Bradykinin B2 receptor triggers ITPR1-Mediated ER calcium release in trigeminal ganglion neurons to drive trigeminal neuropathic pain

Abstract

Objective

To elucidate the role and underlying mechanism of bradykinin (BK) B2 receptor and its downstream inositol 1,4,5-trisphosphate receptor type 1 (ITPR1)-mediated endoplasmic reticulum (ER) calcium release signaling in the development and maintenance of trigeminal neuropathic pain.

Methods

A partial infraorbital nerve transection (pIONT) mouse model of trigeminal neuralgia was employed. Mechanical allodynia was assessed using von Frey filaments. The expression and localization of BK, B2 receptor, and related molecules in the trigeminal ganglion (TG) were analyzed by quantitative real-time PCR (qPCR), Western blot, and immunofluorescence staining. Whole-cell patch-clamp recordings were performed to evaluate TG neuronal excitability. Intracellular calcium signals induced by BK were monitored through Fluo-4 AM calcium imaging. Pharmacological and genetic interventions were conducted via local TG injection of B2 receptor antagonist Icatibant, ITPR1 inhibitor 2-APB, and Itpr1-siRNA.

Results

pIONT induced persistent facial mechanical allodynia in mice, accompanied by a significant upregulation of BK mRNA and B2 receptor expression in the TG, which was primarily localized to myelinated neurons (NF200+), peptidergic neurons (CGRP+), and non-peptidergic neurons (IB4+). Local injection of Icatibant into the TG significantly alleviated mechanical nociceptive responses and reduced the hyperexcitability of nociceptive neurons. Calcium imaging showed that BK evoked ITPR1-dependent ER calcium release in TG neurons, which was abolished by both 2-APB and Itpr1-siRNA. Co-application of 2-APB also reversed BK-induced neuronal hyperexcitability and attenuated facial withdrawal responses.

Conclusion

Following peripheral nerve injury, the B2 receptor-ITPR1 signaling mediated ER calcium release represents an essential mechanism underlying the development and maintenance of trigeminal neuropathic pain. Targeting this signaling pathway effectively attenuates peripheral neuronal hyperexcitability, providing novel experimental evidence and potential therapeutic targets for the management of trigeminal neuralgia.

Introduction

Chronic neuropathic pain is a persistent pain syndrome caused by lesions or diseases of the somatosensory nervous system, clinically characterized by tactile allodynia, thermal hyperalgesia, and spontaneous pain, significantly compromising patients’ quality of life and psychological well-being.^1–3 Neuropathic pain within the trigeminal innervation territory (including trigeminal neuralgia and post-traumatic or iatrogenic pain following maxillofacial injury) poses particular clinical challenges due to the unique anatomical organization of the trigeminal nerve and its intimate connections with cranial vasculature.^4–8 Current pharmacological treatments often suffer from limited efficacy, drug tolerance, and significant adverse effects, ⁴ with first-line agents such as carbamazepine showing high rates of acquired tolerance and surgical treatments bearing a 30-50% long-term recurrence risk. ⁹ Therefore, elucidating the peripheral sensitization mechanisms underlying trigeminal neuropathic pain is of critical importance for identifying novel therapeutic targets.^3,10

Following peripheral nerve injury, profound molecular and electrophysiological remodeling occurs in the trigeminal ganglion (TG), where the cell bodies of primary sensory neurons reside.^11,12 This peripheral remodeling manifests as abnormal hyperexcitability of sensory neurons and sensitization of nociceptors, thereby establishing and maintaining a persistent pain state.^3,10 Throughout this process, multiple endogenous algogenic mediators and their corresponding receptors are upregulated in the TG, including bradykinin (BK) and its B2 receptor, prostaglandin E₂ and EP receptors, ATP and P2X3 receptors, as well as proinflammatory cytokines and their receptors.^13–16 These mediators participate in the generation and amplification of pain signals by modulating neuronal excitability and synaptic transmission.

BK is a key endogenous inflammatory and nociceptive peptide released following tissue injury, inflammation, and nerve trauma.^17,18 It exerts its biological effects through two G protein-coupled receptor (GPCR) subtypes: B1 and B2 receptors. ¹⁹ The B2 receptor is constitutively expressed in primary sensory neurons and glial cells under physiological conditions, and its expression is further robustly upregulated following nerve injury; it serves as the principal mediator of BK-induced acute nociception and inflammatory hyperalgesia, whereas the B1 receptor is typically induced under inflammatory or tissue-damaging conditions. ²⁰ Emerging evidence indicates that BK-B2 receptor signaling contributes to nociceptive sensitization in various peripheral neuropathic pain models, including diabetic neuropathy and sciatic nerve ligation. ²¹ Nevertheless, systematic investigations into the expression dynamics, cell-type-specific distribution, and functional significance of BK and its receptors in trigeminal neuropathic pain remain limited.

