Sage Journals: Discover world-class research

Abstract

The discovery of new substances that present innumerable biological activities for the development of drugs is increasingly difficult. Natural marine products are a source of substances with a diversified chemical structure, a broad spectrum of biological activities and low cytotoxicity, which are the essential characteristics for the development of a new drug. An increasing number of reports of Chikungunya virus (CHIKV) infections, in addition to the lack of specific antiviral therapy or vaccines, emphasizes the importance of searching for effective therapy. Studies with the marine green alga Caulerpa racemosa showed antiviral potential. Hence, the aim of this work was to evaluate the anti-CHIKV activity of a marine alkaloid isolated from green alga C. racemosa. Vero cells were used in antiviral assays, submitted to CHIKV, and treated with different concentrations of caulerpin. In the antiviral activity, we observed that the isolated compound showed a much significant and promising EC₅₀ inhibitory effect of 0.8 µM. When evaluating the virucidal activity, we observed that caulerpin was very efficient against CHIKV, being able to inhibit around 90% of the viral infectivity when treated with 5 μM of the compound. We observed that caulerpin added at times 0, 1, 2, and 3 postinfection still maintains a 100% inhibitory potential of viral replication for CHIKV. These studies suggest that the said compounds might be potentially studied for use in the prevention and treatment of CHIKV infections. Derivatives can be considered as a promising new anti-CHIKV drug and can be used for clinical testing.

Keywords

anti-CHIKV antiviral drugs marine natural product

The secondary metabolites produced by marine macroalgae present a broad spectrum of biological activity, mainly the metabolites derived from representatives of the tropical and subtropical seas,¹ making marine algae an incredible source of substances in the search for prototypes with pharmacological activities. The antiviral potential of macroalgae was very long known. Several studies have demonstrated the activity of various algal strains against strains of HIV-1,^2,3 HSV-1,^4,5 HSV-2,^6,7 and dengue type 2.⁸ Thus, seaweed provides a rich source for the discovery of antiviral drugs.

The green seaweed Caulerpa racemosa is well known in the coastal region of Brazil due to its peculiar shape, which is similar to a grape bunch, and has attracted attention of several researchers due to its biological potential such as antitumoral and antiviral. Several substances have already been isolated from C. racemosa: among them, some alkaloids, terpenes, and sterols which presented antibacterial and antioxidant biological activity.^9,10

Among many chemical classes present in plant species, alkaloids have been found to be of great importance in the development of new drugs, since they have a great variety of chemical structures, and have been identified to be responsible for many of the pharmacological properties of medicinal plants^11

-15

Caulerpin comes from a family of natural bisindole alkaloids and has an extra 8-membered ring between 2 indole rings that are directly incorporated with the carbonyl group. This alkaloid presents a number of important biological activities as already described in the literature among which it is important to mention the antitumor,¹⁶ growth regulator,¹⁷ and the stimulating properties of root growth,¹⁸ but its antinociceptive and in vivo effect in vivo. Anti-inflammatory activities have not been reported yet. In addition, caulerpin can also be classified as a low toxicity compound. The literature reports the repellent activity against the Aedes aegypti mosquito from the C. racemosa algae when prepared in acetone extract.¹⁹ Therefore, it is of great importance to find the use of antiviral activity for this species of seaweed in view of its sustainability in production.

The Chikungunya virus (CHIKV) is an Alphavirus of the Togaviridae family transmitted by the mosquitoes A. aegypti and Aedes albopictus.²⁰ Severe joint pain, also called arthralgia, is the main clinical manifestation of CHIKV. This disease was first described with epidemiological data in East Africa in 1952 to 1953.²¹ In 2014, the first autochthonous case of CHIKV infection was reported in the northeastern Brazil.²² In 2018, 16 chikungunya deaths were laboratory confirmed and 49 deaths remain in suspicion that can be confirmed or discarded. In the same period of 2017, 183 deaths were confirmed and there were 27 deaths under investigation.²³ According to the epidemiological bulletin, in 2019 (December 30, 2018 to March 16, 2019), there were 12 942 probable cases of chikungunya in Brazil, with an incidence of 6.2 cases/100 thousand inhabitants. In 2018, 23 484 probable cases were registered. In 2019, the Southeast region had the highest number of probable cases of chikungunya (8536 cases, 66.0%) when compared to the rest of the country, ie, the North regions (2139 cases, 16.5%), the Northeast (1786 cases, 13.8%), the Midwest (293 cases, 2.3%), and the South (188 cases, 1.5%).

