytocompounds was achieved by comparing the spectrum fragmentation pattern with those stored in Wiley and NIST Mass Spectral Library data. All samples were subjected to derivatization before GC-MS analysis. In brief, dried samples were resuspended in 50 µL of bis(trimethylsilyl)trifluoroacetamide (BSTFA) supplemented with trimethylchlorosilane (TMCS) (99:1) silylation reagent and 50 µL of pyridine.

Extracts Preparation for In Vitro Studies

Briefly, 100 mg of dried extracts were dissolved in 1 mL of absolute Di-Methyl Sulf-Oxide (DMSO) to prepare a stock of 100,000 µg/mL. The stock solution was further diluted with complete growth media to a working solution of 200 µg/mL.

Cytotoxicity and Selectivity Analysis Using CCK8 Assay

In this study, kidney epithelial cells of African green monkey (Vero cells) and human cervical cancer cell line, specifically Henrietta Lacks (HeLa) cell lines were used. Both cell lines were cultured in 10% fetal bovine serum and 1% streptomycin/penicillin in Eagle's Minimum Essential Medium (EMEM). The growth media was supplemented with HEPES, sodium bicarbonate, and glutamine. The incubator environment was set at 37 °C, 5% CO₂, and 95% humidity. Cells were inoculated into a 96-well plate at a density of 1 × 10⁴ cells/well to attach overnight. Cells were treated with different extracts at a concentration of 200 µg/mL for 48 h (h) to select the active extracts. After the treatments, wells were washed with 100 µL of phosphate-buffered saline (PBS). Then, 90 µL of complete growth media and 10 µL of Cell Counting Kit 8 (CCK8, Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, no CA1210) solution were added to each well and incubated for 3 h. Absorbances were measured at 450 and 650 nm using a microplate reader.

Positive control groups were incubated under identical conditions with the same concentration of rapamycin (Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, no R8140), whereas the negative control group received only 0.2% DMSO-containing media. Corrected absorbances were used to calculate the cell viability.^15,16

C o r r e c t e d O D = (O D_{450} - O D_{650}) - O D_{b l a n k 450}

C e l l v i a b i l i t y (%) = \frac{C o r r e c t e d a b s o r b a n c e o f t r e a t e d s a m p l e s}{C o r r e c t e d a b s o r b a n c e o f u n t r e a t e d s a m p l e s}

G r o w t h i n h i b i t i o n (%) = 100 - C e l l v i a b i l i t y p e r c e n t a g e

Furthermore, cells were treated with different concentrations (300, 150, 75, 37.5, 18.75, 9.375, and 4.6875 µg/mL) for 48 h to determine the half-maximal inhibitory concentrations (IC₅₀) for cervical cancer cells (HeLa cell lines) and the half-maximal cytotoxicity concentrations (CC₅₀) for normal cells (Vero cell lines). Dose–response inhibition curves were plotted using Splin/LOWESS fit in GraphPad Prism. To determine the selectivity index (SI), the following formula was used¹⁷:

S I = \frac{C C 50}{I C 50}

Monodansylcadaverine (MDC) Staining

HeLa cells were seeded on membrane-treated slides, at a density of 2 × 10⁵ cells/well, in 24-well plates and allowed to attach overnight, after which they were treated at ¼ IC₅₀ and ½ IC₅₀ for 18 h and 24 h, respectively. After treatment, cells were washed with PBS, followed by the wash buffer. Cells were stained with Monodansylcadaverine stain (MDC, Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, no G0170) stain for 30 min (min), at room temperature, in the dark. Cells were washed with the wash buffer and observed under a fluorescent microscope.

4′,6-Diamidino-2-Phenylindole (DAPI) Staining

HeLa cells were seeded on membrane-treated slides, at a density of 2 × 10⁵ cells/well, in 24-well plates and allowed to attach overnight, after which they were treated at ¼ IC₅₀ and ½ IC₅₀ for 18 h and 24 h, respectively. After treatment, slides were washed with PBS, fixed with 3.7% paraformaldehyde, and permeabilized with Triton-X (Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, no T8200). Samples were stained with DAPI solution (Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, no C0065) for 15 min at room temperature (RT). Finally, cells were rinsed with PBS twice and examined using a fluorescence microscope.

Hoechst Staining

HeLa cells were seeded on membrane-treated slides, at a density of 2 × 10⁵ cells/well, in 24-well plates and allowed to attach overnight, after which they were treated at ¼ IC₅₀ and ½ IC₅₀ for 18 h and 24 h, respectively. After treatment, slides were washed with PBS and stained with Hoechst staining for 15 min (Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, no C0030). Finally, slides were rinsed twice with PBS and observed under a fluorescent microscope.

Caspase-3, −8, and −9 Colorimetric Activity

Caspase-3, −8, and −9 activities were determined using a colorimetric assay kit (Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, no BC3830, BC3880, BC3890). Briefly, cells were treated with S. mannii extract at ¼ and ½ IC₅₀ for 18 h and 24 h, respectively. Following treatment, cells were harvested and lysed for 15 min. Lysate was centrifuged at 10,000 × g for 10 min at 4 °C to collect the supernatant. Protein concentrations were determined using the Bradford assay (Beijing Solarbio Science and Technology Co., Ltd, Beijing, China, Bradford Protein Assay Kit, no PC0010), and equal amounts of protein (100 μg) were incubated with caspase-specific substrate (Asp-Glu-Val-Asp-p-nitroanilide for caspase-3, N-acetyl-Ile-Glu-Thr-Asp-p-nitroanilide for caspase-8, and acetyl-Leu-Glu-His-Asp-p-nitroanilide for caspase-9 (at 37 °C for 2 h). Absorbances were measured at 405 nm using a microplate reader. Caspase activity was calculated as the fold change relative to the untreated control.

Analysis of the Relative Expression of Target Genes

RNA extraction was carried out using Pure Link RNA mini kit (Thermo Scientific™, USA, no 12183020) according to the manufacturer's protocol. In brief, HeLa cells were seeded in T75 flasks and allowed to reach 80% confluence. After treatments, cells were washed twice with PBS and lysed using a lysing buffer (supplemented with 1% 2-mercaptoethanol) for 5 min. The lysate was transferred into RNase-free Eppendorf tube and homogenized. An equivalent volume of absolute cold ethanol (100%) was added and vortexed. Using a spin cartridge, RNA was bound to the cartridge membrane after centrifugation. A total of 700 µL of wash buffer I was added to the spin cartridge and centrifuged at 12,000 rpm at room temperature for 15 s. A total of 500 µL of wash buffer II was added and centrifuged again at 12,000 rpm at room temperature for 15 s. The cartridges were spin-dried before the elution of RNA.

Using the SensiFAST ™ cDNA Synthesis Kit (Bioline, London, UK, no BIO-65053), cDNA was generated according to the manufacturer's instructions in a reaction volume of 20 μL containing 4 μL of RNA sample, 4 μL of buffer, 1 μL of reverse transcriptase, and 11 μL of nuclease-free water. The thermal cycling conditions began with a primer annealing step at 25 °C for 10 min, followed by reverse transcription at 42 °C for 15 min. Afterward, the reaction was inactivated by heating to 85 °C for 5 min and held at 4 °C. cDNA samples’ concentrations were quantified with a Thermo Scientific™ NanoDrop™ 2000/2000c Spectrophotometers, standardized to 900 ng/μL, and then diluted with nuclease-free water (1:9).

Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with the SolisFAST^® SolisGreen^® qPCR Master Mix kit (Solis BioDyne, Estonia, no 28-41-00001) according to the manufacturer's protocol, using RT-PCR Quant Studio V system thermocycler (Thermo Scientific, USA), in a reaction volume of 10 μL (2 μL of the SolisFAST^® SolisGreen^® qPCR Mix (ROX, 5X), 0.3 μL of forward primer (10 μM), 0.3 μL of reverse primer (10 μM), 1 μL of cDNA template, and 6.4 μL of nuclease free water).

The thermal cycler was set as follows: Enzyme activation at 95 °C for 1 min, denaturation at 95 °C for 5 s, and the annealing/extension step was set at 57 °C for 20 s. Sequences of forward and reverse primers of target genes are shown in Table 1.

Table 1.

Forward and Reverse Primers’ Sequences of Target Genes.

Gene	Forward Primer (5′→3′)	Reverse Primer (5′→3′)
ATG13	TGTGGAAACCTGTGATCCAT	CTTGTCCAGGTCCTTTCTGT
Beclin 1	GGACAGTTTGGCACAATCAA	CCCAGAACAGTATAACGGCA
LC3	AGAAAGGATTTTGAGGAGGGG	TGAGACAGTGTCAGAACTACC
BAK	CAGGACACAGAGGAGGTTTT	TGCTAGGTTGCAGAGGTAAG
BAX	CTGAGCAGATCATGAAGACAG	TCCTCTGCAGCTCCATGTTA
β-tubulin	TTTCTTGCCCCATACATACC	CCTGTGGCTTCATTGTAGTA

Relative gene expression was quantified according to the 2^−ΔΔCt method. β-tubulin was used as a housekeeping gene.

Statistical Analysis

All tests were replicated in at least three independent experiments. Two-way ANOVA was used to compare the quantitative data between the groups using GraphPad prism v.10; p < 0.05 was considered statistically significant.

Results

GC-MS-Based Metabolomic Profiles of S. mannii Root Extracts

The untargeted profiling yielded the identification of 61 sary metabolites in the total extract (RTT), 36 non-polar compounds in the hexane extract (RTH), and 15 compounds in the ethyl acetate extract (RTEA). Figure 1 shows the total number of ion chromatograms in the GC-MS-based untargeted metabolite profiling of the studied extracts.

Figure 1.

GC-MS-based Total Ion Chromatograms of the Total (A), hexane (B), and ethyl acetate (C) extracts of S. mannii root. Numbers above the Peaks Represent the Retention Times.