Upon binding to the B2 receptor, BK primarily activates phospholipase C (PLC) via Gq/11 proteins, hydrolyzing phosphatidylinositol 4,5-bisphosphate (PIP₂) into inositol 1,4,5-trisphosphate (IP₃) and diacylglycerol (DAG) ²⁰ . IP₃ subsequently binds to its receptor—the IP₃ receptor (ITPR/IP₃R)—to trigger calcium release from the endoplasmic reticulum (ER), ²² resulting in a rapid increase in intracellular free calcium concentration. As a pivotal second messenger governing neuronal excitability, ²³ neurotransmitter release,^24,25 synaptic plasticity ²⁶ and gene transcription, ²⁷ aberrant intracellular calcium signaling has been implicated in numerous chronic pain states. ²⁷ ITPR1, the most widely distributed isoform of the IP₃R family in the nervous system, plays a critical role in neuronal calcium homeostasis^28–31; however, whether it mediates BK-evoked calcium signaling in TG neurons, ³² and how such ER calcium release influences neuronal excitability and pain behavior, remain to be fully elucidated.

In our study, we hypothesized that following trigeminal nerve injury, increased local BK synthesis and specific upregulation of its B2 receptor in TG neurons activate ITPR1 to mediate ER calcium store release, thereby enhancing nociceptive neuronal excitability and contributing to the initiation and maintenance of trigeminal neuropathic pain. Our study provides novel experimental evidence and potential therapeutic targets for the management of trigeminal neuralgia.

Materials and methods

Experimental animals

Male ICR mice (aged 6–8 weeks) were obtained from the Experimental Animal Center of Nantong University. All mice were housed in a standard specific pathogen-free (SPF) environment under a 12-hour light/dark cycle (lights on at 8:00 AM), with free access to food and water. All animal experimental procedures were approved by the Animal Ethics Committee of Nantong University and strictly followed the guidelines of the International Association for the Study of Pain to minimize animal suffering and the number of animals used (S20230727-010).

Establishment of trigeminal neuropathic model

A partial infraorbital nerve transection model was employed to induce orofacial neuropathic pain in mice.^33–35 The surgical procedure was performed as follows: Mice were anesthetized with isoflurane inhalation and fixed in a supine position. A 2-mm incision was made in the buccal mucosa corresponding to the left maxillary first molar, at a 45-degree angle to the midline. The tissue was bluntly dissected to fully expose the main trunk of the infraorbital nerve. The nerve was tightly ligated approximately at its midpoint using 8-0 sterile suture, and then completely transected distal to the ligation point. Following surgery, the buccal mucosal and skin incisions were closed in layers, and the surgical site was disinfected locally. Sham-operated mice underwent the same surgical exposure procedure, but the nerve was neither ligated nor transected.

Drugs and administration

Bradykinin (05-23-0500, Sigma) was dissolved in physiological saline. The B2 receptor-specific antagonist Icatibant (H157, Sigma) and the ITPR1 inhibitor 2-APB (D9754, Sigma) were prepared using physiological saline containing DMSO (0.1%). Local TG injection was employed for localized genetic manipulation or pharmacological intervention. After anesthesia, a microinjection needle (30G) was guided through the infraorbital foramen towards the trigeminal ganglion region medial to the foramen towards the TG region, and the siRNA complex or drug solution was injected slowly.

Behavioral testing

Prior to behavioral testing, mice were habituated to the experimental environment for 7 days, with 30 minutes of daily adaptation. During the habituation period, the environment was kept quiet, with temperature maintained at 20–23°C and relative humidity controlled at 50% ± 5%. To ensure the objectivity and accuracy of the test results, the experiment strictly followed the principles of randomized grouping and blind testing, with the operators unaware of the experimental group assignments.

In the experiment, von Frey filaments with force values of 0.02 g and 0.16 g were used. A randomized balanced sequential method was applied to deliver quantitative mechanical stimulation to the surgical-side (ipsilateral) infraorbital nerve-innervated area of the model mice. The stimulation site was standardized as follows: with the lateral canthus of the eye as the coordinate origin, the center region of the vibrissal pad located 5 mm posterior and 3 mm downward. During stimulation, the filament was held at a 45° angle to the cheek skin, and the force was applied and maintained for 2–3 seconds. Initially, the 0.02 g filament was applied, and the mice’s behavioral response scores were observed and recorded. For each mouse, there was a 5–6 min interval between two stimulations. Subsequently, the procedure was repeated using the 0.16 g filament. The behavioral responses of the mice were graded by intensity to quantify the severity of facial mechanical allodynia. The specific grading criteria are as follows: Score 0: No observable behavioral response; Score 1: Slight facial twitching or mild head shaking; Score 2: Rapid facial withdrawal or slight lifting of the paw; Score 3: Vigorous avoidance response accompanied by attempted face grabbing; Score 4: Vigorous avoidance response with face grabbing occurring 1–3 times; Score 5: Vigorous avoidance response with face grabbing occurring more than 3 times.

TG neuron culture

After the animals were deeply anesthetized with isoflurane, the skull base anatomical structures were exposed, and the crescent-shaped TG located within Meckel’s cave was dissected. The ganglion tissue was promptly placed in pre-chilled Hank’s balanced salt buffer. With the aid of a stereomicroscope, the surrounding connective tissue and epineurium were carefully removed. The tissue block was then transferred to enzyme digestion solution and placed in a 37°C constant-temperature shaker for continuous digestion for 40 minutes, with gentle trituration using a sterile pipette every 10 minutes to facilitate digestion.