Currently, there are no specific drugs for the treatment of CHIKV infection. Nonsteroidal anti-inflammatory drugs are recommended to improve arthralgia. However, the re-emergence of CHIKV led to the evaluation of nonspecific antiviral drugs, such as ribavirin and chloroquine, which have antiviral activity in cell cultures but achieved only a limited success, with questionable therapeutic effectiveness (Briolant et al, 2004; Khan et al, 2010), without conclusive results being demonstrated on their in vivo efficacy (Brighton, 1984; Lamballerie et al, 2008; Ravichandran, 2008).

Based on all the clear evidence that has been observed in the literature, determining the strong association with different gravitational frames for this infection and the increasing search for immediate solutions contribute to its control. The aim of this study is to evaluate the antiviral activity of caulerpin, an alkaloid isolated from the macroalgae C. racemosa, to reduce the morbidity and mortality of CHIKV infection, thus contributing to a decrease in the number of infected individuals and possible consecutive outbreaks.

Air-dried specimen (70 g) were extracted with 100% acetone. Evaporation of the crude extract yielded 2.4 g of residue (about 3.3% of the dry mass) of which 1 g was subjected to purification by silica gel column chromatography and eluted with n-hexane/EtOAc mixtures of increasing polarity (going from 100% hexane to 100% EtOAc). The fractions eluted with hexane/EtOAc (7:3) contained caulerpin, obtained in pure form as orange-red needle-shaped crystals after recrystallization from n-hexane. The identification of 1 as caulerpin (Figure 1) was based on the comparison of physical and spectroscopic data with literature data and the authentic samples were obtained as in the previous studies.⁹

Figure 1

Molecular structure of caulerpin.

The extract of C. racemosa was prepared in 100% acetone and was subjected to a choice of the eluent system to be used in the chromatographic column by varying the polarity of the organic solvents n-hexane and ethyl acetate by thin layer chromatography (TLC). The eluent system chosen to be run on the open chromatography column was Hex/AcOEt (7:3) due to separation of the lanes and an appropriate Rf.

The acetone extract was subjected to the chromatography on the open chromatography column with a silica gel stationary phase of 60 (0.063-0.200 mm) from Merck, supported by a glass column with a diameter of 4 cm. The silica height used for the glass column was 20 cm, where the sample (1 g) was incorporated into the column. The organic solvents n-hexane and ethyl acetate (7:3) were used as the mobile phase, where the displacement of a coral stain was observed, and it was collected in its entirety in a Becker.

An aliquot (10 mg) of the fraction obtained in the fractionation of the extract was solubilized using the chloroform organic solvent and conditioned under refrigeration. After evaporation of the solvent, it was possible to observe reddish crystals under the vessel wall. The bottom of the vessel was solubilized using dichloromethane and discarded.

Analyzing the ¹H NMR of the sample resulting from recrystallization, we observed the presence of 2 broad doublets in δ 7.41 and δ 7.31. There were also 2 double triplets in δ 7.17 and δ 7.07, and 3 simpletons δ 9.18, δ 8.03, and δ 3.88 which show the characteristics of methyl groups. When compared with the literature, such signals are characteristic of the natural caulerpin product. Therefore, the recrystallized fraction has caulerpin as the major substance.^24,25 (Figure 1).

The cytotoxicity (CC₅₀) of the isolated compound from the algae C. racemosa was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich). The results in Table 1 showed that C. racemosa isolated present the best CC₅₀ with a value of 589.3 µg/mL. Subsequently, we evaluated the antiviral activity of the caulerpin. For these analyses, we tested different concentrations of the compound. The percent inhibition results (EC₅₀) of the molecule caulerpin showed a 99% inhibition at concentrations of 20, 10, and 5 µM. A concentration of 2.5 µM showed 92% inhibition, 1.25 µM showed 75% inhibition, and 0.65 µM showed 47% inhibition featuring an EC₅₀ of 0.8 µg/mL.

