Sage Journals: Discover world-class research

Abstract

Cystic fibrosis (CF) is an autosomal recessive disease caused by the inheritance of two mutant cystic fibrosis transmembrane conductance regulator (CFTR) alleles, one from each parent. Autosomal recessive disorders are rarely associated with germline mutations or mosaicism. Here, we propose a case of paternal germline mutation causing CF. The subject also had an identifiable maternal mutant allele. We identified the compound heterozygous variants in the proband through Sanger sequencing, and in silico studies predicted functional effects on the protein. Also, short tandem repeat markers revealed the de novo nature of the mutation. The maternal mutation in the CFTR gene was c.1000C > T. The de novo mutation was c.178G > A, p.Glu60Lys. This mutation is located in the lasso motif of the CFTR protein and, according to in silico structural analysis, disrupts the interaction of the lasso motif and R-domain, thus influencing protein function. This first reported case of de novo mutation in Asia has notable implications for molecular diagnostics, genetic counseling, and understanding the genetic etiology of recessive disorders in the Iranian population.

Plain language summary

Identifying the first de novo mutation in the cystic fibrosis transmembrane conductance regulator protein in Iran: a case report with insights from microsatellite markers

A child can develop Cystic Fibrosis (CF) if both parents pass on mutated genes. In some rare cases, new genetic mutations occur spontaneously, causing CF. This report discusses a unique case where a child has one gene with a spontaneous mutation and inherits another gene mutation from the mother. We used a method called Sanger sequencing to find the two different gene changes in the affected person. We also used computer analysis to predict how these changes might affect the protein responsible for this genetic disease. To confirm that the child's new change is not inherited, we used a type of genetic marker called microsatellite markers. The mutation inherited from the mother and the new spontaneous mutation resulted in a unique change in the responsible protein. This mutation is located in a specific part of the protein called the lasso motif. Our computer simulations show that this mutation disrupts the interaction between the lasso motif and another part of the protein called the R-domain, which ultimately affects the protein's function. This case is significant because it is the first reported instance of a de novo mutation causing CF in Asia. It has important implications for genetic testing, counseling, and understanding how recessive genetic disorders like CF occur within the Iranian population.

Keywords

autosomal recessive disorder case report CFTR mutation cystic fibrosis genetic counseling microsatellite marker pediatric diagnosis pulmonary disease

Introduction

Cystic fibrosis transmembrane conductance regulator (CFTR) is a unique ATP-binding cassette transporter that functions as an ion channel. CFTR consists of 5 domains and 1480 amino acids.¹ Mutations in the CFTR gene are associated with severe pathophysiological conditions in the lungs and pancreatic ducts, leading to cystic fibrosis (CF).² This is one of the most common hereditary diseases among Caucasian populations. Therefore, a precise genetic diagnosis is crucial.^3,4

Over 2000 CFTR genetic variants are known,⁵ with about 350 causing CF.⁶ The ΔF508 mutation is the most common, while other pathogenic variants are typically infrequent.⁷ Inherited CFTR mutations have been the primary focus of genetic studies in recent decades. De novo mutations in CFTR are sporadic, like other autosomal recessive disorders, and have received limited attention.⁸ Germline de novo mutations occur approximately 1.0–1.5 × 10⁻⁸ per nucleotide and per generation.⁹ A balanced interplay between premutagenic mutations and DNA repair mechanisms results in this low frequency.¹⁰ As a result, only a few reports of de novo mutations in the CFTR gene have been published, with only 10 identified so far.^11–17

De novo mutations can arise in parental germline cells or during the early stages of embryonic development in the offspring.¹⁸ Recently, the fitness of mutated premeiotic testis cells, referred to as “selfish spermatogonial selection,” has garnered attention.^19–21 As a result, there is growing interest in assessing the likelihood of de novo mutations in spermatogonia using sperm sample analysis. However, this is only feasible in cases where such a sample is available. Haplotype analysis offers the unique opportunity to verify the presence and identify the origin of de novo mutations without the need for sperm samples.^22,23

Here, we investigated a family in which the child carried a CF mutation not present in the father (c.178G > A, p.Glu60Lys). Our evidence suggests a paternal germline mutation through the application of phenotypic observations, genetic analysis, and homozygosity mapping of the patient.