The analysis of S. mannii root phytocompounds in a high-throughput approach identified 9,12-octadecadienoic acid majorly constituting the total extract with 18.68% (Table 2). Hydroquinone was the major compound in the ethyl acetate extract, with an area sum of 59.57% (Table 3), whereas palmitic acid constituted 53.04% of the hexane extract (Table 4). Glycerol monostearate, 1-monopalmitin, 4-coumaric acid, caffeic acid, stearic acid, and azelaic acid were commonly found in the three studied extracts.

Table 2.

GC-MS-Based High-Throughput Secondary Metabolite Profiling of the S. mannii Root Total Extract.

Extract	Peak	Retention Time	Name	Formula	Area Sum %
Total extract of S. mannii root	1	6.27	Heptanoic acid	C₁₀H₂₂O₂Si	0.62
	2	7.024	Dihydroxyacetone	C₉H₂₂O₃Si₂	0.15
	3	7.369	Benzoic acid	C₁₀H₁₄O₂Si	0.17
	4	7.486	3-Methyl-1-cyclohexanecarboxylic acid	C₁₁H₂₂O₂Si	0.03
	5	7.588	Octanoic acid	C₁₁H₂₄O₂Si	0.24
	6	7.691	Glycerol	C₁₂H₃₂O₃Si₃	7.15
	7	7.786	2-Butenedioic acid	C₁₀H₂₀O₄Si₂	0.15
	8	8.269	Butanedioic acid	C₁₀H₂₂O₄Si₂	0.43
	9	8.32	2-Octenoic acid	C₁₁H₂₂O₂Si	0.05
	10	8.438	Glyceric acid	C₁₂H₃₀O₄Si₃	0.02
	11	8.752	Silane	C₁₄H₃₂O₂Si	0.03
	12	8.884	heptanoic acid	C₁₃H₃₀O₃Si₂	0.19
	13	9.346	cyclobutanecarboxylic acid	C₈H₁₆O₂Si	0.03
	14	10.122	Decanoic acid	C₁₃H₂₈O₂Si	0.03
	15	10.29	3-Trimethylsiloxyoctanoic acid	C₁₄H₃₂O₃Si₂	0.14
	16	10.363	Eudesma-2,4,11-triene	C₁₅H₂₂	0.04
	17	10.48	Malic acid	C₁₃H₃₀O₅Si₃	0.29
	18	10.649	6-Pentadecanol	C₁₈H₄₀OSi	0.23
	19	10.729	Butylated Hydroxytoluene	C₁₅H₂₄O	0.39
	20	10.876	Pipecolic acid	C₁₂H₂₇NO₂Si₂	0.04
	21	11.125	Cycloheptanol	C₁₃H₂₈OSi	0.17
	22	11.484	6-Methylheptanoic acid	C₁₁H₂₄O₂Si	0.4
	23	11.82	(E)-4-Hydroxynon-2-enoic acid	C₁₅H₃₂O₃Si₂	0.6
	24	11.872	6-Dodecanol	C₁₅H₃₄OSi	1.08
	25	12.025	octanoate	C₁₄H₃₂O₃Si₂	0.06
	26	12.201	propargyl alcohol	C₉H₂₀OSi₂	0.1
	27	12.421	Dodecanoic acid	C₁₅H₃₂O₂Si	0.03
	28	12.699	2,6-Dimethoxyhydroquinone	C₁₄H₂₆O₄Si₂	0.14
	29	12.809	2,2-Dimethylcyclohexyl hydrogen methylphosphonate	C₁₅H₃₃O₃PSi	0.29
	30	12.941	Suberic acid	C₁₄H₃₀O₄Si₂	0.22
	31	13.094	Adonitol	C₂₀H₅₂O₅Si₅	0.15
	32	13.461	5-Methyluridine	C₁₉H₃₈N₂O₆Si₃	0.9
	33	13.57	2-(2,6-Dimethylphenoxy)acetohydrazide	C₁₆H₃₀N₂O₂Si₂	0.39
	34	13.651	Vanillic acid	C₁₄H₂₄O₄Si₂	0.12
	35	13.688	cis-11,14-Eicosadienoic acid	C₂₆H₅₀O₂Si	0.37
	36	13.922	4-Coumaric acid	C₁₅H₂₄O₃Si₂	0.1
	37	14.002	Azelaic acid	C₁₅H₃₂O₄Si₂	3.61
	38	14.083	.beta.-D-Fructofuranose	C₂₁H₅₂O₆Si₅	8.52
	39	14.354	2-(2,6-Dimethylphenoxy)acetohydrazide	C₁₆H₃₀N₂O₂Si₂	0.2
	40	14.434	.beta.-D-Tagatopyranose	C₂₁H₅₂O₆Si₅	2.35
	41	14.522	Isocitric acid lactone	C₁₈H₃₄O₆Si₂	0.42
	42	14.991	Sebacic acid	C₁₆H₃₄O₄Si₂	0.44
	43	15.071	.alpha.-D-Glucopyranose	C₁₇H₃₈O₆Si₃	1.2
	44	15.452	4-Coumaric acid	C₁₅H₂₄O₃Si₂	1.35
	45	15.525	Pentadecanoic acid	C₁₈H₃₈O₂Si	0.32
	46	15.73	.beta.-D-Tagatopyranose	C₂₁H₅₂O₆Si₅	0.08
	47	16.485	Palmitic acid	C₁₉H₄₀O₂Si	11.99
	48	17.29	Caffeic acid	C₁₈H₃₂O₄Si₃	0.57
	49	17.371	Heptadecanoic acid	C₂₀H₄₂O₂Si	0.27
	50	17.978	9,12-Octadecadienoic acid	C₂₁H₄₀O₂Si	18.68
	51	18.015	11-Octadecenoic acid	C₂₁H₄₂O₂Si	3.02
	52	18.066	Oleic acid	C₂₁H₄₂O₂Si	0.86
	53	18.242	Stearic acid	C₂₁H₄₄O₂Si	1.08
	54	19.487	(9E,11Z)-8-Hydroxyoctadeca-9,11-dienoic acid	C₂₄H₄₈O₃Si₂	0.6
	55	19.64	7-(3-Hydroxy-propyl)-bicyclo[2.2.1]heptan-2-one	C₁₆H₃₀O₂Si	2.77
	56	19.882	Arachidic acid	C₂₃H₄₈O₂Si	0.85
	57	20.417	Sucrose	C₃₆H₈₆O₁₁Si₈	1.74
	58	20.687	Rosiridin	C₃₁H₆₈O₇Si₅	1.85
	59	21.01	1-Monopalmitin	C₂₅H₅₄O₄Si₂	13
	60	21.302	(Z)-9,12,13-Trihydroxyoctadec-15-enoic acid	C₃₀H₆₆O₅Si₄	1.35
	61	22.415	Glycerol monostearate	C₂₇H₅₈O₄Si₂	7.35

Table 3.

GC-MS-Based High-Throughput Secondary Metabolites Profiling of S. mannii Root Hexane Extract.

Extract	Peak	Retention Time	Name	Formula	Area Sum %
Hexane extract of S. mannii root	1	6.27	Heptanoic acid	C₁₀H₂₂O₂Si	1.93
	2	7.024	2-Heptenoic acid	C₁₀H₂₀O₂Si	0.35
	3	7.193	2-Ethylhexanol	C₁₁H₂₆OSi	0.09
	4	7.369	Benzoic acid	C₁₀H₁₄O₂Si	0.23
	5	7.493	3-Methyl-1-cyclohexanecarboxylic acid	C₁₁H₂₂O₂Si	0.15
	6	7.596	Octanoic acid	C₁₁H₂₄O₂Si	0.66
	7	7.661	Silanol	C₉H₂₇O₄PSi₃	0.23
	8	8.328	2-Octenoic acid	C₁₄H₂₈O₂Si	0.24
	9	8.884	Nonanoic acid	C₁₂H₂₆O₂Si	0.38
	10	10.122	Decanoic acid	C₁₃H₂₈O₂Si	0.12
	11	10.715	2-Octanol	C₁₄H₃₂OSi	0.07
	12	10.942	p-Anisic acid	C₁₁H₁₆O₃Si	0.02
	13	11.125	2-Methylcyclohexanol	C₁₃H₂₈OSi	0.14
	14	11.484	6-Methylheptanoic acid	C₁₁H₂₄O₂Si	0.63
	15	11.872	6-Dodecanol	C₁₅H₃₄OSi	1.36
	16	12.025	octanoate	C₁₄H₃₂O₃Si₂	0.06
	17	12.428	Dodecanoic acid	C₁₅H₃₂O₂Si	0.06
	18	12.941	Suberic acid	C₁₄H₃₀O₄Si₂	0.31
	19	13.57	2(1H)Naphthalenone	C₁₅H₂₂O	0.4
	20	13.914	Terephthalic acid	C₁₄H₂₂O₄Si₂	0.06
	21	14.002	Azelaic acid	C₁₅H₃₂O₄Si₂	1.18
	22	14.537	Myristic acid	C₁₇H₃₆O₂Si	0.41
	23	15.525	Pentadecanoic acid	C₁₈H₃₈O₂Si	1.15
	24	15.672	Didodecyl phthalate	C₃₂H₅₄O₄	0.18
	25	16.499	Palmitic acid	C₁₉H₄₀O₂Si	53.04
	26	17.37	Heptadecanoic acid	C₂₀H₄₂O₂Si	1.13
	27	17.949	9,12-Octadecadienoic acid	C₂₁H₄₀O₂Si	0.4
	28	18	Oleic acid	C₂₁H₄₂O₂Si	1.26
	29	18.242	Stearic acid	C₂₁H₄₄O₂Si	4.7
	30	19.479	(9E,11Z)-8-Hydroxyoctadeca-9,11-dienoic acid	C₂₄H₄₈O₃Si₂	1.72
	31	19.882	Arachidic acid	C₂₃H₄₈O₂Si	2.45
	32	20.746	2-Palmitoylglycerol	C₂₅H₅₄O₄Si₂	1
	33	21.002	1-Monopalmitin	C₂₅H₅₄O₄Si₂	12.08
	34	21.398	Behenic acid	C₂₅H₅₂O₂Si	0.81
	35	22.408	Glycerol monostearate	C₂₇H₅₈O₄Si₂	6.04
	36	26.011	beta.-Sitosterol	C₃₂H₅₈OSi	4.96

Table 4.