After digestion, the cell suspension was centrifuged at 1000 rpm for 3 minutes, and the supernatant was discarded. Basal medium containing 10% fetal bovine serum was added to terminate the enzyme reaction, and the mixture was gently pipetted 5-8 times. The suspension was then filtered through a 70 μm cell strainer to remove incompletely digested tissue clumps, and the filtrate was collected to obtain a single-cell suspension. The suspension was centrifuged again under the same conditions, the supernatant was discarded, and the cell pellet was resuspended in complete medium.

The resuspended cell solution was then dripped onto coverslips pre-coated with poly-D-lysine. An appropriate amount of specialized neuron culture medium was added, and the culture was placed in a 37°C, 5% CO₂ incubator. Cells were cultured for 5 hours before being used in subsequent functional experiments.

Calcium imaging

Following the 5-hour incubation period, the neuron culture medium was removed, and cells were gently rinsed once with sterile phosphate-buffered saline to minimize non-specific fluorescence background. The Ca²⁺ fluorescent probe Fluo-4 AM (F14217, Invitrogen) was diluted at a 1:1000 ratio in fresh culture medium. This solution replaced the original medium, and cells were incubated at 37°C in the dark for 60 minutes. Following incubation, the cells were washed three times with pre-warmed PBS to thoroughly remove any residual probe from the extracellular space. The coverslip with the probe-loaded cells was then placed on the stage of an inverted fluorescence microscope. Under fluorescence imaging mode, the distribution of the fluorescent signals from the calcium ion probe within the neurons was observed. Fluorescence images at the excitation wavelength of 488 nm and emission wavelength of 520 nm were captured at 500 ms intervals using the microscope’s integrated high-sensitivity CCD camera. Experiments were conducted in a specialized chamber equipped with a multi-channel perfusion system. After baseline stabilization in calcium-free imaging buffer, neurons were sequentially exposed to various drug concentrations via the perfusion system, followed by a challenge with Ca²⁺-containing KCl solution to verify functional viability. Only KCl-responsive cells were included in the data analysis. The calcium signal intensity is expressed as the relative change in fluorescence (ΔF/F₀), calculated using the formula: ΔF/F₀ = (F_max - F₀)/F₀, where F₀ represents the average baseline fluorescence intensity and F_max represents the maximum fluorescence intensity after stimulation. ³⁶

Patch-clamp electrophysiological recording

The preparation of electrophysiological patch-clamp recordings was performed according to methods described in previous studies.^37,38 Following induction of anesthesia with isoflurane, experimental mice were rapidly decapitated, and the TGs were excised and immediately transferred to oxygen-saturated artificial cerebrospinal fluid. Subsequently, the tissue was placed in an enzymatic digestion mixture containing collagenase type I (3.54 mg/mL, Gibco, Cat# 17100017, USA) and Dispase II (1.65 mg/mL, Roche, Cat# 4942078001, Switzerland) and digested for 30 minutes in a 37°C shaking incubator to thoroughly dissociate the connective tissue. After digestion, the cell suspension was seeded onto coverslips pre-coated with 0.5 mg/mL poly-D-lysine (Gibco, Cat# A3890401, USA) and cultured in Neurobasal medium (Gibco, Cat# 10888022, USA) at 37°C with 5% CO₂.

Patch-clamp recordings were performed 6–8 hours after neuron culture at an ambient temperature of 22–24°C. Under an infrared differential interference contrast (IR-DIC) microscope (Olympus BX51WI, Japan), small TG neurons with diameters less than 25 μm were selected for recording. Recording pipettes, fabricated from borosilicate glass using a P-97 micropipette puller (Sutter Instruments, USA), had tip resistances of 4–8 MΩ when filled with pipette solution. The pipette solution contained (in mM): 140 KCl, 1 CaCl₂, 2 MgCl₂, 10 HEPES, 11 EGTA, 2 Mg-ATP, pH 7.3. The bath solution contained (in mM): 140 NaCl, 5 KCl, 2 CaCl₂, 1 MgCl₂, 10 HEPES, 10 glucose, pH 7.4. Electrophysiological signals were digitized through a 2 kHz low-pass filter at a sampling frequency of 10 kHz and recorded and analyzed using the pClamp 10 system (Axon Instruments, USA). To assess neuronal excitability, different current stimulation protocols were applied to elicit action potential firing, including: ramp current stimulation (intensity: 100, 200, 300 pA, duration: 1000 ms) and incremental square-wave current stimulation (duration: 1000 ms, intensity increased in 10 pA steps). Parameters such as action potential threshold, frequency, and overshoot amplitude were recorded and analyzed to evaluate neuronal excitability. Bradykinin (BK, 100 nM) was administered via incubation in a CO₂ incubator. ³⁹

Quantitative real-time polymerase chain reaction (qRT-PCR)

To analyze the mRNA expression levels of specific genes in TG tissues, the following experimental procedure was adopted. Total RNA was extracted from TG tissues using TRIzol reagent. One microgram (1 µg) of total RNA was reverse-transcribed to synthesize cDNA according to the manufacturer’s protocol using the HiScript® III First Strand cDNA Synthesis Kit, with Oligo(dT) as the primer. Amplification reactions were performed on a real-time quantitative PCR instrument using TB Green Premix Ex Taq II. The reaction conditions were set as follows: initial denaturation at 95°C for 30 seconds, followed by 40 cycles of amplification (95°C for 5 seconds, 60°C for 45 seconds). GAPDH was used as the reference gene, and the relative expression levels of the target genes were calculated using the 2^−ΔΔCt method. The genes detected in this study and their corresponding primer sequences are shown in Table 1. Experimental data were analyzed by comparing the Ct values of target genes with that of the reference gene Gapdh using the 2^{^−ΔΔCt} method for relative quantification to assess the expression changes of target genes in the TG.