Case

Clinical presentation

The proband is a 3-year-old male diagnosed with CF at 2.5 months [Figure 1(a)]. He demonstrated typical CF symptoms such as recurrent coughing and greasy stools with a positive sweat test (first test: Na: 78, Cl: 80; second test: Na: 68, Cl: 70). He also experienced respiratory complications and multiple hospitalizations before the age of 5 months. The developmental patterns were within the expected range, and the patient was regularly examined every 3 months. The high-resolution computed tomography scan of the chest revealed diffuse mosaic attenuation, mild bronchiectasis, and diffuse peribronchial thickening. A potential exacerbation of CF was observed through bronchioles, mucous plugs, and atelectasis in the right upper lobe and inferior lingular segment. The presence of prominent bilateral pulmonary arteries raises the possibility of pulmonary hypertension.

Figure 1.

Pedigree and genetic analysis of the studied family. (a) Pedigree and linkage analysis: The pedigree of the family under study is presented, highlighting the relationships between individuals. Sanger sequencing was performed to identify the presence of mutations. Individuals II1 and I2 were found to share the same mutation, as indicated. The linkage analysis also revealed similar haplotypes based on STR markers, represented by corresponding colors. The numbers denote the base pair size of the STR markers, with each marker size ending in the respective digit. The relative location of the c.1408 A > G SNP is shown. (b) The results of Sanger sequencing for the father, mother, and proband were analyzed using the Chromas program. On the left, the Sanger sequencing result of the proband and his father were compared, and it was observed that his father does not carry the c.178 G > A mutation. On the right, the Sanger sequencing result of the proband and his mother were compared, and it was found that both carry the c.1000 C > T mutation.

Since the CF diagnosis, he has regularly consumed pancrelipase delayed-release capsules (250–500 daily units depending on the gastrointestinal health, CREON, Abbott GmbH, Hanover, Germany). Omeprazole (20 mg/day) and Salbutamol (2 × 100 µg/day, air puffs) were prescribed to prevent gastrointestinal and respiratory complications. Additionally, Vitamin E was used as an antioxidant to prevent fatty liver, and daily respiratory physiotherapy and nebulizer treatment (7% NaCl solution w/v) were administered.

The proband’s father and mother were 39 and 34 years old at the time of examination. The mother was 7-month pregnant with the next child at the referral time to our center for a prenatal diagnosis. Both parents are Iranians, unrelated, and they have no previous genetic tests. In this study, we followed the CARE reporting guidelines to ensure accurate and transparent reporting.²⁴

Genotyping

Genomic DNA was extracted from blood sample and chorionic villus sampling using the salting-out method.²⁵ In the proband and all family members, the CFTR gene was amplified. Primers were designed to amplify all CFTR gene exons and 200 bp flanking regions. The amplicons were purified using the KBC DNA Pure DNA extraction kit (Kawsar Biotech Co., Tehran, Iran). The BigDye Terminator Cycle sequencing kit (Thermo Fisher Scientific, Foster City, CA, USA, TF) was employed for amplicon sequencing, and a 3130/XL Genetic Analyzer (TF) was utilized for analysis. Bioinformatic tools, including Mutation Taster,²⁶ Polyphen-2,²⁷ CADD,²⁸ FATHMM,²⁹ SIFT,³⁰ and PROVEAN,³¹ were employed to investigate variant pathogenicity. The 3D structure of the protein was analyzed by modeling in the UCSF ChimeraX software package (version 1.3).³² Genomic DNA sequencing revealed two mutations in the CFTR gene of the proband that result in a genotype of c.178 G > A/c.1000 C > T. The mother (family member I-2) was heterozygous for the c.1000C > T mutation, while the 7-month-old fetus had two normal CFTR alleles, as depicted in Figure 1(a). Surprisingly, the paternal genotype (family member I-1) appeared normal based on the same sequencing data [Figure 1(b)]. To ensure that the polymerase chain reaction (PCR) conditions were the cause of a missed mutation, we attempted multiple conditions for family member I-1 [Figure 1(a)], such as altering the annealing temperature (Table 1) and location of the sequencing primers. However, the paternal genotype remains normal. Based on the sequencing data, family members I-1, II-1, and II-2 were also heterozygous for the c.1408 A > G polymorphism.