GC-MS-Based High-Throughput Secondary Metabolites Profiling of S. mannii Root Ethyl Acetate Extract.

Extract	Peak	Retention Time	Name	Formula	Area Sum %
Ethyl acetate extract of S. mannii root	1	8.042	Hydroquinone	C₁₂H₂₂O₂Si₂	59.57
	2	9.205	Vanillin	C₁₄H₂₂O₃Si	0.77
	3	9.668	(E)-4-Hydroxynon-2-enoic acid	C₁₅H₃₂O₃Si₂	5.03
	4	10.472	Syringaldehyde	C₁₂H₁₈O₄Si	0.62
	5	11.134	Azelaic acid	C₁₅H₃₂O₄Si₂	3.77
	6	11.276	5,16-Pregnadien-3β-ol-20-one	C₂₁H₃₀O₂	2.43
	7	11.824	Syringic acid	C₁₅H₂₆O₅Si₂	0.67
	8	12.098	4-Coumaric acid	C₁₅H₂₄O₃Si₂	3.78
	9	12.779	Icariside II	C₂₇H₃₀O₁₀	2.36
	10	13.328	Caffeic acid	C₁₈H₃₂O₄Si₃	3.96
	11	13.961	Spironolactone	C₂₄H₃₂O₄S	0.77
	12	15.805	1-Monopalmitin	C₂₅H₅₄O₄Si₂	6.37
	13	16.003	(Z)-9,12,13-Trihydroxyoctadec-15-enoic acid	C₃₀H₆₆O₅Si₄	5.65
	14	16.75	Glycerol monostearate	C₂₇H₅₈O₄Si₂	3.1
	15	24.977	Microcystin RR	C₄₉H₇₅N₁₃O₁₂	1.16

S. mannii Root Extracts Selectively Inhibited the Viability of HeLa Cells

Our study investigated the effect of S. mannii extracts on the viability of HeLa cells. Treatment with the extracts, over a period of 48 h, resulted in a significant inhibition of cell growth and a notable reduction in cell viability. These findings suggest that the total, hexane, and ethyl acetate extracts of S. mannii root possess cytotoxic properties against HeLa cells. To investigate the inhibitory concentrations of the active extracts, we performed a dose–response analysis. Our findings showed that the cell inhibition percentage increased in a concentration-dependent manner, with higher concentrations of the extract correlating with greater inhibition of HeLa cell viability (Figure 2). Specifically, the ethyl acetate extract showed the lowest IC₅₀ of 12.16 ± 0.52 μg/mL, followed by the hexane and total extracts with IC₅₀ values of 38.94 ± 0.87 μg/mL and 113 ± 0.28 μg/mL, respectively. Rapamycin, the positive control, exhibited an IC₅₀ of 59.15 ± 2.44 μg/mL.

Our findings demonstrate selective activity of S. mannii root extracts against a human cervical cancer cell line. Table 5 shows the IC₅₀ and CC₅₀ depicted against HeLa cells and Vero cells, respectively, and the selectivity indexes of the extracts.

Figure 2.

Effect of S. mannii Root Extracts on HeLa Cells.

Table 5.

Selectivity of S. mannii Root Extracts.

Extract	IC₅₀ (μg/mL)HeLa Cells	CC₅₀ (μg/mL)Vero Cells	Selectivity Index
Total extract	113 ± 0.28	165.9 ± 0.91	1.47
Hexane extract	38.94 ± 0.87	42.80 ± 3.99	1.09
Ethyl acetate extract	12.16 ± 0.52	14.30 ± 0.81	1.18

All data are presented as mean ± SD.

S. mannii Root Extracts Differentially Regulated Autophagy in HeLa Cells

This study investigated the potential of root extracts in autophagy induction in HeLa cells in a dose- and time-dependent manner using monodansylcadaverine (MDC) staining as a marker for autophagic vacuoles. RTH significantly modulated autophagy in HeLa cells. At ¼ IC₅₀ for 18 h, RTH reduced autophagy, while at ½ IC₅₀ for 24 h, it significantly enhanced autophagy compared to the untreated group. Treatment with RTEA at ¼ IC₅₀ for 18 h decreased autophagic vacuole staining, but at ½ IC₅₀ for 24 h, the staining returned to levels comparable to the untreated group. In contrast, RTT of S. mannii root did not alter autophagic vacuole staining at either dosage. Rapamycin caused no changes at lower dosages but significantly reduced MDC intensity at ½ IC₅₀ for 24 h (Figure 3A, B).

Figure 3.

Effect of S. mannii Root Extracts on Autophagic Vacuoles and the Expression of Autophagy-related Key Proteins. (A). The Average Intensity of MDC Staining. (B). The MDC Staining of Autophagic Vacuoles Under Fluorescent Microscopy, 40×. (C–E). The Relative Ex-pression of Autophagy-related Key Proteins.

Transcriptomics analysis revealed decreased ATG13 expression across all treatments at ¼ IC₅₀ for 18 h. At ½ IC₅₀ for 24 h, RTH and RTT significantly increased ATG13 expression, while RTEA restored it to levels comparable to the untreated group. Rapamycin reduced ATG13 expression at both dosages (Figure 3C). Beclin 1 expression also decreased at ¼ IC₅₀ for 18 h in all treatments. At ½ IC₅₀ for 24 h, RTH and rapamycin restored Beclin 1 to untreated levels, while RTT and RTEA showed increases that remained significantly lower than untreated levels (Figure 3D). in addition, LC3 expression was similarly reduced by RTT, RTEA, and rapamycin at ¼ IC₅₀ for 18 h, with significant increases at ½ IC₅₀ for 24 h compared to untreated cells. Notably, RTH increased LC3 expression even at ¼ IC₅₀ for 18 h, in a dose- and time-dependent manner (Figure 3E).

S. mannii Root Extracts Induced Intrinsic Apoptosis in Dose- and Time-Dependent Manner

This study investigated the impact of extracts on apoptosis induction in HeLa cells using DAPI and Hoechst staining. Irregular shape, reduced circularity (nuclear shape index), the condensation of the chromatin into sharply delineated masses, the shrinkage/swell of the nucleus, fragmentation, and the presence of lobules/herniation/invagination and ring-like structures were depicted upon treatment (Figure 4).

Figure 4.

Effects of S. mannii Root Extracts on Nuclear Morphological Characteristics of Hela Cells Using DAPI and Hoechst Staining, 40×.

Additionally, treatment with S. mannii root extracts revealed the upregulation of BAK and BAX in a time- and dose-dependent manner (Figure 5). Notably, the expression level of BAX and BAK was significantly elevated the most when treated with RTT at ½ IC₅₀ for 24 h. Treatment with the hexane extract significantly increased the expression of BAK and BAX compared to the untreated group, but not change in a dose-dependent manner. Additionally, treatment with RTEA increased the expression of BAK and BAX in a dose-dependent manner.

Figure 5.

Effects of S. mannii Root Extracts on the Expression Level of BAK and BAX. All Data are Presented as Mean ± SD.

Moreover, we analyzed the fold-increase activity of caspase-8, −9 and −3. S. mannii root extracts induced a dose-dependent increase in caspase-9 activity by 2.032 ± 0.144 and 3.223 ± 0.371 folds when treated with RTT at ¼ IC₅₀ for 18 h, and ½ IC₅₀ for 24 h, respectively. Additionally, RTH increased the activity of caspase-9 by 2.029 ± 0.093 and 2.5 ± 0.233 folds when treated at ¼ IC₅₀ for 18 h, and ½ IC₅₀ for 24 h, respectively. An increase in the caspase activity was shown upon treatment with RTEA in a dose- and time-dependent manner by 2.936 ± 0.233 and 4.132 ± 0.551 folds, compared to the untreated control (Figure 6). The significant increase in caspase-8 activity was only detected in rapamycin-treated group in a dose- and time-dependent manner. Additionally, there was a significant increase in caspase 3 activity upon treatments, most notably at higher dosages.

Figure 6.

Effects of S. mannii Root Extracts in the Activity of Caspase-3, Caspase −8 and Caspase 9. All Data are Presented as Mean ± SD.

Discussion

Cervical cancer is a major global public health issue, particularly in low- and middle-income countries, where reductions in prevalence and mortality have been sluggish despite prevention strategies such as vaccination against human papillomavirus (HPV) and screening.³ Cervical cancer is currently managed primarily through surgical resection, chemotherapy, immunotherapy, local targeted therapy, and radiotherapy. While conventional treatments demonstrate effectiveness in managing cervical cancer in its early stages, their effectiveness diminishes when applied to locally staged and metastatic forms due to the presence of severe adverse effects, drug resistance, multiple recurrences, and metastasis.¹⁸ As a result, the development of drugs with improved safety profiles and enhanced efficacy for the treatment of cervical cancer is imperative. Rich in bioactive chemicals that have molded contemporary medicine, medicinal plants are priceless tools for the search and development of new medications. Additionally, the development of herbal medicine depends on the techniques of analysing and extracting plant materials, which help to refine and standardize herbal compositions thereby guaranteeing their safety, effectiveness, and quality.