Table 1.

The list of primer sequences designed for quantitative RT-PCR.

​	Forward primer (5′-3′)	Reverse primer (5′-3′)
Kng1	GCCAACTTCTCACAGAGCTGTAC	TGACCAAGCACCTCCTTCAGCT
Bdkrb1	TCCTGTCCTTCTTCCTTTTGC	AGATCAGAAGCTGCCAAGTTAG
Bdkrb2	AGAACATCTTTGTCCTCAGCG	CGTCTGGACCTCCTTGAACT
Gapdh	AAATGGTGAAGGTCGGTGTGAA	CAAACATCTCCACTTTGCCACTG

Western blot

TG tissues were homogenized in ice-cold lysis buffer, and supernatants were collected following centrifugation. Protein concentrations were determined using the BCA assay. Equal amounts of protein were separated by SDS-PAGE and transferred onto PVDF membranes. After blocking with 5% skimmed milk, the membranes were incubated overnight at 4°C with the following primary antibodies: Anti-B2 receptor antibody (1:1000, MCE) and anti-GAPDH antibody (1:5000, Proteintech). Subsequently, the membranes were incubated with corresponding IRDye 800CW-conjugated secondary antibodies at room temperature for 1 hour. The membranes were then scanned using an Odyssey dual-color infrared imaging system, and band intensity was quantified by grayscale analysis with ImageJ software.

Immunofluorescence staining

Immunofluorescence staining was performed according to methods described in previous studies. ¹⁵ Mice were fixed by transcardial perfusion with paraformaldehyde. The TG were then harvested, post-fixed, dehydrated, embedded in OCT compound, and sectioned into cryosections with a thickness of 15 μm. After blocking, the sections were incubated with primary antibodies at 4°C overnight, including: NF200 (mouse, 1:5000, Sigma), CGRP (goat, 1:3000, Millipore), IB4 (1:3000, Sigma), ATF3 (rabbit, 1:500, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-B2 receptor antibody (1:200). The following day, the sections were incubated with appropriate Alexa Fluor 488- or 594-conjugated secondary antibodies at room temperature in the dark for 1 hour. Images were acquired using a laser scanning confocal microscope, and fluorescence intensity analysis and cell counting were performed using ImageJ software.

Statistical analysis

All data are expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism software (version 10.2.1). The specific methods were as follows: comparisons between two groups were made using the Student's t-test; comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test; behavioral time-course data were analyzed using two-way repeated measures ANOVA with Bonferroni’s correction for post-hoc multiple comparisons. A p-value of less than 0.05 (p < 0.05) was considered statistically significant.

Results

Peripheral nerve injury induces specific upregulation of the B2 receptor in the TG

Consistent with previous reports, ⁴⁰ pIONT surgery induced persistent facial mechanical hyperalgesia from postoperative day 3 to day 21 (Figure 1(a)). Immunofluorescence staining showed that the expression of the nerve injury marker ATF3 was significantly increased in the TG neurons on postoperative day 7 in the pIONT group, confirming successful model establishment (Figure 1(b)). Quantitative analysis further confirmed that 83% of neurons were positive in the pIONT group, a percentage significantly higher than that in the sham group (Figure 1(c)). Subsequently, we examined the expression changes of BK and its receptors in the TG. qPCR results revealed that BK mRNA levels in the ipsilateral TG of pIONT mice were significantly elevated compared to those in naive mice on postoperative days 3 and 7 (Figure 1(d)). Analysis of BK receptor subtypes (B1 and B2 receptors) revealed that the mRNA levels of the BK B2 receptor were significantly upregulated on postoperative days 3, 7, and 21, peaking on day 7, whereas B1 receptor expression was significantly upregulated only on day 21, with no marked changes observed at other time points (Figure 1(e) and (f)).

Figure 1.

Bradykinin and its B2 receptor are persistently upregulated following pIONT (a) Behavioral testing (facial nocifensive scoring) revealed that pIONT model mice exhibited significant mechanical nocifensive responses on postoperative days 3, 7, and 21 (compared to sham-operated (Sham), *P < 0.05, **P < 0.01, ***P < 0.001, Two-way ANOVA followed by the Bonferroni test). (b) Immunofluorescence staining showed that the nerve injury marker ATF3 was specifically expressed in TG neurons on postoperative day 7 in the pIONT group. Scale bar: 200 μm. (c) Quantitative analysis indicates a significant increase in the proportion of ATF3-positive cells (***P<0.001, Student’s t-test). (d–f) qPCR analysis of mRNA levels in the ipsilateral TG for BK (d), B1 receptor (e), and B2 receptor (f) (compared to sham-operated groups: *P < 0.05, **P < 0.01,***P < 0.001, one-way ANOVA followed by Tukey’s post-hoc test).