Table 1.

Different PCR conditions and primers for exon 3 of CFTR gene.

Conditions	Annealing (1 min)	Forward primer	Reverse primer
Condition 1	62	GTTTGGTGTTGTATGGTCTCC	ATTGCCACCCGTGTTCCAG
Condition 2	60	ACAGTGATATATGGCAGAGC	AGGCACCAGTAATCTCATG
Condition 3	58	CTTGGGTTAATCTCCTTGG	TGGTTTCTTAGTGTTTGGAG

CFTR, cystic fibrosis transmembrane conductance regulator.

Haplotype analysis and paternity testing

Paternity testing was performed using the IR-filer PCR amplification kit following the manufacturer’s protocol (Kawsar Biotech Co., Tehran, Iran). Haplotype analysis was conducted using the GT Hapscreen CFTR kit (GENETEK Biopharma GmbH, Berlin, Germany). The fragment analysis was also performed on an ABI 3130/XL Genetic Analyzer (ThermoFisher Scientific, Foster City, CA, United States), and the haplotypes were visualized. We also confirmed the paternity by evaluating 17 distinctive DNA markers (Supplemental File 1), including linked short tandem repeat (STR) markers to the CFTR gene.

Given the confirmed paternity and the lack of c. 178 G > A mutation in either parent, we suggest that this is de novo mutation in the affected child.

Discussion

This study describes the result of a comprehensive genetic analysis in a family with cystic fibrosis (CF). We demonstrated that the affected child carried two mutations in the CFTR gene, with one inherited from the mother. The second mutant allele, c.178 G > A, could not be identified in the father’s genome. Our findings indicated that the c.178 Gs > A, p. Glu60Lys mutation is generated de novo. We propose below that the allele variant stems most likely from a mutation in the spermatogonial cells as compared to germline mosaicism. Notably, this study represents the first report of a de novo mutation occurring in the N-terminal lasso motif of the CFTR protein. To our knowledge, this is the first reported de novo CFTR mutation in Asia.

The affected child presented positive sweat test results and manifested typical CF symptoms, an autosomal recessive genetic disorder. He had the c.1000 C > T, p. Arg334Trp, mutation from his maternally inherited chromosome, as indicated by its presence in the mother’s genome. Gasperini et al.³³ reported c.1000 C > T, R334W mutation for the first time (in a Spanish patient with lung and pancreatic involvement), and it has been reported as a common variant in Iran.³⁴ Also, a phenotype/genotype investigation of 16 CF patients with R334W demonstrated that symptoms caused by R334W tend to be less severe than those caused by F508 deletion.³⁵

In addition to R334W, our subject had a missense de novo mutation, c.178 G > A. Our first aim was to understand its impact on the structure of the protein. Currently, there is no report on the clinical symptoms of patients with the p. Glu60Lys mutation in the literature where a glutamic acid is altered in the CFTR protein’s N-terminal of the lasso motif (Figure 2). However, based on cftr2³⁶ and the SickKids³⁷ database, p. Glu60Lys leads to impaired lung function and has been reported in both pancreatic-sufficient and pancreatic-insufficient patients. These phenotypes are consistent with the symptoms of our subject.