Phytotherapy, a combination of ethnobotanical knowledge and modern drug discovery techniques, has shown promise in treating cancer. Traditional plant medicinal properties have led to the identification of bioactive compounds with anticancer properties, including paclitaxel, vinblastine, camptothecin, curcumin, and resveratrol.⁹ This paradigm shift has led to the exploration of herbal-based extracts and formulations, which can modulate multiple targets and pathways simultaneously. This approach enhances treatment efficacy, overcomes drug resistance, and mitigates cancer cell heterogeneity.^19,20 Ethnobotanical studies have demonstrated that the roots of S. mannii exhibit therapeutic properties.¹⁴ Traditionally, it has been utilized to treat wounds, infections, and cancer, crediting its effectiveness to its abundant phytochemical content. Despite its ethnobotanical significance, S. mannii has not been extensively investigated for its anticancer properties, particularly in the context of cervical cancer. Additionally, there exists a substantial deficiency of evidence concerning its metabolomics profile. In this study, we have demonstrated the selective cytotoxic potential of S. mannii against HeLa cells, and its potential in regulating autophagy and inducing apoptosis.

Our pioneering study demonstrates, for the first time, the selective cytotoxic activity of S. mannii on cancerous cells, in accordance with previous ethnobotanical surveys. Selectivity index (SI) values >1 indicate desirable selectivity against cancerous cells.²¹ In the present study, the ethyl acetate fraction exhibited the most potent anticancer activity, having the lowest IC₅₀, followed by the hexane fraction (P < 0.0001), with SI of 1.18 and 1.09, respectively. The solvent used in the plant extraction and partitioning of the total extract can influence the extraction efficiency and the yielded extracts’ components. This might, therefore, affect the extract's biological properties, particularly its cytotoxic potential. The cytotoxic activity of RTEA against HeLa cells with an IC₅₀ of 12.16 ± 0.52 μg/mL demonstrated a comparable effect to that of paclitaxel, a widely used chemotherapeutic agent for cervical cancer treatment, typically reported in the range of 5–10 nM.²² This similarity in potency suggested that the ethyl acetate extract of S. mannii has comparable efficacy in inhibiting the proliferation of HeLa cells, highlighting its potential as a therapeutic agent for cervical cancer.

The cytotoxic activities are not only attributed to the solvent but also to the complexity and diversity of the bioactive components of plant extracts. According to the concept of “like dissolves like” solubility, polar compounds can only dissolve in polar solvents, while semipolar and non-polar compounds can only dissolve in semipolar and non-polar solvents.^23,24

In our study, the total extract exhibited a significantly higher IC₅₀ compared to RTH, RTEA, and rapamycin (P < 0.0001). In regards to the guidelines of the National Cancer Institute, RTT exhibited a weakly cytotoxic effect (IC₅₀> 50 μg/mL).²⁵ Despite this classification, the total extract exhibited the most selective effect against HeLa cells (SI = 1.47). Lower IC₅₀ indicates a higher potency and effectiveness, which was depicted in the ethyl acetate and hexane extracts of S. mannii root extracts. Human cervical cancer cell lines (HeLa cells) are sensitive to S. mannii extracts and could be a potential anticancer candidate for the management of cervical cancer, without drug resistance, compared to common treatment approaches used in the management of cervical cancer.

The phytochemical profiles of the three extracts revealed distinct chemical compositions that correlate with the polarity of the extraction solvents. The metabolomics profile of the RTT extract highlighted a broad range of compounds, including fatty acids (palmitic acid, oleic acid, and stearic acid), organic acids (azelaic acid and sebacic acid), sugars (β-D-fructofuranose and β-D-tagatopyranose), and glycerides (glycerol monostearate), reflecting both polar and nonpolar compounds. In comparison, the RTH extract exhibited a marked enrichment of nonpolar constituents, predominated by lipophilic compounds, including palmitic acid, monopalmitin, and beta-sitosterol, aligning with hexane's low polarity. Additionally, the RTH extract showed a significant relative abundance of arachidic acid and stearic acid, both long-chain fatty acids are hydrophobic metabolites. On the other hand, the RTEA extract showed a distinct profile dominated by hydroquinone, caffeic acid, and syringic acid. Therefore, the ethyl acetate extracted was enriched with moderately polar compounds, including phenols and certain acids, including azelaic acid and 4-coumaric acid. This underscores the solvent's role in constituent segregation and fractionation. The demonstrated anticancer activity of S. mannii is attributed to the identified phytocompounds. The GC-MS analysis of S. mannii extracts reveals a rich profile of bioactive compounds.

Caffeic acid is well-documented for its pro-apoptotic and anti-proliferative properties, particularly in colon, breast, and lung cancer models.²⁶ Caffeic acid promoted apoptotic morphological changes, increased ROS levels, and altered matrix metalloproteinases in ME-180, HT-1080, and HeLa cell lines.^26,27 In breast cancer, caffeic acid inhibited the proliferation of MCF-7 cell lines.²⁸ Additionally, in colon cancer, caffeic acid demonstrated an anti-tumor property by activating AMPK signaling pathway.²⁹ Caffeic acid triggered cell death by blocking Bcl-2 activity, which released and activated caspase-3 in B cell lymphoma, squamous cell carcinoma, and cervical cancer.^26,30–32 Caffeic acid reduced cell viability in human colorectal adenocarcinoma HT-29 cell lines, regulated cell cycle, inhibited their clonogenic potential, and upregulated caspase expression.^29,33,34 According to Li et al (2015), caffeic acid reduced the viability of cancer stem cells by inhibiting TGFβ-SMAD2 signaling.³⁵ According to research conducted by Kabała-Dzik et al (2017) and Kleczka et al (2020), caffeic acid reduced the migration of MCF-7 and induced apoptosis and cell cycle arrest in MDA-MB-231 cells.^36,37

Similarly, 4-coumaric acid showed mitochondrial-mediated apoptosis in colorectal cancer cell lines by inhibiting Bcl-2 and Bcl-xL, Bcl-2 protein family members, and activating BAK and BAX.^38–41 Sharma et al revealed that coumaric acid has induced mitochondrial membrane depolarization, promoted cytochrome-c release, and promoted caspase-dependent intrinsic apoptosis in human colon cancer cell lines (HT-29 and SW480).³⁹ Hu et al (2020) demonstrated the potential of coumaric acid to inhibit melanoma cell proliferation and to induce cell cycle arrest in the G0/G1 phase by downregulating Cyclin E and CDK2. In addition, coumaric acid induced intrinsic apoptosis in A375 and B16 cells by upregulating Apaf1, and Bax, and increasing the activity of caspase-3 and caspase-9.⁴²

Azelaic acid exhibits cytolytic and cytotoxic effects on acute myeloid leukemia cell lines and inhibits their viability. According to Dongdong et al (2019), azelaic acid promoted NK and T cell proliferation and activation, and the secretion of cytolysis-related cytokines in vitro.⁴³ Additionally, azelaic acid reduced oxidative stress and intracellular ROS Levels and increased the total antioxidant capacity in acute myeloid leukemia by increasing SOD and GSH levels. It induced cell cycle arrest in G0/G1 and apoptosis.⁴⁴

Linoleic acid, for instance, has demonstrated anticancer properties against endometrial cancer cell lines (HEC-1A and KLE) and in transgenic mice with endometrial cancer. Linoleic acid was shown to induce cell cycle arrest in G1 and to promote apoptosis via a dose-dependent increase in the activity of caspase3, −8, and −9.⁴⁵ Additionally, linoleic acid altered cancer cells' energy metabolism, induced cell quiescence, and decreased colorectal cancer growth in mice injected with CT26 cell line.⁴⁶

Other pharmacologically active phytocompounds included beta-sitosterol, stearic acid, hydroquinone, syringic acid, and vanillin. Mounting evidence demonstrated the anti-cancer and pro-apoptotic activities of these molecules in several cancer types, including human non-small cell lung cancer (NCI-H460 and NSCLC cell lines), breast cancer (MCF-7 and MDA-MB-231 cell lines), and cervical cancer (Caski, HeLa, and SiHa cell lines).^47–51

Umereweneza et al (2023) showed the presence of umutagarananol, umutagarinine A and B, umutagarinine B, senaetnine, 2-angeloyloxy-5,8-dihydroxypresilphiperfolane, caffeic acid, methyl caffeate, and lupeol in the CH2Cl2-MeOH (1:1) extracts of root and stem bark of S. mannii.⁵² These compounds showed anticancer activities of 378.2, 35.6, 21.7, 12.5, 486.2, > 1110.1, 844.1, and 164.9, respectively, against MCF7 breast cancer cell lines. Notably, umutagarananol and umutagarinine A and B demonstrate potent cytotoxic effects. These effects may be achieved by activating caspase pathways and modulating pro- and anti-apoptotic proteins, which potentially induce apoptosis. Additionally, caffeic acid and methyl caffeate, which are known for their antioxidant properties, contribute to the anticancer effect by inducing oxidative stress and subsequent DNA damage in cancer cells, thereby promoting apoptosis.^53,54 Similarly, lupeol, a triterpenoid, is recognized for its ability to impede the proliferation of cancer cells by inhibiting NF-κB signaling.^55–58 These compounds enhance apoptotic pathway signaling and reduce cancer cell survival.⁵⁹ Similarly, Ndom et al (2007) identified styrylpirones in the aerial parts of S. mannii, including 4-methoxy-6-(11-O-ß-D-glucopyranosylstyryl)-αpyrone, 4-methoxy-6-(11-hydroxystyryl)-α-pyrone, 4-methoxy-6-(11-O-α-L- rhamnopyranosylstyryl)-αpyrone, L-rhamnopyranose, and α-amyrin.⁶⁰ The alkaloid extract of Solanecio mannii contained 7-O-senecioylplatynecine and 7-O-tigloylplatynecine (81.9% and 17.1% of the total alkaloid content).⁶¹ Furthermore, Dou et al (2017) have studied the antitumoral effects of crude polysaccharides, extracted from Solanecio scandens (S. scancdens) (dried whole plant, using ethanol), against human lung cancer, leukemia, sarcoma, and hepatocellular carcinoma cell lines (A549, HL60, S180, and H22, respectively). S. scandens crude polysaccharides showed anti-proliferative activity, mostly against H22 cell lines, with an IC₅₀ of 42.4 μg/mL, followed by S180 (60.3 μg/mL), A549 (102.8 μg/mL), and HL60 (117.9 μg/mL).⁶²

Altogether, our findings offer a new perspective for research on the pharmacological activities of S. mannii, mainly with regard to its anticancer activity.