Table 1

Cytotoxicity, Anti-Chikungunya Virus Profile, and Selectivity Index for Fractions Isolated Caulerpin.

Compounds	CC₅₀, µM^a	EC₅₀, µM^b	SI^c
Caulerpin	589.3	0.8 ± 2.31	736.62
Ribavirin	297	2.42 ± 0.49	122

The mean values ± standard deviation are representative of 3 independent experiments.

^a50% Cytotoxic concentration, the concentration that reduces cell viability by 50% compared to untreated controls.

^bConcentration that reduced Chikungunya virus replication by 50% compared to infected controls.

^cSelectivity index was defined as the ratio between CC₅₀ and EC₅₀ and represents the safety for in vitro assays.

We observed that the caulerpin were able to inhibit the replication of CHIKV in a dose-dependent manner by inhibiting plaque formation (Figure 2). Based on these data, we evaluated the selectivity index (SI) that represents the degree of reliability of the extracts for possible future use and that has the relationship between CC₅₀ and EC₅₀, corroborating the perspectives that 3 extracts with the lowest EC₅₀ also had a higher index of selectivity. Caulerpin presented a higher index 736.62 (Table 1). We have already published a paper, which demonstrates that the algae extract of C. racemosa presents a 732 mg/mL CC₅₀.²⁶

Figure 2

Effect of the caulerpin on Chikungunya virus replication at different concentrations 0.65, 1.25, 2.5, 5, 10, and 20 µM.

After the outbreaks of infection and its accelerated spread caused by CHIKV²⁷ as well as their strong impacts on public health, severe associations with signs and symptoms of high severity possibly caused by these viruses. Several studies have been carried out in the search of compounds that can act on viral replication reducing the severity of the cases and improving the quality of life of the affected people.

Strategies using natural products of seaweed or other sources and their derivatives for years have been shown to be effective mainly because of their low toxicity and their high activity potential against different viruses as previously described.^20,21 In our studies, we demonstrated that the compounds have low toxicity, with a CC₅₀ of 589.3 µM for caulerpin, demonstrating that the compound can be very promising. Our compound also exhibits potent antiviral activity with values of EC₅₀ CHIKV 0.8 µM generating a SI of 736.62.

We also performed the PCR assay and evaluated that caulerpin was able to dose-dependently inhibit the production of RNA copies showing that the drug has a total effect both on the viral particle and on the production of RNA (Figure 3) .

Figure 3

Graphical representation showing the effect of caulerpin at concentrations of 0.65, 1.25, 2.5, 5, and 10 µM on Chikungunya virus genomic RNA by quantitative PCR. The results showed that all treatments with the extract showed a significant reduction of RNA copies. Error bars indicate that the standard deviation and experiments were performed in triplicate. **P < 0.01; ***P < 0.001 in Tukey test.

Determination of the Virucidal Activity of the Compound

This evaluation was performed by the determination of plaque formation and the determination of viral titer. As can be seen in Figure 4, C. racemosa isolated was able to inhibit the replication of CHIKV in a 100% dose-dependent manner at the concentration of 5 µM used. Ribavirin that was used as a control did not present a significant effect inhibiting up to 35% of virucidal activity for CHIKV.

Figure 4

Effect of caulerpin on infectivity of Chikungunya virus. Vero cells were infected with Chikungunya virus at an MOI of 0.1; the results were evaluated by plaque assay. Error bars indicate that the standard deviation and experiments were performed in triplicate. 1.25 μg/mL; 2.5 μg/mL; and 5 μg/mL.

An important evaluation that has been extensively studied in the literature was to evaluate the virucidal potential of compounds, determining their effectiveness in epidemic outbreaks, acting as a preventive measure. We observed that caulerpin showed a dose-dependent virucidal potential to inhibit up to 100% of CHIKV activity at the concentration of 5 µM used (Figure 4).

Time of Addition Assay

When we observed the effects of the compounds at different times of addition on vero cells infected by CHIKV, the compounds added at T = 0, 1, 2, and 3 (simultaneous) had a very significant inhibitory effect with 100% inhibition rate on the virus when compared with ribavirin, followed by a strong decline of its activity after 8 hours, whereas caulerpin only showed a decline accentuated after 16 hours, as observed in Figure 5.