Figure 2.

In silico structural analysis of the de novo variant. (a) CFTR exons and protein landscape: The drawing depicts the CFTR exons and protein structure, highlighting the regional tolerance or intolerance to missense or synonymous variation as determined by MetaDome analysis. Known de novo CFTR variants are indicated, while the position of the c.178G > A mutation is highlighted in red. Different colors represent specific protein domains with corresponding exon colors. Gray areas represent protein regions where the domain border is undefined. (b) Structural model of human CFTR protein: A structural model of the human CFTR protein (PDB: 6MSM) is presented, providing a visual representation of its three-dimensional structure. (c) Predicted effects of E60K mutation: On the right and top, the Glutamic acid residue (Glu60) is shown, indicating the presence of a hydrogen bond (dashed lines) between Glu60 and Arg75. The substituted Lysine residue (Lys60) is demonstrated on the right and bottom, illustrating the absence of a hydrogen bond between Lys60 and Arg75. These visualizations show the predicted impact of the E60K mutation.

Several studies have reported patients with the homozygote R334W genotype,^38–40 while the E60K mutation has only been reported in compound heterozygote forms.^41–43 To investigate the effects of E60K mutation on the CFTR protein, Gene et al. expressed this variant in the HEK 293 cell line and conducted functional studies. They reported that the E60K mutation results in a misfolded CFTR protein that undergoes degradation in the cytoplasm, similar to the more common F508del deletion variant.⁴⁴ Glutamic acid at position 60 is the endpoint of a highly conserved amino acid sequence involved in PKA-dependent channel gating through interaction with the R-domain.^45,46 The substitution of glutamic acid for lysine likely disrupts this interaction and impairs the protein function. Substitution of a negative charge (glutamic acid) for the positive (lysine) might also cause repulsion among the protein core residues.

Additionally, glutamic acid at position 60 forms a hydrogen bond with arginine at position 75. The larger size of the mutant lysine may impact the positioning of this residue, which would need a new hydrogen bond partner [Figure 2(b)]. The larger mutant residue also likely affects the structure by disrupting the proper folding of the protein core.

The affected child in our study was the only carrier of this mutation in the whole family. Interestingly, his father’s genome did not carry these mutations. We investigated three possibilities of nonpaternity: allele dropout during PCR, or a de novo mutation. First, the paternal relationship was confirmed through haplotype analysis, confirming family member 1-I was, in fact, the biological father (data not shown). To rule out allelic dropout, we modified PCR conditions and designed new primers. Sequencing the amplified DNA from the father yielded no mutations in the CFTR gene, eliminating allelic dropout as a potential explanation. Given the three possible hypotheses, we conclude that the mutation is de novo.

Geneticists have long been interested in investigating the features and prevalence of de novo mutations. These mutations are typically inherited from the paternal lineage with increased likelihood in older fathers.^47,48 Some genomic regions are more susceptible to mutation, and several factors influence mutation rates, such as replication timing and local base pair combinations.⁴⁹ The c.178 G > A is located in the third exon of the CFTR gene; also, another nonsense mutation, c.178 G > T, is reported in the same position.⁴⁸ The region spanning cDNA nucleotides 166–182 harbors ten mutations. The high number of mutations in this region and an increased likelihood of a de novo C: G > T: A transition in non-CpG sites might explain the nucleotide alteration at this position.⁵⁰

We found the c.1408 heterozygous polymorphism in the affected child, father, and fetus, which we used as a complementary marker for homozygosity mapping and mosaicism analysis. STR markers revealed a crossover in the paternally inherited chromosome of the fetus [see Figure 1(A)]. Since the fetus inherited the closely linked c.1408 A > G polymorphism to the c.178 position, our subject likely inherited the same allele from the father, which supports the hypothesis of a de novo germline mutation. Therefore, we can conclude that this is most probably a de novo mutation originating during spermatogenesis and not gonadal mosaicism. Nevertheless, gonadal mosaicism can only be ruled out by either having another child or obtaining gonadal cells like sperm from the father. Unfortunately, neither was possible since the family did not have any other child, and the father did not agree to give sperm due to religious reasons. It is also possible that the de novo mutation appeared during the early stages of embryonic development.