Autophagy is a physiological intracellular degradation/catabolic pathway mediated by autophagosomes that deliver degraded damaged proteins and cytoplasmic components to the lysosome to be recycled for further cellular metabolism.⁶³ In this study, we employed sub-inhibitory concentrations to ensure the most selective anticancer activity and modulation of cellular processes while minimizing non-specific cytotoxic effects. Our findings demonstrated the potential of S. mannii root extracts to regulate autophagy in HeLa cells. At a lower dosage, S. mannii regulates the autophagy process on the nucleation and the maturation level, demonstrated by the reduced average intensity of autophagosomes, via the downregulation of ATG13, Beclin 1, and LC3. Kumari et al (2023) demonstrated that the inhibition of autophagy in HeLa cells by lichen extract induced ROS generation, membrane depolarization, and lipid peroxidation, thereby promoting cell cycle arrest and apoptosis.⁶⁴

At higher dosages (½ IC₅₀ for 24 h), an increase in the MDC staining was depicted in HeLa cells, together with an increase in the expression of ATG13 and LC3, demonstrating an increase in the number of autophagic vacuoles. Nevertheless, the relative expression of Beclin 1 is persistently significantly reduced, demonstrating a stronger regulatory effect of the extracts on the fusion step of autophagosomes with lysosomes, where HeLa cells are unable to overcome the suppression of autophagosome fusion with lysosomes (incomplete/defective autophagy). In this context, targeting the fusion step between autophagosomes and lysosomes represents an anticancer strategy of S. mannii root, where the degradation of autophagic cargo within lysosomes is hindered, leading to the accumulation of damaged organelles and toxic proteins within the cell. This buildup can trigger apoptotic pathways or induce cellular senescence, ultimately inhibiting cancer cell proliferation and promoting their demise. Chloroquine was found to inhibit autophagy by decreasing autophagosome-lysosome fusion and autophagosome degradation rate, thereby blocking autophagic flux and enhancing the pro-apoptotic effect of treatments.⁶⁵ Oblongifolin C, extracted from Garcinia yunnanensis Hu was found to induce apoptosis in human cholangiocarcinoma cells (QBC939) via inhibiting the autophagic flux and mitochondrial dysfunction.⁶⁶

According to McKnight et al (2014), Beclin 1 is essential for the trafficking of vacuoles and their fusion with endosomes/lysosomes, where it plays a major role in the localization of PI(3)P.⁶⁷ Thoresen et al (2010) demonstrated that depletion of one of PI3K-III subunits (VPS15, VPS34, Beclin 1, UVRAG or BIF-1) in HeLa cells im-paired the degradation of epidermal growth factor receptor (EGFR).⁶⁸ In addition, defective PI3K-III complexes (including the loss of Beclin 1) impaired degradative endocytic receptor trafficking. In the same study, the depletion of Beclin 1 or any member of the PIK-III (but not ATG14L) increased the number of midbodies, resulting in impaired cytokinesis in HeLa cells and, therefore, human cervical cancer cell proliferation.⁶⁸ Further, Beclin 1 has been demonstrated to be critical for maintaining the proliferation and the tumorigenicity of breast cancer stem cells.⁶⁹ MCF-7 mammospheres reduced in size when Beclin 1 was downregulated. McKnight et al (2014) reported an endosome maturation defect-based impaired autophagy when Beclin 1 was depleted due to the loss of Rab5 GTPase and the UVRAG-VPS34 complex and associated activity.⁶⁷ Overall, when Beclin 1, the stability of members of the autophagy and late endosomal trafficking and fusion is compromised. This supports, in turn, our hypothesis, as when HeLa cells were treated with higher dosage of total and ethyl acetate S. mannii root extracts, we found an increased autophagosome generation (high MDC stain, high expression of LC3 and ATG13) in response to the defective late stage of autophagy due to decreased expression of Beclin 1; however, due to financial constraints, the autophagic defect in a post-autophagosomes production context was not validated in this study.

The enhanced autophagosome formation was depicted upon treatment with RTH at ½ IC₅₀ for 24 h, with high intensity of MDC staining, upregulated LC3 and ATG13, and no significant change in the Beclin 1 expression level, compared to the untreated group. Autophagy has been described as a tumor suppressor mechanism in other contexts. The loss of autophagy through Beclin 1 and ATG 5 loss increased DNA damage and genomic instability (gene amplification, centrosome abnormalities, and aneuploidy), promoting tumorigenesis and apoptosis deficiency in immortalized and transformed primary epithelial cells.⁷⁰ Autophagy inhibits cell malignancy by preventing gene and chromosome mutations and reducing reactive oxygen species production, primarily by clearing dysfunctional mitochondria and cheesy proteins during redox reactions.⁷¹ In cervical cancer, the increase in autophagy promoted apoptosis in c-ray-irradiated HeLa and CaSki.⁷² The differential regulation of autophagy is likely attributed to the identified phytocompounds. Palmitic identified in the hexane extracts, is known to promote apoptosis by inducing excessive autophagy.⁷³ Tu et al (2014) demonstrated that palmitic acid promoted autophagy via JNK2 activation.⁷⁴ Conversely, in a study conducted by Hernández-Cáceres et al (2020), palmitic acid was found to regulate the autophagic flux by impairing autophagosome-lysosome fusion and endolysosome trafficking.⁷⁵ Previous research has demonstrated the anticancer activity of beta-sitosterol by activating autophagy in hepatocellular carcinoma and gastric cancer.⁷⁶ Further research should be conducted to further investigate the effect of RTH on autophagy. Our findings highlighted a stable ATG13 expression level and MDC staining when treated with a lower dosage of rapamycin, compared to the untreated group. Previous studies have shown that HeLa cells exhibit reduced sensitivity to rapamycin at suboptimal concentrations, due to compensatory signaling mechanisms, involving mTORC2 activity, and/or alterations in upstream regulators.⁷⁷

Our findings show how ATG13, Beclin 1, and LC3 affect autophagic processes at various dosages of S. mannii root extracts; the control of autophagy is closely linked to the expression of key autophagy-related genes. Lower dosages (¼ IC₅₀ for 18 h) suggest decreased autophagic vacuole generation since the downregulation of ATG13, Beclin 1, and LC3 corresponds with a reduction in the intensity of MDC staining. Particularly, ATG13 is a vital component of the autophagy initiation complex and its downregulation indicates early-stage autophagy suppression. Analogous to this, the reduction in Beclin 1 expression points to reduced autophagosome generation and trafficking, which is crucial for the maturation and nucleation phases of autophagy. Since LC3 is involved in autophagosome membrane elongation, the decreased expression of LC3 supports even more a lower autophagic flow. This joint downregulation in gene expression helps to limit the cells’ capacity to remove damaged organelles and proteins, therefore triggering either death or other stress-related processes, or incomplete or inhibited autophagy. Increased MDC staining at higher dosages (½ IC₅₀ for 24 h) together with ATG13 and LC3 overexpression hint to improved autophagosome generation. However, the ongoing downregulation of Beclin 1 points to a deficit in the fusion of autophagosomes with lysosomes even as autophagy is triggered and autophagosomes are generated. This flaw in the fusion step causes an accumulation of autophagosomes, a characteristic of faulty autophagy, where autophagic cargo is not efficiently broken down inside the lysosome. Under these conditions, the increased expression of ATG13 and LC3 suggests that, despite the activation of the autophagic process, cargo breakdown and poor fusion keep it incomplete. This disturbance of late-stage autophagy might gather broken proteins and organelles inside the cell, therefore causing cellular damage. Furthermore, the expression of LC3 indicates maturity as well as the generation of autophagosomes. The higher expression of LC3 at higher dosages corresponds with our finding of more autophagic vacuoles, therefore supporting the hypothesis that S. mannii extracts can induce autophagosome synthesis with compromised fusing phase, pointing to a continuous deficiency in autophagosome-lysosome fusion.

Moreover, S. mannii extract showed a pro-apoptotic potential. Based on the morphological changes depicted with DAPI and Hoechst staining, S. mannii root extracts appear to induce late apoptosis, characterized by extensive nuclear alterations. These changes are indicative of advanced stages of cell death, where the cell is committed to the apoptotic process and irreversibly destined for death/destruction.⁷⁸ The observed increase in apoptotic cells suggests that S. mannii roots possess pro-apoptotic properties, prompting the activation of programed cell death pathways in HeLa cells. This study outlined evidence of the pro-apoptotic potential of S. mannii root, specifically the mitochondrial intrinsic pathway. The mitochondrial intrinsic apoptotic pathway is a tightly regulated process, initiated by internal cellular stress signals, including DNA damage, oxidative stress, or cytokine deprivation. Key players in this pathway are the pro-apoptotic proteins BAK (Bcl-2 homologous antagonist/killer) and BAX (Bcl-2-associated X protein), which belong to the Bcl-2 family. Upon activation, BAK and BAX oligomerize and form pores in the mitochondrial membrane, disrupting its integrity, which leads to the release of cytochrome C from the mitochondria into the cytosol. Cytochrome C binds to apoptotic protease activating factor-1 (Apaf-1), forming the apoptosome, which recruits and activates procaspase-9. Active caspase-9 subsequently triggers a caspase cascade, activating executioner caspases-3 and −7.⁷⁹