Figure 5

Time course chart showing different treatment times (hours) at the concentration of 5 µM with the action of the compound in infection.

The determination of the action mechanisms is an important strategy to evaluate if the compounds have a promising character and has certain specificities. The search for drugs that act at different stages of viral replication in addition to its low toxicity may be important to determine if it is possible to adopt it for clinical use.²⁶ In this way, when we observed the low cytotoxicity and high inhibition of the replication of CHIKV, we evaluated the inhibitory effect of the compound added at different times after viral infection. We observed that caulerpin added in time 0, 1, 2, and 3 hours postinfection still maintains an inhibitory potential of viral replication 100% for CHIKV.

The cycle of the virus has not yet been described in the literature according to a time frame. The article claims the CHIKV replication cycle to last 6 hours.²⁸ However, this study has published a review demonstrating a few drug candidates that act on different stages of the replication cycle, but with a questionable therapeutic efficacy.

Further studies allowed us to determine if the compound has a potential antiviral activity. The evaluation of a compound combination is in reduced concentrations with a considerable increase of its inhibitory effects, but with reduction of toxicity in the low concentrations used, as already proposed by some research groups.^29,30

In conclusion, our findings showed that the caulerpin isolated compound had activity against CHIKV. With regard to the possible mechanism of action of these substance, caulerpin showed a high virucidal pattern.

Our results demonstrate the importance of searching the marine environment for antiviral drugs with activity against CHIKV that can significantly reduce the morbidity and mortality of infection. Given the virucidal activity of caulerpin, it may be useful in developing a preventive strategy to significantly reduce the emergence of new cases.

Experimental

Algae Extraction and Isolation

Specimen of green seaweed C. racemosa (Forsskål) J.Agardh were collected by scuba diving at a depth ranging from 50 to 10 m, in May 2008, at sublittoral the west side of the archipelago of São Pedro and São Paulo, Pernambuco Brazil (lat. 00°55′S, long. 29°21′W) lying about 1000 km from the Rio Grande do Norte State coast. The algae were collected and identified by Doctor Roberto Campos Villaça (Departamento de Biologia Marinha, Instituto de Biologia, Universidade Federal Fluminense). The seaweeds were washed with local seawater and separated from sediments, epiphytes, and other associated organisms. The Voucher specimens were deposited at the Herbarium of the Rio de Janeiro State University, Brazil (HRJ 10572).

All solvents were high performance liquid chromatography (HPLC) grade. Analytical thin-layer chromatography (TLC) separations were carried out on Merck silica gel 60 F-254 (0.2 mm) precoated aluminum plates. Once developed, the plates were visualized by spraying with 2% ceric sulfate in sulfuric acid, followed by gentle heating. Silica gel 60 (Merck, 70-230 and 230-400 mesh) was used for column chromatography. Nuclear magnetic resonance spectra were recorded in CDCl₃ (100%, Aldrich). After extraction with 100% acetone at room temperature, the material was filtered and the solvent was removed by using a rotary evaporator under reduced pressure. The extract was stored under refrigeration. The extract was subjected to TLC with eluents of different polarities. Analyses by analytical TLC were performed on silica gel 60 F254 aluminum plates. The revelations of the chromatographic spots were made by inspection under UV light (at 254 and 366 nm) and by spraying with a solution of 2% ceric sulfate in sulfuric acid, followed by heating. The column chromatography was performed on silica gel 60 (70-230 mesh).

Cytotoxicity Assay

To assess the cytotoxic effect of the caulerpin on vero cells with 90% confluence in 96-well plate, the cells were treated with 100, 200, 400, 800, and 1000 µg/mL of isolated substance caulerpin and incubated for 2 to 3 days in Dulbecco's Modified Eagle Medium (DMEM) plus 5% of fetal bovine serum (FBS) at 37°C in CO₂ incubator. Next, MTT reagent (5 mg/mL) (Sigma Aldrich) was added after 3 days postdrug treatment and incubated for 3 hours at 37°C. Medium was removed, 100 µM Dimethyl sulfoxide (DMSO) was added, and cells were incubated at 37°C for 15 minutes to dissolve the Formazan crystals as described.³¹ The absorbance was measured at 550 nm using ELISA plate reader. The metabolically active cell percentage was compared with the cells control and cellular cytotoxicity was determined. To validate this experiment, we perform 3 times in independent form.