Both immunofluorescence staining and Western blot analysis confirmed upregulated BK B2 receptor expression in the TG on postoperative day 7 (Figure 2(a)–(d)). Further immunofluorescence co-localization performed on pIONT 7d predominantly mapped the receptor to myelinated neurons (NF200+), while also identifying its presence on peptidergic (CGRP+) and non-peptidergic (IB4+) neuronal subsets (Figure 2(e)–(g)).

Figure 2.

B2 Receptor was predominantly expressed in TG neurons following pIONT (a) Western blot analysis shows that the protein levels of the B2 receptor in the TG were significantly upregulated after pIONT compared to the sham-operated group (Sham). (b) Quantitative analysis of BDKRB2 (normalized to GAPDH) further confirmed the significant increase in B2 receptor protein levels in the pIONT group (***P<0.001, Student’s t-test). (c) Immunofluorescence staining shows that the expression of the B2 receptor (red) in the TG was significantly increased on postoperative day 7 in the pIONT group compared to the sham-operated group (Sham 7d). Scale bar:100 μm. (d) Quantitative analysis indicates a significant increase in the proportion of B2 receptor-positive cells (**P<0.01, Student’s t-test, scale bar: 100 μm). (e–g) Immunofluorescence co-localization analysis demonstrates that the B2 receptor (red) is primarily expressed on myelinated neurons (NF200+, green, e), peptidergic neurons (CGRP+, green, f), and non-peptidergic neurons (IB4+, green, g). The bar charts on the right show the quantitative co-localization ratios of the B2 receptor with each cell marker. Scale bar:100 μm.

B2 receptor antagonism effectively alleviates neuropathic pain

To investigate the role of the BK B2 receptor in pain maintenance, we locally injected the B2 receptor-specific antagonist Icatibant or a control vehicle into the TG on postoperative days 1 and 7 following pIONT. Mechanical hypersensitivity assessments on postoperative day 1 revealed that, when stimulated with von Frey filaments of 0.02 g and 0.16 g, Icatibant intervention significantly reduced nociceptive response scores at 1 h and 3 h post-injection compared to the pIONT + vehicle control group (Figure 3(a)), with this effect persisting for up to 6 h (Figure 3(b)). Similarly, pain sensitivity testing on postoperative day 7 showed that the Icatibant-treated group exhibited significantly lower nociceptive scores at 3 h and 6 h under both stimulus intensities compared to the control group (Figure 3(c) and (d)), suggesting that early pharmacological intervention effectively alleviates acute allodynia. These results indicate that blockade of upregulated B2 receptor activity following pIONT exerts significant analgesic effects.

Figure 3.

Blocking the B2 receptor effectively alleviates pIONT-induced neuropathic pain and reverses neuronal hyperexcitability. (a–b) Local injection of Icatibant significantly alleviated mechanical allodynia on postoperative day 1 (pIONT 1d) in pIONT mice (*P < 0.05, pIONT 1d + Vehicle vs. pIONT 1d + Icatibant; Two-way ANOVA followed by the Bonferroni test). (c–d) On postoperative day 7 (pIONT 7d), mechanical allodynia was similarly attenuated by Icatibant treatment (**P < 0.01, pIONT 7d + Vehicle vs. pIONT 7d + Icatibant; two-way ANOVA followed by Bonferroni test). (e-f) Representative traces of action potentials evoked by step-current injection in TG neurons. (e) Rheobase current responses in Sham (0 pA), pIONT + Vehicle (20 pA), and pIONT + Icatibant (30 pA) neurons (Δ = 10 pA, 1000 ms). (f) Firing patterns at 100 pA in Sham, pIONT + Vehicle, and pIONT + Icatibant neurons. Scale bar: 0.2s, 20 mV. (g) pIONT reduced the rheobase of the first action potential in Vehicle-treated mice, whereas Icatibant administration preserved rheobase values comparable to sham controls (*P < 0.05, one-way ANOVA followed by Tukey’s post-hoc test). (h) pIONT increased the firing frequency elicited by step-current injection in Vehicle-treated mice, an effect abolished by Icatibant(**P < 0.01, pIONT + Vehicle vs. pIONT + Icatibant). (i) pIONT enhanced the firing frequency in response to ramp-current stimulation in vehicle-treated mice, which was prevented by Icatibant co-treatment (*P < 0.05, **P < 0.01, ***P < 0.001, pIONT + vehicle vs. pIONT + Icatibant; two-way ANOVA followed by Bonferroni test). (j) The discharge RMP of action potentials was not altered by pIONT or Icatibant treatment. (P > 0.05, pIONT + vehicle vs. pIONT + Icatibant; one-way ANOVA followed by Tukey’s post-hoc test). (K) pIONT decreased action potential half-width in vehicle-treated mice. (l-m) Neither the peak amplitude (l) nor the discharge threshold (m) of action potentials was altered by pIONT or Icatibant treatment (P > 0.05, pIONT + vehicle vs. pIONT + Icatibant; one-way ANOVA followed by Tukey’s post-hoc test).