In the present study, S. mannii increased the activity of caspase-9, a hallmark of the intrinsic apoptotic pathway, together with an increase in effector caspases (3 and 7). In accordance with Ulloth et al (2003), palmitic and stearic acids induced caspase-dependent apoptosis in PC12 cell lines. These fatty acids induced apoptosis-related morphological changes of the chromatin, including cell shrinkage, membrane blebbing, condensation, and fragmentation.⁸⁰ Additionally, beta-sitosterol was found to induce mitochondrial-mediated apoptosis via ROS generation and loss of mitochondrial membrane potential, together with an increase in caspase-9, −3, and −7.^81–83 Furthermore, Numerous studies have demonstrated the potential of oleic acid to inhibit cell proliferation in different tumor cell lines by increasing intracellular ROS levels and caspase-3 activity.^84–88 According to Cortez et al (2024) and Nasiri et al (2018), caffeic acid upregulated the expression of BAK and BAX and induced mitochondrial-mediated apoptosis.^89,90 Rapamycin, the positive control, increased the activity of both caspase-8 and −9, demonstrating its potential to induce both intrinsic and extrinsic apoptotic pathways. Our findings are in accordance with previous studies.^91,92 Notably, this study speculated the lack of dose dependency in the pro-apoptotic potential of RTT and RTH. This may be due to complex regulatory mechanisms underlying BAK expression or the presence of bioactive compounds in the extract with opposing effects at different concentrations. Further investigations are required to elucidate the potential interactions with other apoptotic regulators. Our findings align with previous studies on related species within the Solanecio genus. The antitumor effect of Solanecio scandens against hepatocellular carcinoma was pronounced through the regulation of the expression level of Bcl-2 (down) and the upregulation of Bax, caspase-3, and caspase-9, depicting a mitochondria-mediated apoptosis pathway, in vivo.⁶²

To the best of our knowledge, this study is the first to report the anticancer activity of S. mannii root total extract and fractions, demonstrating its potential for cervical cancer management. Our investigation revealed that S. mannii root extracts selectively induced cytotoxic effects on cervical cancer cells, thereby corroborating the plant's ethnobotanical application in the treatment of cancer. The study highlighted the pro-apoptotic effects and regulation of autophagy by S. mannii root, in accordance with ethnomedicine. Nevertheless, further research is needed to identify the specific bioactive compounds responsible and to evaluate the effects of S. mannii root extracts in animal models and clinical settings.

Conclusion

The findings of this study suggest that S. mannii root extracts have a potential selective cytotoxic effect on human cervical cancer cells, attributed to their metabolomic profiles. In addition, S. mannii root extracts differentially regulated autophagy and triggered intrinsic mitochondrial-mediated apoptotic cell death in a dose- and time-dependent manner. Nevertheless, there is a need for further research to fully elucidate the molecular mechanism of S. mannii root against cervical cancer and the selective anti-cancer activity reported herein. Finally, the present study suggests that S. mannii root extracts may be further investigated in cervical cancer models, in vivo, and in clinical settings as a potential candidate for the treatment and management of cervical cancer.

Footnotes

Acknowledgments

This research was partially supported by KEMRI, under grant number KEMRI/COV/SPEC/003, and by the Africa-AI-Japan Project.

Statement of Human and Animal Rights

This article does not contain any studies with human or animal subjects.

Statement of Informed Consent

There are no human subjects in this article and informed consent is not applicable.

ORCID iD

Amel Elbasyouni

Author Contributions/CRediT

Elbasyouni, Amel: Conceptualization; Data curation; Formal analysis; Funding acquisition; Investigation; Methodology; Project administration; Resources; Software; Validation; Visualization; Writing - original draft; Writing - review & editing. Kyama, Mutinda C.: Conceptualization; Funding acquisition; Resources; Supervision; Writing - review & editing. El-Shemy, Hany A.: Conceptualization; Supervision; Writing - review & editing. Mwitari, Peter G.: Conceptualization; Resources; Supervision; Writing - review & editing.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was supported with funding from the Pan African University under the African Union Commission scholarship.

Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability

The data used and analyzed during the current study are incorporated in this paper.

References

Ferlay

Colombet

Soerjomataram

, et al. Cancer statistics for the year 2020: an overview. Int J Cancer. 2021;149(4):778–789. doi:https://doi.org/10.1002/ijc.33588

Singh

Vignat

Lorenzoni

, et al. Global estimates of incidence and mortality of cervical cancer in 2020: a baseline analysis of the WHO global cervical cancer elimination initiative. Lancet Glob Health. Published online December 2022:S2214109X22005010. doi:https://doi.org/10.1016/S2214-109X(22)00501-0

Sung

Ferlay

Siegel

, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–249. doi:https://doi.org/10.3322/caac.21660

Zhong

Xiong

, et al. Small molecules in targeted cancer therapy: advances, challenges, and future perspectives. Signal Transduct Target Ther. 2021;6(1):201. doi:https://doi.org/10.1038/s41392-021-00572-w

Burmeister

Khan

Schäfer

, et al. Cervical cancer therapies: current challenges and future perspectives. Tumour Virus Res. 2022;13:200238. doi:https://doi.org/10.1016/j.tvr.2022.200238

George

Chauhan

Dhawale

, et al. Insights into therapy resistance in cervical cancer. Adv Cancer Biol - Metastasis. 2022;6:100074. doi:https://doi.org/10.1016/j.adcanc.2022.100074

Nasim

Sandeep

Mohanty

. Plant-derived natural products for drug discovery: current approaches and prospects. The Nucleus. 2022;65(3):399–411. doi:https://doi.org/10.1007/s13237-022-00405-3

Mukhtar

Mustafa Adhami

Khan

Mukhtar

. Apoptosis and autophagy induction as mechanism of cancer prevention by naturally occurring dietary agents. Curr Drug Targets. 2012;13(14):1831–1841. doi:https://doi.org/10.2174/138945012804545489

Dehelean

Marcovici

Soica

, et al. Plant-Derived anticancer compounds as new perspectives in drug discovery and alternative therapy. Molecules. 2021;26(4):1109. doi:https://doi.org/10.3390/molecules26041109

10.

Auyeung

. Target-oriented mechanisms of novel herbal therapeutics in the chemotherapy of gastrointestinal cancer and inflammation. Published online 2013.

11.

Wang

Tan

Cheung

Feng

. Multi-Component herbal products in the prevention and treatment of chemotherapy-associated toxicity and Side effects: a review on experimental and clinical evidences. Front Pharmacol. 2018;9:1394. doi:https://doi.org/10.3389/fphar.2018.01394

12.

Atanasov

Waltenberger

Pferschy-Wenzig

, et al. Discovery and resupply of pharmacologically active plant-derived natural products: a review. Biotechnol Adv. 2015;33(8):1582–1614. doi:https://doi.org/10.1016/j.biotechadv.2015.08.001

13.

Najmi

Javed

Bratty

Alhazmi

. Modern approaches in the discovery and development of plant-based natural products and their analogues as potential therapeutic agents. Molecules. 2022;27(2):349. doi:https://doi.org/10.3390/molecules27020349

14.

Jeruto

Lukhoba

Ouma

Otieno

Mutai

. An ethnobotanical study of medicinal plants used by the nandi people in Kenya. J Ethnopharmacol. 2008;116(2):370–376. doi:https://doi.org/10.1016/j.jep.2007.11.041

15.

Nemati

Dehpouri

Eslami

Mahdavi

Mirzanejad

. Cytotoxic Properties of Some Medicinal Plant Extracts from Mazandaran, Iran. Iran Red Crescent Med J. 2013;15(11). doi:https://doi.org/10.5812/ircmj.8871

16.

Rahman

Sahabjada Akhtar

. Evaluation of anticancer activity of Cordia dichotoma leaves against a human prostate carcinoma cell line, PC3. J Tradit Complement Med. 2017;7(3):315–321. doi:https://doi.org/10.1016/j.jtcme.2016.11.002

17.

Calderón-Montaño

Martínez-Sánchez

Jiménez-González

, et al. Screening for selective anticancer activity of 65 extracts of plants collected in western andalusia, Spain. Plants. 2021;10(10):2193. doi:https://doi.org/10.3390/plants10102193

18.

Vergote

Ray-Coquard

Lorusso

Oaknin

Cibula

Van Gorp

. Investigational drugs for recurrent or primary advanced metastatic cervical cancer: what is in the clinical development pipeline? Expert Opin Investig Drugs. 2023;32(3):201–211. doi:https://doi.org/10.1080/13543784.2023.2179483

19.

Ali

Wani

SUD

Salahuddin

, et al. Recent advance of herbal medicines in cancer- a molecular approach. Heliyon. 2023;9(2):e13684. doi:https://doi.org/10.1016/j.heliyon.2023.e13684

20.

Gaobotse

Venkataraman

Brown

, et al. The use of African medicinal plants in cancer management. Front Pharmacol. 2023;14:1122388. doi:https://doi.org/10.3389/fphar.2023.1122388

21.

Lica

Wieczór

Grabe

, et al. Effective drug concentration and selectivity depends on fraction of primitive cells. Int J Mol Sci. 2021;22(9):4931. doi:https://doi.org/10.3390/ijms22094931

22.

Chi

Viriyapak

Kwack

, et al. Regulation of paclitaxel-induced programmed cell death by autophagic induction: a model for cervical cancer. Obstet Gynecol Sci. 2013;56(2):84. doi:https://doi.org/10.5468/OGS.2013.56.2.84

23.

Carpentieri

Soltanipour

Ferrari

Pataro

Donsì

. Emerging green techniques for the extraction of antioxidants from Agri-food by-products as promising ingredients for the food industry. Antioxidants. 2021;10(9):1417. doi:https://doi.org/10.3390/antiox10091417

24.

Del Pilar Sánchez-Camargo

Pleite

Herrero

Cifuentes

Ibáñez

Gilbert-López

. New approaches for the selective extraction of bioactive compounds employing bio-based solvents and pressurized green processes. J Supercrit Fluids. 2017;128:112–120. doi:https://doi.org/10.1016/j.supflu.2017.05.016

25.