Antiviral Assay

Antiviral activity was evaluated using a virus plaque reduction assay. Vero cells were grown in 24-well plates under described conditions and subsequently infected with CHIKV (Multiplicity of Infection - MOI = 0.1) in the absence or presence of different concentrations of the caulerpin (0.65, 1.25, 2.5, 5, 10, and 20 µM). After 1 hour of adsorption at 37°C, residual inoculum was replaced by medium containing 1% methylcellulose and the corresponding dose of each compound. Plaques were counted after 3 days of incubation at 37°C at 5% CO₂. The inhibitory concentration 50% (EC₅₀) was calculated as the compound concentration required to reduce virus plaques by 50%. All determinations were performed twice and each in triplicate. This was used to determine the number of plaques forming virus units (PFU/mL) compared to mock CHIKV control.

Virucidal Profile

To assess C. racemosa alga isolated compound that has a direct effect on the infectivity of CHIKV, approximately 200 plaque forming units of the viruses were incubated at 37°C in DMEM containing concentration of 5 µg/mL. As a control, the same amount of virus was incubated in DMEM containing 1% DMSO and the same procedure was performed for ribavirin. The remaining virus titer obtained after each treatment was determined by plaque assay on vero cells as described above.

Time of Drug Addition

To determine which stage of the viral life cycle was affected by the drug, the effects of treatment at different times were evaluated. Monolayers of vero cells were grown in 24-well plates as previously described and were infected with CHIKV at an MOI of 0.1 at time 0. Cells were treated with compound caulerpin to a final concentration of 5 µM per 0, 1, 2, 4, 6, 8, 12, and 16 hours. After incubation for further 12 hours, the culture supernatants were collected and the cells were topped with 3% carboxymethylcellulose in culture medium. After 72 hours of incubation at 37°C, the cells were fixed with 20% formaldehyde for 2 hours and stained with crystal violet for 5 minutes. Plates formed after each treatment were counted and titer calculated.

RNA Detection by RT-qPCR and Virus Sequence

RNA from samples presenting cytopathic effect was extracted using the commercial kit QIAamp viral RNA mini (QIAGEN, Valencia, CA, United States) according to the manufacturer’s instructions. Isolation was confirmed by reverse transcription real-time PCR (RT-PCR) using primers targeting the structural polyprotein (Forward TATCCTGACCATCCGACCCT/reverse GGCTCTTGTCCTTGCACTCT) and Superscript III One-Step RT PCR Kit (Invitrogen Carlsbad, CA, United States), according to the manufacturer’s instructions. Amplification was performed in the PeqStar (PeqLab, Erlangen, Germany). PCR conditions were as follows: 60°C for 1 minute, 50°C for 45 minutes, 94°C for 2 minutes followed by 45 cycles of 95°C for 15 seconds, 55°C for 30 seconds, and 68°C for 60 seconds. The resulting amplicons were sequenced in the ABI 3730 genetic analyzer (Applied Biosystems) following the manufacturer’s protocol. Raw sequence data were aligned, edited, and assembled using the Assembler tool Bioedit Sequence Aligner Editor. The identity was confirmed by using the Basic Local Alignment Search Tool (Blast) and compared to other CHIKV sequences. Phylogenetic tree was constructed using MEGA 7 program.

Footnotes

Acknowledgments

The authors are grateful to CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico) for Productivity Fellowships to VTL (443930/2014-7 and 04070/2014-9) and ICNPP (443911/2004 and 44021/2018). VTL (E-26/201.442/2014) and ICNPP (E18/2015) also thank FAPERJ (Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro). CCCS thanks CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior) for a Postdoc fellowship, and CSB thanks FAPERJ for a Postdoc fellowship (E-26/201.344/2016). MWLG, RG, COM, CJBR, and MM thank CAPES scholarships obtained during graduate school.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico).