Conclusion

We investigated a family with a cystic fibrosis patient and discovered the first reported de novo mutation in the N-tail lasso motif of CFTR and the first identified de novo CFTR mutation in Asia. This study highlights that STR markers can play an essential role in determining the developmental origin of the mutated chromosome. Moreover, these findings have significant implications for genetic counseling and prenatal diagnosis. It provides evidence that de novo mutations in cystic fibrosis and other autosomal recessive disorders may be more prevalent than expected, as demonstrated in Spinal Muscular Atrophy (SMA) patients previously.⁵¹ Thus, it is possible, through de novo mutations, to have an affected child with only one parent carrying a single recessive allele. However, it is also crucial to rule out confounders such as paternity and PCR allele drop-out and not to assume that every mutation is de novo.

Supplemental Material

sj-docx-1-tar-10.1177_17534666241253990 – Supplemental material for Identification and in silico structural analysis for the first de novo mutation in the cystic fibrosis transmembrane conductance regulator protein in Iran: case report and developmental insight using microsatellite markers

Supplemental material, sj-docx-1-tar-10.1177_17534666241253990 for Identification and in silico structural analysis for the first de novo mutation in the cystic fibrosis transmembrane conductance regulator protein in Iran: case report and developmental insight using microsatellite markers by Amin Hosseini Nami, Mahboubeh Kabiri, Fatemeh Zafarghandi Motlagh, Tina Shirzadeh, Hamideh Bagherian, Razie Zeinali, Ali Karimi and Sirous Zeinali in Therapeutic Advances in Respiratory Disease

Supplemental Material

sj-jpg-2-tar-10.1177_17534666241253990 – Supplemental material for Identification and in silico structural analysis for the first de novo mutation in the cystic fibrosis transmembrane conductance regulator protein in Iran: case report and developmental insight using microsatellite markers

Supplemental material, sj-jpg-2-tar-10.1177_17534666241253990 for Identification and in silico structural analysis for the first de novo mutation in the cystic fibrosis transmembrane conductance regulator protein in Iran: case report and developmental insight using microsatellite markers by Amin Hosseini Nami, Mahboubeh Kabiri, Fatemeh Zafarghandi Motlagh, Tina Shirzadeh, Hamideh Bagherian, Razie Zeinali, Ali Karimi and Sirous Zeinali in Therapeutic Advances in Respiratory Disease

Footnotes

Acknowledgements

We gratefully acknowledge Dr. Ali Shakerizadeh from Johns Hopkins University School of Medicine for his valuable revisions and feedback on this manuscript.

Declarations

ORCID iD

Amin Hosseini Nami

Supplemental material

Supplemental material for this article is available online.

References

Hanssens

Duchateau

Casimir

GJ.

CFTR protein: not just a chloride channel?

Cells 2021; 10: 2844.

Cutting

GR.

Cystic fibrosis genetics: from molecular understanding to clinical application. Nat Rev Genet 2015; 16: 45–56.

O'Sullivan

Freedman

. Cystic fibrosis. Lancet 2009; 373: 1891–1904.

Castellani

Assael

BM.

Cystic fibrosis: a clinical view. Cell Mol Life Sci 2017; 74: 129–140.

Bell

Mall

Gutierrez

, et al. The future of cystic fibrosis care: a global perspective. Lancet Respir Med 2020; 8: 65–124.

Salvatore

Terlizzi

Francalanci

, et al. Ivacaftor improves lung disease in patients with advanced CF carrying CFTR mutations that confer residual function. Respir Med 2020; 171: 106073.