Ellithey

Lall

Hussein

Meyer

. Cytotoxic and HIV-1 enzyme inhibitory activities of red sea marine organisms. BMC Complement Altern Med. 2014;14(1):77. doi:https://doi.org/10.1186/1472-6882-14-77

26.

Alam

Ashraf

Sheikh

, et al. Potential therapeutic implications of caffeic acid in cancer signaling: past, present, and future. Front Pharmacol. 2022;13:845871. doi:https://doi.org/10.3389/fphar.2022.845871

27.

Rajendra Prasad

Karthikeyan

Venkata Reddy

. Inhibitory effect of caffeic acid on cancer cell proliferation by oxidative mechanism in human HT-1080 fibrosarcoma cell line. Mol Cell Biochem. 2011;349(1-2):11–19. doi:https://doi.org/10.1007/s11010-010-0655-7

28.

Rezaeiseresht

Cheshomi

Falanji

Movahedi-Motlagh

Hashemian

Mireskandari

. Cytotoxic activity of caffeic acid and gallic acid against MCF-7 human breast cancer cells: An in silico and in vitro study. Avicenna J Phytomedicine. Online First 2019. doi:https://doi.org/10.22038/ajp.2019.13475

29.

Murad

Soares

NDCP

Brand

Monteiro

Teodoro

. Effects of caffeic and 5-caffeoylquinic acids on cell viability and cellular uptake in human colon adenocarcinoma cells. Nutr Cancer. 2015;67(3):532–542. doi:https://doi.org/10.1080/01635581.2015.1004736

30.

Alam

Ali

Mohammad

Hasan

Yadav

MdI

. B cell lymphoma 2: a potential therapeutic target for cancer therapy. Int J Mol Sci. 2021;22(19):10442. doi:https://doi.org/10.3390/ijms221910442

31.

Alam

Kashyap

Mishra

Panda

Nagini

Mishra

. Role and regulation of proapoptotic bax in oral squamous cell carcinoma and drug resistance. Head Neck. 2019;41(1):185–197. doi:https://doi.org/10.1002/hed.25471

32.

Chang

Hsieh

Hsiao

Lin

Hung

. Caffeic acid induces apoptosis in human cervical cancer cells through the mitochondrial pathway. Taiwan J Obstet Gynecol. 2010;49(4):419–424. doi:https://doi.org/10.1016/S1028-4559(10)60092-7

33.

Anantharaju

Gowda

Vimalambike

Madhunapantula

. An overview on the role of dietary phenolics for the treatment of cancers. Nutr J. 2016;15(1):99. doi:https://doi.org/10.1186/s12937-016-0217-2

34.

Pelinson

Assmann

Palma

, et al. Antiproliferative and apoptotic effects of caffeic acid on SK-mel-28 human melanoma cancer cells. Mol Biol Rep. 2019;46(2):2085–2092. doi:https://doi.org/10.1007/s11033-019-04658-1

35.

Jiang

Chen

, et al. Blockage of TGFβ-SMAD2 by demethylation-activated miR-148a is involved in caffeic acid-induced inhibition of cancer stem cell-like properties in vitro and in vivo. FEBS Open Bio. 2015;5(1):466–475. doi:https://doi.org/10.1016/j.fob.2015.05.009

36.

Kleczka

Kubina

Dzik

, et al. Caffeic acid phenethyl ester (CAPE) induced apoptosis in serous ovarian cancer OV7 cells by deregulation of BCL2/BAX genes. Molecules. 2020;25(15):3514. doi:https://doi.org/10.3390/molecules25153514

37.

Kabała-Dzik

Rzepecka-Stojko

Kubina

, et al. Comparison of two components of propolis: caffeic acid (CA) and caffeic acid phenethyl ester (CAPE) induce apoptosis and cell cycle arrest of breast cancer cells MDA-MB-231. Molecules. 2017;22(9):1554. doi:https://doi.org/10.3390/molecules22091554

38.

Karakurt

Abuşoğlu

Arituluk

. Comparison of anticarcinogenic properties of Viburnum opulus and its active compound p-coumaric acid on human colorectal carcinoma. Turk J Biol. 2020;44(5):252–263. doi:https://doi.org/10.3906/biy-2002-30

39.

Sharma

Rajamanickam

Nagarajan

. Antiproliferative effect of p-Coumaric acid targets UPR activation by downregulating Grp78 in colon cancer. Chem Biol Interact. 2018;291:16–28. doi:https://doi.org/10.1016/j.cbi.2018.06.001

40.

Jang

Kim

. Effect of Sasa quelpaertensis Nakai extracts and its constituent p -coumaric acid on the apoptosis of human cancer cell lines. Nat Prod Sci. 2018;24(4):293. doi:https://doi.org/10.20307/nps.2018.24.4.293

41.

Jaganathan

. Events associated with apoptotic effect of p-Coumaric acid in HCT-15 colon cancer cells. World J Gastroenterol. 2013;19(43):7726. doi:https://doi.org/10.3748/wjg.v19.i43.7726

42.

Yang

Liu

, et al. The anti-tumor effects of p-coumaric acid on melanoma A375 and B16 cells. Front Oncol. 2020;10:558414. doi:https://doi.org/10.3389/fonc.2020.558414

43.

Dongdong

Jin

Yang

, et al. Antiproliferative and immunoregulatory effects of azelaic acid against acute myeloid leukemia via the activation of notch signaling pathway. Front Pharmacol. 2019;10:1396. doi:https://doi.org/10.3389/fphar.2019.01396

44.

Zhang

Luo

Jin

, et al. Azelaic acid exerts antileukemia effects against acute myeloid leukemia by regulating the prdxs/ROS signaling pathway. Saso L, ed. Oxid Med Cell Longev. 2020;2020:1–16. doi:https://doi.org/10.1155/2020/1295984

45.

Qiu

Zhao

Suo

, et al. Linoleic acid exhibits anti-proliferative and anti-invasive activities in endometrial cancer cells and a transgenic model of endometrial cancer. Cancer Biol Ther. 2024;25(1):2325130. doi:https://doi.org/10.1080/15384047.2024.2325130

46.

Ogata

Mori

Kishi

, et al. Linoleic acid upregulates microrna-494 to induce quiescence in colorectal cancer. Int J Mol Sci. 2021;23(1):225. doi:https://doi.org/10.3390/ijms23010225

47.

Bao

Zhang

Xia

. Molecular mechanism of β-sitosterol and its derivatives in tumor progression. Front Oncol. 2022;12:926975. doi:https://doi.org/10.3389/fonc.2022.926975

48.

Evans

Cowey

Siegal

Hardy

. Stearate preferentially induces apoptosis in human breast cancer cells. Nutr Cancer. 2009;61(5):746–753. doi:https://doi.org/10.1080/01635580902825597

49.

Byeon

Lee

, et al. Hydroquinone exhibits in vitro and in vivo anti-cancer activity in cancer cells and mice. Int J Mol Sci. 2018;19(3):903. doi:https://doi.org/10.3390/ijms19030903

50.

Mihanfar

Darband

Sadighparvar

, et al. In vitro and in vivo anticancer effects of syringic acid on colorectal cancer: possible mechanistic view. Chem Biol Interact. 2021;337:109337. doi:https://doi.org/10.1016/j.cbi.2020.109337

51.

Kafali

Finos

Tsoupras

. Vanillin and its derivatives: a critical review of their anti-inflammatory, anti-infective, wound-healing, neuroprotective, and anti-cancer health-promoting benefits. Nutraceuticals. 2024;4(4):522–561. doi:https://doi.org/10.3390/nutraceuticals4040030

52.

Umereweneza

Atilaw

Peintner

, et al. Macrocyclic pyrrolizidine alkaloids and silphiperfolanol angelate esters from Solanecio mannii. Eur J Org Chem. 2023;26(8):e202201280. doi:https://doi.org/10.1002/ejoc.202201280

53.

Balachandran

Emi

Arun

, et al. In vitro anticancer activity of methyl caffeate isolated from Solanum torvum swartz. fruit. Chem Biol Interact. 2015;242:81–90. doi:https://doi.org/10.1016/j.cbi.2015.09.023

54.

Sidoryk

Jaromin

Filipczak

Cmoch

Cybulski

. Synthesis and antioxidant activity of caffeic acid derivatives. Molecules. 2018;23(9):2199. doi:https://doi.org/10.3390/molecules23092199

55.

Ahmad

Khan

Lee

, et al. Lupeol, a plant-derived triterpenoid, protects mice brains against aβ-induced oxidative stress and neurodegeneration. Biomedicines. 2020;8(10):380. doi:https://doi.org/10.3390/biomedicines8100380

56.

Bociort

Macasoi

Marcovici

, et al. Investigation of lupeol as anti-melanoma agent: an in vitro-in ovo perspective. Curr Oncol. 2021;28(6):5054–5066. doi:https://doi.org/10.3390/curroncol28060425

57.

Kamran

Sinniah

Abdulghani

MAM

Alshawsh

. Therapeutic potential of certain terpenoids as anticancer agents: a scoping review. Cancers (Basel). 2022;14(5):1100. doi:https://doi.org/10.3390/cancers14051100

58.

Pardo-Rodriguez

Cifuentes-López

Bravo-Espejo

, et al. Lupeol acetate and α-amyrin terpenes activity against trypanosoma cruzi: insights into toxicity and potential mechanisms of action. Trop Med Infect Dis. 2023;8(5):263. doi:https://doi.org/10.3390/tropicalmed8050263

59.

Yadav

Prasad

Sung

Kannappan

Aggarwal

. Targeting inflammatory pathways by triterpenoids for prevention and treatment of cancer. Toxins (Basel). 2010;2(10):2428–2466. doi:https://doi.org/10.3390/toxins2102428

60.

Ndom

Mbafor

Kakam

, et al. Styrylpyrone glucosides with antimicrobial activity from Senecio mannii hook. (Asteraceae). 2007:6.