References

Teixeira

VL.

Kelecom

Gottlieb

. Produtos naturais de algas marinhas. Quim Nova. 1991;14:83-90.

Cirne-Santos

CC.

Souza

TML.

Teixeira

et al. The dolabellane diterpene Dolabelladienetriol is a typical noncompetitive inhibitor of HIV-1 reverse transcriptase enzyme. Antiviral Res. 2008;77(1):64-71.doi:10.1016/j.antiviral.2007.08.006

de Souza Barros

Cirne-Santos

CC.

Garrido

et al. Anti-Hiv-1 activity of compounds derived from marine alga Canistrocarpus cervicornis. J Appl Phycol. 2016;28(4):2523-2527.doi:10.1007/s10811-015-0776-1

de Souza Barros

Teixeira

VL.

Paixão

ICNP.

Barros

deS

. Seaweeds with anti-herpes simplex virus type 1 activity. J Appl Phycol. 2015;27(4):1623-1637.doi:10.1007/s10811-014-0447-7

Soares

AR.

Robaina

MCS.

Mendes

et al. Antiviral activity of extracts from Brazilian seaweeds against herpes simplex virus. Rev Bras Farmacogn. 2012;22(4):714-723.doi:10.1590/S0102-695X2012005000061

Macedo

NRPV.

Ribeiro

MS.

Villaça

et al. Caulerpin as a potential antiviral drug against herpes simplex virus type 1. Rev Bras Farmacogn. 2012;22(4):861-867.doi:10.1590/S0102-695X2012005000072

Mendes

GdaS.

Bravin

IC.

Yoneshigue-Valentin

Yokoya

NS.

Romanos

MTV

. Anti-HSV activity of Hypnea musciformis cultured with different phytohormones. Rev Bras Farmacogn. 2012;22(4):789-794.doi:10.1590/S0102-695X2012005000054

Talarico

LB.

Duarte

ME.

Zibetti

RG.

Noseda

MD.

Damonte

. An algal-derived DL-galactan hybrid is an efficient preventing agent for in vitro dengue virus infection. Planta Med. 2007;73(14):1464-1468.doi:10.1055/s-2007-990241

Aguilar-Santos

. Caulerpin, a new red pigment from green algae of the genus Caulerpa. J Chem Soc C: Organic. 1970;6(6):842-843.doi:10.1039/j39700000842

10.

Gorbi

Giuliani

ME.

Pittura

et al. Could molecular effects of Caulerpa racemosa metabolites modulate the impact on fish populations of Diplodus sargus? Mar Environ Res. 2014;96:2-11.doi:10.1016/j.marenvres.2014.01.010

11.

Barbosa-Filho

da-Cunha

EVL.

Gray

. Alkaloids of the Menispermaceae. 2000.

12.

de Souza

ET.

de Lira

DP.

de Queiroz

AC.

De Souza

Éverton Tenório.

Pereira de Lira

Cavalcanti de Queiroz

et al. The antinociceptive and anti-inflammatory activities of caulerpin, a bisindole alkaloid isolated from seaweeds of the genus Caulerpa. Mar Drugs. 2009;7(4):689-704.doi:10.3390/md7040689

13.

Conserva

LM.

Pereira

CdeAB.

Barbosa-Filho

. Alkaloids of the Hernandiaceae: occurrence and a compilation of their biological activities. Alkaloids Chem Biol. 2005;62:175-243.

14.

de Sousa Falcão

Leite

JA.

Barbosa-Filho

et al. Gastric and duodenal antiulcer activity of alkaloids: a review. Molecules. 2008;13(12):3198-3223.doi:10.3390/molecules13123198

15.

Abbink

Larocca

RA.

De La Barrera

et al. Protective efficacy of multiple vaccine platforms against Zika virus challenge in rhesus monkeys. Science (New York, N.Y.). 2016.

16.

Ayyad

S-E.

Badria

. Caulerpine: an antitumor indole alkaloid from Caulerpa racemosa. Alexandria J Pharm Sci. 1994;8:217-217.

17.

. The separation, identification and bioassay of caulerpin. Zhongshan Daxue Xuebao Ziran Kexueban. 1996;35:64-66.