Ziȩtkiewicz

Rutkiewicz

Pogorzelski

, et al. CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients. PLoS One 2014; 9: e89094.

Black

Parry

Atanur

, et al. De novo mutations in autosomal recessive congenital malformations. Genet Med 2016; 18: 1325–1326.

Rahbari

Wuster

Lindsay

, et al. Timing, rates and spectra of human germline mutation. Nat Genet 2016; 48: 126–133.

10.

Acuna-Hidalgo

Veltman

Hoischen

New insights into the generation and role of de novo mutations in health and disease. Genome Biol 2016; 17: 241.

11.

Martínez-Hernández

Larrosa

Barajas-Olmos

, et al. Next-generation sequencing for identifying a novel/de novo pathogenic variant in a Mexican patient with cystic fibrosis: a case report. BMC Med Genom 2019; 12: 68.

12.

White

Leppert

Nielsen

, et al. A de novo cystic fibrosis mutation: CGA (Arg) to TGA (stop) at codon 851 of the CFTR gene. Genomics 1991; 11: 778–779.

13.

Cremonesi

Cainarca

Rossi

, et al. Detection of a de novo R1066H mutation in an Italian patient affected by cystic fibrosis. Hum Genet 1996; 98: 119–121.

14.

Casals

Ramos

Giménez

, et al. Paternal origin of a de novo novel CFTR mutation (L1065R) causing cystic fibrosis. Hum Mutat 1998; Suppl 1: S99–S102.

15.

Křenková

Piskáčková

Holubová

, et al. Distribution of CFTR mutations in the Czech population: positive impact of integrated clinical and laboratory expertise, detection of novel/de novo alleles and relevance for related/derived populations. J Cyst Fibros 2013; 12: 532-537.

16.

Girodon

Medina

Grenet

, et al. Occurrence of CFTR de novo mutations is not so rare. J Cyst Fibr 2008: S6–S6.

17.

Norek

Stremska

Sobczyńska-Tomaszewska

, et al. Novel de novo large deletion in cystic fibrosis transmembrane conductance regulator gene results in a severe cystic fibrosis phenotype. J Pediatr 2011; 159: 343–346.e341.

18.

Goldmann

Veltman

Gilissen

De novo mutations reflect development and aging of the human germline. Trends Genet 2019; 35: 828–839.

19.

Goriely

McGrath

Hultman

, et al. “Selfish spermatogonial selection”: a novel mechanism for the association between advanced paternal age and neurodevelopmental disorders. Am J Psychiatry 2013; 170: 599–608.

20.

Goriely

Wilkie

AO.

Paternal age effect mutations and selfish spermatogonial selection: causes and consequences for human disease. Am J Hum Genet 2012; 90: 175–200.

21.

Maher

Ralph

Ding

, et al. Selfish mutations dysregulating RAS-MAPK signaling are pervasive in aged human testes. Genome Res 2018; 28: 1779–1790.

22.

Martincorena

Gerstung

, et al. Somatic mutations reveal asymmetric cellular dynamics in the early human embryo. Nature 2017; 543: 714–718.

23.

Freed

Pevsner

The Contribution of mosaic variants to autism spectrum disorder. PLoS Genet 2016; 12: e1006245.

24.

Gagnier

Kienle

Altman

, et al. The CARE guidelines: consensus-based clinical case reporting guideline development. Glob Adv Health Med 2013; 2: 38–43.

25.

Miller

Dykes

Polesky

HF.

A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988; 16: 1215.

26.

Schwarz

Cooper

Schuelke

, et al. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods 2014; 11: 361–362.

27.

Adzhubei

Schmidt

Peshkin

, et al. A method and server for predicting damaging missense mutations. Nat Methods 2010; 7: 248–249.

28.

Kircher

Witten

Jain

, et al. A general framework for estimating the relative pathogenicity of human genetic variants. Nat Genet 2014; 46: 310-315.

29.