61.

Asres

Sporer

Wink

. Occurrence of pyrrolizidine alkaloids in three Ethiopian Solanecio species. Biochem Syst Ecol. 2008;36(5-6):399–407. doi:https://doi.org/10.1016/j.bse.2007.10.003

62.

Dou

Zhang

Han

Jin

Sun

. Anti-tumor activity of polysaccharides extracted from Senecio scandens Buch, -Ham root on hepatocellular carcinoma. Trop J Pharm Res. 2017;16(1):43. doi:https://doi.org/10.4314/tjpr.v16i1.6

63.

Yang

, et al. Autophagy: an intracellular degradation pathway regulating plant survival and stress response. Front Plant Sci. 2020;11:164. doi:https://doi.org/10.3389/fpls.2020.00164

64.

Kumari

Kamat

Singh

Kumar

Jayabaskaran

. Inhibition of autophagy increases cell death in HeLa cells through usnic acid isolated from lichens. Plants. 2023;12(3):519. doi:https://doi.org/10.3390/plants12030519

65.

Mauthe

Orhon

Rocchi

, et al. Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy. 2018;14(8):1435–1455. doi:https://doi.org/10.1080/15548627.2018.1474314

66.

Zhang

Shi

Huang

. Natural compound oblongifolin C inhibits autophagic flux, and induces apoptosis and mitochondrial dysfunction in human cholangiocarcinoma QBC939 cells. Mol Med Rep. 2016;14(4):3179–3183. doi:https://doi.org/10.3892/mmr.2016.5591

67.

McKnight

Zhong

Wold

, et al. Beclin 1 is required for neuron viability and regulates endosome pathways via the UVRAG-VPS34 Complex. Orr HT, ed. PLoS Genet. 2014;10(10):e1004626. doi:https://doi.org/10.1371/journal.pgen.1004626

68.

Thoresen

Pedersen

Liestøl

Stenmark

. A phosphatidylinositol 3-kinase class III sub-complex containing VPS15, VPS34, Beclin 1, UVRAG and BIF-1 regulates cytokinesis and degradative endocytic traffic. Exp Cell Res. 2010;316(20):3368–3378. doi:https://doi.org/10.1016/j.yexcr.2010.07.008

69.

Gong

Bauvy

Tonelli

, et al. Beclin 1 and autophagy are required for the tumorigenicity of breast cancer stem-like/progenitor cells. Oncogene. 2013;32(18):2261–2272. doi:https://doi.org/10.1038/onc.2012.252

70.

Mathew

Kongara

Beaudoin

, et al. Autophagy suppresses tumor progression by limiting chromosomal instability. Genes Dev. 2007;21(11):1367–1381. doi:https://doi.org/10.1101/gad.1545107

71.

Rui

Jiumei

Ziwei

Ying

. Advances in the study of autophagy in breast cancer. Breast Cancer. 2024;31(2):195–204. doi:https://doi.org/10.1007/s12282-023-01541-7

72.

Yoo

Lee

. Enhancing autophagy leads to increased cell death in radiation-treated cervical cancer cells. J Obstet Gynaecol. 2023;43(1):2171281. doi:https://doi.org/10.1080/01443615.2023.2171281

73.

Yang

, et al. Excessive autophagy activation and increased apoptosis are associated with palmitic acid-induced cardiomyocyte insulin resistance. J Diabetes Res. 2017;2017:1–11. doi:https://doi.org/10.1155/2017/2376893

74.

Zheng

, et al. Palmitic acid induces autophagy in hepatocytes via JNK2 activation. Acta Pharmacol Sin. 2014;35(4):504–512. doi:https://doi.org/10.1038/aps.2013.170

75.

Hernández-Cáceres

Cereceda

Hernández

, et al. Palmitic acid reduces the autophagic flux in hypothalamic neurons by impairing autophagosome-lysosome fusion and endolysosomal dynamics. Mol Cell Oncol. 2020;7(5):1789418. doi:https://doi.org/10.1080/23723556.2020.1789418

76.

Liu

. Targeting cell death mechanisms: the potential of autophagy and ferroptosis in hepatocellular carcinoma therapy. Front Immunol. 2024;15:1450487. doi:https://doi.org/10.3389/fimmu.2024.1450487

77.

Niu

Chen

Zhu

Zhou

Shi

. Anti-proliferative effect of cardamonin on mTOR inhibitor-resistant cancer cells. Mol Med Rep. Published online December 20, 2019. doi:https://doi.org/10.3892/mmr.2019.10898

78.

Eidet

Pasovic

Jackson

Utheim

. Objective assessment of changes in nuclear morphology and cell distribution following induction of apoptosis. Diagn Pathol. 2014;9(1):92. doi:https://doi.org/10.1186/1746-1596-9-92

79.

Kalkavan

Green

. MOMP, cell suicide as a BCL-2 family business. Cell Death Differ. 2018;25(1):46–55. doi:https://doi.org/10.1038/cdd.2017.179

80.

Ulloth

Casiano

De Leon

. Palmitic and stearic fatty acids induce caspase-dependent and -independent cell death in nerve growth factor differentiated PC12 cells. J Neurochem. 2003;84(4):655–668. doi:https://doi.org/10.1046/j.1471-4159.2003.01571.x

81.

Wang

Zhang

Liu

Hong

. β-Sitosterol as a promising anticancer agent for chemoprevention and chemotherapy: mechanisms of action and future prospects. Adv Nutr. 2023;14(5):1085–1110. doi:https://doi.org/10.1016/j.advnut.2023.05.013

82.

Jayaraman

Raj Natarajan

Ponnusamy

Veeraraghavan

Jasmine

. Unlocking the potential of beta sitosterol: augmenting the suppression of oral cancer cells through extrinsic and intrinsic signalling mechanisms. Saudi Dent J. 2023;35(8):1007–1013. doi:https://doi.org/10.1016/j.sdentj.2023.08.003

83.

Rajavel

Packiyaraj

Suryanarayanan

Singh

Ruckmani

Pandima Devi

. β-Sitosterol targets Trx/Trx1 reductase to induce apoptosis in A549 cells via ROS mediated mitochondrial dysregulation and p53 activation. Sci Rep. 2018;8(1):2071. doi:https://doi.org/10.1038/s41598-018-20311-6

84.

Carrillo

Cavia

Alonso-Torre

. Efecto antitumoral del ácido oleico; mecanismos de acción: revision cientifica. Nutr Hosp. 2012;6:1860–1865. doi:https://doi.org/10.3305/nh.2012.27.6.6010

85.

Kim

Moon

Lee

Cho

. Oleic acid inhibits the migration and invasion of breast cancer cells with stemness characteristics through oxidative stress-mediated attenuation of the FAK/AKT/NF-κB pathway. J Funct Foods. 2024;116:106224. doi:https://doi.org/10.1016/j.jff.2024.106224

86.

Deng

Kong

Suo

, et al. Oleic acid exhibits anti-proliferative and anti-invasive activities via the PTEN/AKT/mTOR pathway in endometrial cancer. Cancers (Basel). 2023;15(22):5407. doi:https://doi.org/10.3390/cancers15225407

87.

Jiang

Wang

, et al. Oleic acid induces apoptosis and autophagy in the treatment of tongue squamous cell carcinomas. Sci Rep. 2017;7(1):11277. doi:https://doi.org/10.1038/s41598-017-11842-5

88.

Zhu

Schwarz

Ahlemeyer

Grzeschik

Klumpp

Krieglstein

. Oleic acid causes apoptosis and dephosphorylates bad. Neurochem Int. 2005;46(2):127–135. doi:https://doi.org/10.1016/j.neuint.2004.08.003

89.

Cortez

Villegas

Burgos

, et al. Adjuvant properties of caffeic acid in cancer treatment. Int J Mol Sci. 2024;25(14):7631. doi:https://doi.org/10.3390/ijms25147631

90.

Nasiri

Azarbani

Pirnia

Abbaszadeh

Gholami

. The effect of caffeic acid on spermatogonial stem cell-type A Cryopreservation.

91.

Yao

Liu

. Rapamycin inhibits proliferation and apoptosis of retinoblastoma cells through PI3K/AKT signaling pathway. Oncol Lett. Published online January 30, 2020. doi:https://doi.org/10.3892/ol.2020.11363

92.

Wang

Yao

Liang

. Rapamycin, an mTOR inhibitor, induced apoptosis via independent mitochondrial and death receptor pathway in retinoblastoma Y79 cell.

Metabolomics Profile and Pro-Apoptotic Activity of Solanecio mannii Root Extracts Against Human Cervical Cancer Cell Lines

Abstract

Background

Methods

Results

Conclusion

Keywords

Introduction

Materials and Methods

Plant Collection, Identification, and Extraction

Gas Chromatography–Coupled Mass Spectrometry (GC-MS)-Based Metabolomic Profiling of S. mannii Root Extracts

Extracts Preparation for In Vitro Studies

Cytotoxicity and Selectivity Analysis Using CCK8 Assay

Monodansylcadaverine (MDC) Staining

4′,6-Diamidino-2-Phenylindole (DAPI) Staining

Hoechst Staining

Caspase-3, −8, and −9 Colorimetric Activity

Analysis of the Relative Expression of Target Genes

Statistical Analysis

Results

GC-MS-Based Metabolomic Profiles of S. mannii Root Extracts

S. mannii Root Extracts Selectively Inhibited the Viability of HeLa Cells

S. mannii Root Extracts Differentially Regulated Autophagy in HeLa Cells

S. mannii Root Extracts Induced Intrinsic Apoptosis in Dose- and Time-Dependent Manner

Discussion

Conclusion

Footnotes

Acknowledgments

Statement of Human and Animal Rights

Statement of Informed Consent

ORCID iD

Author Contributions/CRediT

Funding

Conflicting Interests

Data Availability

References