To further investigate whether the B2 receptor modulates neuronal excitability, whole-cell patch-clamp recordings were performed on small-diameter TG neurons, which are predominantly nociceptive. Compared with the sham-operated group, small-diameter nociceptive TG neurons from pIONT model mice displayed increased excitability, as evidenced by a significantly reduced rheobase (Figure 3(e)–(h)). Pretreatment with Icatibant (100 nM) for 30 min significantly reversed this hyperexcitable state, manifesting as fewer action potentials evoked by fixed-current injection (160 pA, 1000 ms) (Figure 3(h)) and incremental ramp current stimulation (300 pA, 1000 ms) (Figure 3(i)). By contrast, resting membrane potential, half-width, action potential peak amplitude and threshold remained unchanged (Figure 3(j)–(m)). Collectively, these findings suggest that the B2 receptor antagonist exerts its analgesic effect by attenuating abnormal excitability in nociceptive neurons.

BK mediates ER calcium release via ITPR1

To elucidate the downstream signaling mechanism of the BK B2 receptor, we investigated whether BK mediates intracellular calcium release via the ITPR1. Under extracellular calcium-free conditions, we performed calcium imaging on primary cultured TG neurons using the calcium indicator Fluo-4 AM. Given that BK activates phospholipase C (PLC) via Gq/11-protein coupled receptors, thereby promoting IP₃ generation and triggering ER calcium release, BK stimulation was applied to both the control group and the ITPR1 function-blocked group. The results showed that application of BK (10 µM) induced a robust intracellular calcium transient, manifested as a significant increase in intracellular green fluorescence intensity (Figure 4(a) and (b)). In contrast, in the group pretreated with the ITPR1 inhibitor (2-APB), the BK-induced calcium signal responses were significantly attenuated (Figure 4(c) and (d)), suggesting that ITPR1 plays a key role in BK-induced calcium release.

Figure 4.

BK mediates ER calcium release via ITPR1 in TG Neurons. (a) Representative Ca²⁺ imaging of intracellular Ca²⁺ activity in TG neurons from vehicle + BK and 2-APB + BK treated group. Arrows indicate BK-responsive neurons. Scale Bar: 50μm. (b–c) Representative Fluo-4 fluorescence traces showing Ca²⁺ release in TG neurons following BK stimulation. After recording, neurons were challenged with Ca²⁺-containing KCl extracellular solution to confirm viability. (d) Quantification of BK-induced Ca²⁺ response amplitudes in the Vehicle + BK and 2-APB + BK groups (***P < 0.001, Student’s t-test) (e) Representative Ca²⁺ imaging of intracellular Ca²⁺ activity in TG neurons from NC siRNA and Itpr1 group. Scale bar: 50 μm. (f–g) Representative Fluo-4 fluorescence traces showing Ca²⁺ release in TG neurons following BK stimulation. (h) Quantification of BK-induced Ca²⁺ response amplitudes in the NC siRNA and Itpr1-siRNA groups (***P < 0.001, Student’s t-test). (i) qPCR analysis of mRNA levels in the TG tissues for Itpr1 revealed that Itpr1 mRNA levels were significantly reduced following Itpr1 siRNA treatment compared to the NC group (**P < 0.01, student's t-test) n=7 mice.

To further validate this mechanism, we performed gene silencing in TG neurons using Itpr1-siRNA. The results showed that in the negative control group, BK still induced a clear calcium transient (Figure 4(e) and (f)). However, in the Itpr1-siRNA group, the BK-induced calcium signal response was significantly inhibited (Figure 4(e)–(h)). These results collectively demonstrate that BK mediates ER calcium store release by activating ITPR1. qPCR confirmed that Itpr1-siRNA transfection reduced Itpr1 mRNA expression, verifying efficient target knockdown (Figure 4(i)).

2-APB alleviates bradykinin-induced nocifensive behavior and modulates trigeminal neuronal excitability

We further evaluated the impact of pharmacological inhibition of ITPR1 on pain behavior and neuronal excitability. Behavioral testing revealed that injection of BK into TG induced significant nocifensive behavior. Specifically, when mechanical stimulation was applied using a 0.02 g von Frey filament, the nociceptive response scores in the BK + 2-APB group were significantly lower than those in the control group at 3 hours post-injection (Figure 5(a)). Furthermore, when stimulated with a 0.16 g von Frey filament, the BK + 2-APB group exhibited significantly lower nociceptive response scores at both 3 and 6 hours post-injection compared to the control group (Figure 5(b)).

Figure 5.