18.

Raub

MF.

Cardellina

JH.

Schwede

. The green algal pigment caulerpin as a plant growth regulator. Phytochemistry. 1987;26(3):619-620.doi:10.1016/S0031-9422(00)84752-4

19.

Thangam

TS.

Kathiresan

. Note: Repellency of marine plant extracts against the Mosquito Aedes aegypti . Int J Pharmacogn. 1993;31(4):321-323.doi:10.3109/13880209309082961

20.

Vega-Rúa

Zouache

Girod

Failloux

A-B.

Lourenço-de-Oliveira

. High level of vector competence of Aedes aegypti and Aedes albopictus from ten American countries as a crucial factor in the spread of Chikungunya virus. J Virol. 2014;88(11):6294-6306.doi:10.1128/JVI.00370-14

21.

Robinson

. An epidemic of virus disease in southern Province, Tanganyika Territory, in 1952–1953. Trans R Soc Trop Med Hyg. 1955;49(1):28-32.doi:10.1016/0035-9203(55)90080-8

22.

Nunes

MRT.

Faria

NR.

de Vasconcelos

et al. Emergence and potential for spread of Chikungunya virus in Brazil. BMC Med. 2015;13(1):102.doi:10.1186/s12916-015-0348-x

23.

de Vigilância em Saúde

da Saúde

. Monitoramento DOS casos de dengue, febre de Chikungunya E febre pelo vírus Zika até a Semana Epidemiológica 52, 2016. Bol Epidemiol. 2017;48(5):1-9.

24.

Anjaneyulu

ASR.

Prakash

CVS.

Mallavadhani

. Two caulerpin analogues and a sesquiterpene from Caulerpa racemosa. Phytochemistry. 1991;30(9):3041-3042.doi:10.1016/S0031-9422(00)98248-7

25.

Anjaneyulu

ASR.

Prakash

CVS.

Raju

KVS.

Mallavadhani

. Isolation of new aromatic derivatives from a marine algal species Caulerpa racemosa. J Nat Prod. 1992;55(4):496-499.doi:10.1021/np50082a016

26.

Cirne-Santos

Barros

CDS.

Cesar Richter Nogueira

et al. Inhibition of Zika Virus by Marine Algae. Preprints 2017, 2017030087.

27.

Musso

Nilles

EJ.

Cao-Lormeau

V-M

. Rapid spread of emerging Zika virus in the Pacific area. Clin Microbiol Infect. 2014;20(10):O595-O596.doi:10.1111/1469-0691.12707

28.

Singh

Mudgal

Narwal

et al. Chikungunya virus inhibition by peptidomimetic inhibitors targeting virus-specific cysteine protease. Biochimie. 2018;149:51-61.doi:10.1016/j.biochi.2018.04.004

29.

J-W.

Hsieh

P-S.

Lin

C-C

et al. Synergistic effects of combination treatment using EGCG and suramin against the Chikungunya virus. Biochem Biophys Res Commun. 2017;491(3):595-602.doi:10.1016/j.bbrc.2017.07.157

30.

Snyder

Goebel

Koide

Ptak

Kalkeri

. Synergistic antiviral activity of sofosbuvir and type-I interferons (α and β) against Zika virus. J Med Virol. 2018;90(1):8-12.doi:10.1002/jmv.24932

31.

Hirayama

Shibata

Imamura

Sakaguchi

Hori

. High-Mannose specific lectin and its recombinants from a Carrageenophyta Kappaphycus alvarezii represent a potent anti-HIV activity through high-affinity binding to the viral envelope glycoprotein gp120. Mar Biotechnol. 2016;18(1):144-160.doi:10.1007/s10126-015-9677-1

Antiviral Effect of Caulerpin Against Chikungunya

Abstract

Keywords

Determination of the Virucidal Activity of the Compound

Time of Addition Assay

Experimental

Algae Extraction and Isolation

Cytotoxicity Assay

Antiviral Assay

Virucidal Profile

Time of Drug Addition

RNA Detection by RT-qPCR and Virus Sequence

Footnotes

Acknowledgments

Declaration of Conflicting Interests

Funding

References