Shihab

Gough

Cooper

, et al. Predicting the functional, molecular, and phenotypic consequences of amino acid substitutions using hidden Markov models. Hum Mutat 2013; 34: 57–65.

30.

Sim

N-L

Kumar

, et al. SIFT web server: predicting effects of amino acid substitutions on proteins. Nucleic Acids Res 2012; 40: W452–W457.

31.

Choi

Chan

AP.

PROVEAN web server: a tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics 2015; 31: 2745–2747.

32.

Pettersen

Goddard

Huang

, et al. UCSF ChimeraX: Structure visualization for researchers, educators, and developers. Protein Sci 2021; 30: 70–82.

33.

Gasparini

Nunes

Savoia

, et al. The search for south European cystic fibrosis mutations: identification of two new mutations, four variants, and intronic sequences. Genomics 1991; 10: 193–200.

34.

Alibakhshi

Kianishirazi

Cassiman

, et al. Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations. J Cyst Fibros 2008; 7: 102–109.

35.

Estivill

Ortigosa

Pérez-Frias

, et al. Clinical characteristics of 16 cystic fibrosis patients with the missense mutation R334W, a pancreatic insufficiency mutation with variable age of onset and interfamilial clinical differences. Hum Genet 1995; 95: 331–336.

36.

Clinical and Functional TRanslation (CFTR), https://cftr2.org/ (accessed 01 September 2023).

37.

Cystic Fibrosis Mutation Database (CFTR1), http://www.genet.sickkids.on.ca/ (accessed 01 September 2023).

38.

Moura Cabral

Oliveira Pereira

Gonçalves

, et al. Cystic fibrosis: clinical profile of 10 patients with R334W mutation compared to ?F508 homozigoty. Eur Respir J 2020; 56: 2766.

39.

Pereira

Ribeiro

, et al. Novel, rare and common pathogenic variants in the CFTR gene screened by high-throughput sequencing technology and predicted by in silico tools. Sci Rep 2019; 9: 6234.

40.

Grangeia

Sá

Carvalho

, et al. Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens. Genet Med 2007; 9: 163–172.

41.

Alonso

Heine-Suñer

Calvo

, et al. Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry. Ann Hum Genet 2007; 71: 194–201.

42.

Fichou

Génin

Le Maréchal

, et al. Estimating the age of CFTR mutations predominantly found in Brittany (Western France). J Cyst Fibros 2008; 7: 168–173. 20070906.

43.

Ramalho

Lewandowska

Farinha

, et al. Deletion of CFTR translation start site reveals functional isoforms of the protein in CF patients. Cell Physiol Biochem 2009; 24: 335–346.

44.

Gené

Llobet

Larriba

, et al. N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel. Hum Mutat 2008; 29: 738–749.

45.

Chappe

Irvine

Liao

, et al. Phosphorylation of CFTR by PKA promotes binding of the regulatory domain. Embo J 2005; 24: 2730–2740.

46.

Naren

Cormet-Boyaka

, et al. CFTR chloride channel regulation by an interdomain interaction. Science 1999; 286: 544–548.

47.

Campbell

Eichler

EE.

Properties and rates of germline mutations in humans. Trends Genet 2013; 29: 575–584.

48.

Shendure

Akey

JM.

The origins, determinants, and consequences of human mutations. Science 2015; 349: 1478–1483.

49.

Hodgkinson

Eyre-Walker

Variation in the mutation rate across mammalian genomes. Nat Rev Genet 2011; 12: 756–766.

50.

Francioli

Polak

Koren

, et al. Genome-wide patterns and properties of de novo mutations in humans. Nat Genet 2015; 47: 822–826.

51.

Wirth

Schmidt

Hahnen

, et al. De novo rearrangements found in 2% of index patients with spinal muscular atrophy: mutational mechanisms, parental origin, mutation rate, and implications for genetic counseling. Am J Hum Genet 1997; 61: 1102–1111.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.01 MB

0.89 MB