2-APB alleviates bradykinin-induced nocifensive behavior and modulates trigeminal neuronal excitability. (a–b) Co-injection of 2-APB significantly alleviated bradykinin (BK)-induced mechanical allodynia (*P < 0.05, **P < 0.01, BK + vehicle vs. BK + 2-APB; two-way ANOVA followed by Bonferroni test). (c–d) Representative traces of action potentials evoked by step-current injection in TG neurons. (c) Neurons treated with PBS (0 pA), BK (10 pA), or BK + 2-APB (30 pA). (d) Neurons treated with PBS (100 pA), BK (100 pA), or BK + 2-APB (100 pA). Scale Bar: 0.2s, 20 mV. (e) Local BK injection lowered the rheobase of the first action potential in vehicle-treated mice, an effect abolished by 2-APB co-administration (*P < 0.05, BK + Vehicle vs. BK + 2-APB; one-way ANOVA followed by Tukey’s post-hoc test). (f) BK increased the firing frequency elicited by step-current injection in vehicle-treated mice, whereas 2-APB co-treatment preserved baseline firing patterns (**P < 0.01, BK + Vehicle vs. BK + 2-APB). (g) BK enhanced firing frequency in response to ramp-current stimulation in vehicle-treated mice, which was prevented by 2-APB (**P < 0.01, BK + vehicle vs. BK + 2-APB, two-way ANOVA followed by Bonferroni test). (h) BK depolarized the resting membrane potential in vehicle-treated mice; this effect was reversed by 2-APB co-injection (*P < 0.05, BK + vehicle vs. BK + 2-APB; one-way ANOVA followed by Tukey’s post-hoc test). (i) 2-APB increased the action potential half-width in BK + 2-APB mice compared to BK + vehicle controls (**P < 0.01, BK + Vehicle vs. BK + 2-APB; one-way ANOVA followed by Tukey’s post-hoc test). (j–k) Neither peak amplitude (j) nor discharge threshold (k) of action potentials was altered by BK or BK + 2-APB treatment (P > 0.05, BK + vehicle vs. BK + 2-APB; one-way ANOVA followed by Tukey’s post-hoc test).

To further elucidate the cellular mechanisms, we performed whole-cell patch-clamp recordings. Representative current-clamp recordings intuitively demonstrated the differences in electrical activity among neurons under various treatment conditions (Figure 5(c) and (d)). Compared to the PBS control group, BK treatment decreased the rheobase for action potential generation (Figure 5(e)), increased the firing frequency in response to a fixed current stimulus (160 pA, 1000 ms) (Figure 5(f)), and increased the number of action potentials evoked by incremental ramp current stimulation (300 pA, 1000 ms) (Figure 5(g)) in nociceptive TG neurons. Additionally, BK treatment induced depolarization of the resting membrane potential (Figure 5(h)).

In contrast, combined 2-APB treatment reversed these BK-induced changes in excitability. This was manifested by an increased rheobase (Figure 5(e)), reduced firing frequency under fixed current stimulation (Figure 5(f)), a decreased number of action potentials evoked by ramp current stimulation (Figure 5(g)), an increased half-width (Figure 5(i)), and restoration of resting membrane potential (Figure 5(h)). However, no significant changes were observed in the peak amplitude or the action potential discharge threshold (Figure 5(j) and (k)). In summary, these findings indicate that 2-APB, by inhibiting ITPR1, blocks BK-mediated calcium release, thereby reversing neuronal hyperexcitability and ultimately alleviating pain behavior.

Discussion

The present study investigated the role and mechanism of B2 receptor-mediated ITPR1-dependent ER calcium release signaling in trigeminal neuropathic pain. Using a combination of molecular, cellular, electrophysiological, and behavioral approaches, we demonstrated that: (1) pIONT induces significant upregulation of BK mRNA and B2 receptor expression in the TG neurons; (2) pharmacological blockade of the B2 receptor significantly alleviates mechanical allodynia and attenuates neuronal hyperexcitability; (3) BK evokes intracellular calcium release via ITPR1 activation in TG neurons, which can be suppressed by both the ITPR1 inhibitor and Itpr1-siRNA; and (4) inhibition of ITPR1 effectively reverses BK-induced neuronal hyperexcitability and nocifensive behavior. Collectively, these findings establish the B2 receptor-ITPR1 signaling axis as a critical mechanism underlying the development and maintenance of trigeminal neuropathic pain.

A salient finding of this study is the marked upregulation of BK mRNA and B2 receptor expression in the TG following peripheral nerve injury. BK, a potent endogenous algogenic mediator, is rapidly released in response to tissue injury, ⁴¹ inflammation, ⁴² and nerve trauma. ⁴³ While previous studies have documented the involvement of BK-B2 receptor signaling in somatic neuropathic pain models, ⁴⁴ including sciatic nerve ligation and diabetic neuropathy,^45–48 systematic investigations specifically addressing the trigeminal system have remained limited. Our results demonstrate that pIONT induces a time-dependent increase in BK synthesis and B2 receptor expression in the ipsilateral TG, peaking at postoperative day 7 and underscoring the predominant role of the constitutively expressed B2 receptor in mediating BK-induced nociceptive sensitization from the early to chronic phases of trigeminal neuropathic pain.

The cell-type-specific distribution of the B2 receptor provides important insights into its functional relevance. Immunofluorescence co-localization analysis revealed that the upregulated B2 receptor is predominantly expressed on myelinated (NF200+), peptidergic (CGRP+) and non-peptidergic (IB4+) neurons. This distribution pattern is particularly significant given the established roles of these cell populations in nociceptive processing. Myelinated Aβ-fibers, traditionally associated with mechanosensation, ⁴⁹ undergo phenotypic switches following nerve injury and contribute to mechanical allodynia—a hallmark of neuropathic pain.^50,51 The presence of B2 receptors on these neurons suggests that BK signaling may facilitate the aberrant excitability of Aβ-fibers that underlies tactile allodynia in the trigeminal territory. Similarly, peptidergic C-fibers, which constitutively express CGRP and substance P, are principal conveyors of nociceptive information, ¹⁰ and B2 receptor activation on these neurons likely amplifies nociceptive transmission. ⁵²

The functional significance of B2 receptor upregulation was substantiated by behavioral and electrophysiological experiments. Local injection of the selective B2 receptor antagonist Icatibant into the TG significantly attenuated pIONT-induced mechanical allodynia, with analgesic effects observed up to 6 hours post-administration. This temporal profile suggests that blocking B2 receptor activity effectively interrupts ongoing nociceptive signaling. At the cellular level, Icatibant treatment restored the excitability parameters of small-diameter nociceptive TG neurons, including rheobase and firing frequency, to levels comparable to sham-operated controls. These findings corroborate that B2 receptor signaling directly contributes to the hyperexcitable state of nociceptive neurons following peripheral nerve injury.

A central mechanistic advance of this study is the elucidation of ITPR1-dependent ER calcium release as a downstream effector of B2 receptor signaling in TG neurons. Activation of the B2 receptor, a Gq/11-coupled GPCR, stimulates PLC-mediated hydrolysis of PIP₂ to generate IP₃, ⁵³ which subsequently binds to ITPR1 on the ER membrane to trigger calcium store release. ³⁰ Our calcium imaging experiments, conducted under extracellular calcium-free conditions to exclude the contribution of membrane calcium channels, unequivocally demonstrated that BK induces robust intracellular calcium transients in primary cultured TG neurons. Both pharmacological inhibition of ITPR1 with 2-APB and genetic silencing of Itpr1 via siRNA markedly attenuated these BK-evoked calcium responses, confirming the essential role of ITPR1 in this signaling cascade. Mechanistically, ITPR1-mediated ER calcium release modulates neuronal excitability through multiple calcium-sensitive downstream effectors. For example, elevated intracellular calcium can activate calcium-activated chloride channels (e.g., ANO1) to drive membrane depolarization, ³⁶ and may also regulate potassium channel gating to reshape action potential firing properties, ¹³ collectively linking ER calcium release to the observed neuronal hyperexcitability.

The functional implications of ITPR1-mediated calcium release extend beyond intracellular signaling to the modulation of neuronal excitability and pain behavior. ³⁶ Calcium is a ubiquitous second messenger that regulates numerous neuronal processes, including membrane excitability, ion channel function, ⁵⁴ neurotransmitter release, ⁵⁵ and gene expression. ⁵⁶ Aberrant calcium signaling has been implicated in various chronic pain states,^57–59 and the present findings specifically implicate ER calcium store release—rather than solely extracellular calcium influx—as a critical determinant of neuronal sensitization. Patch-clamp recordings demonstrated that co-application of 2-APB reversed BK-induced depolarization of the resting membrane potential, reduced rheobase, and attenuated increased firing frequency in nociceptive TG neurons. Correspondingly, local co-administration of 2-APB with BK significantly reduced nocifensive behavior scores. These convergent lines of evidence from calcium imaging, electrophysiology, and behavior collectively establish ITPR1-mediated ER calcium release as a key mechanism by which BK-B2 receptor signaling enhances neuronal excitability and promotes pain sensitization.

Current pharmacological management of trigeminal neuropathic pain, including anticonvulsants (e.g., carbamazepine, gabapentin) and tricyclic antidepressants, often provides incomplete pain relief and is frequently accompanied by intolerable adverse effects. ⁶⁰ The present findings suggest that peripherally restricted interventions targeting the BK B2 receptor or ITPR1 could offer effective analgesia with potentially reduced central side effects. Icatibant, a peptide B2 receptor antagonist already approved for the treatment of hereditary angioedema in several countries, ⁶¹ could be repurposed or optimized for local delivery to the TG. Similarly, the development of selective ITPR1 inhibitors with improved pharmacokinetic properties and reduced off-target effects could provide an alternative or complementary therapeutic strategy. Notably, since both BK and ITPR1 are expressed peripherally, targeting this axis may avoid the central nervous system side effects associated with conventional analgesics.

Several limitations of this study should be acknowledged. First, while our findings demonstrate a causal role for the BK B2 receptor-ITPR1 axis in trigeminal neuropathic pain using pharmacological and siRNA-mediated approaches, the development of conditional knockout mouse models would provide more definitive genetic evidence. Second, the present study focused primarily on acute and subacute time points (up to 21 days post-pIONT); future studies should evaluate whether this signaling axis contributes to chronic phases of trigeminal neuropathic pain. Third, all experiments were conducted exclusively in male mice. Given well-documented sex differences in neuropathic pain mechanisms and inflammatory mediator expression, the generalizability of these findings to female animals requires further validation in future studies.

In conclusion, this study establishes that following trigeminal nerve injury, increased local BK synthesis and upregulation of its B2 receptor in TG neurons activate ITPR1 to mediate ER calcium store release, thereby enhancing nociceptive neuronal excitability and contributing to the initiation and maintenance of trigeminal neuropathic pain. These findings not only advance our understanding of the peripheral sensitization mechanisms underlying trigeminal neuralgia but also identify the BK B2 receptor-ITPR1 signaling axis as a promising target for the development of novel, mechanism-based analgesic therapies. Future studies employing genetic approaches, chronic pain models, and more selective pharmacological tools will further validate this signaling axis as a viable therapeutic target and potentially contribute to improved clinical management of patients suffering from trigeminal neuropathic pain.