Sage Journals: Discover world-class research

Abstract

Objective: To investigate the effect and clinical significance of myeloid-derived suppressor cells (MDSCs) levels and serum miRNA-21 expression in advanced non-small cell lung cancer (NSCLC) patients. Methods: Advanced NSCLC patients treated at the First People’s Hospital of Tongxiang City, Zhejiang Province, between July 2021 and June 2022 were included in this study. MDSCs in the peripheral circulation were assessed by flow cytometry, and serum miRNA-21 expression was assessed by q-PCR. The effects of miRNA-21 on MDSC proliferation and ARG-1 and inducible nitric oxide synthase (iNOS) secretion from MDSCs were examined using in vitro cell experiments. In addition, the correlation between MDSC and CEA, CRP and Ki67 was analyzed. Results: Compared with those in the peripheral circulation of individuals in the control group, the expression levels of polymorphonuclear-MDSCs (PMN-MDSCs) and miRNA-21 in the peripheral circulation of NSCLC patients were significantly higher, and the two groups were significantly positively correlated. In in vitro cell experiments, miRNA-21 mimics promoted MDSC proliferation and increased ARG-1 and iNOS secretion and miRNA-21 inhibtor has an opposite result. In addition, PMN-MDSCs in the peripheral circulation of NSCLC patients were significantly positively correlated with carcinoembryonic antigen (CEA), C-reactive protein (CRP), and Ki67. Conclusion: The blood of advanced NSCLC patients contains high levels of MDSCs and miRNA-21, and the two may interact to impact on NSCLC.

Keywords

MDSCs miRNA-21 non-small cell lung cancer iNOS

Introduction

Lung cancer is one of the most common malignant tumours worldwide, and its incidence is increasing yearly. Approximately 80% of lung cancers are non-small cell lung cancer (NSCLC), and approximately one-third of patients are at an advanced stage at the time of disease diagnosis, thus missing the opportunity for surgery.¹ The treatment options for NSCLC vary with disease stages. For patients with advanced disease, the main treatment methods include traditional chemotherapy and molecular targeted therapy, which have emerged in recent years. Targeted therapy for lung cancer involves the disruption of multiple important steps in tumour cell growth. Although molecular targeted therapy has become a new and effective treatment for NSCLC and can prolong patient survival, to determine the response rates for immunosuppressants, the immunobiology of lung cancer and the effect of the tumour microenvironment (TME) on the survival time of NSCLC patients need to be elucidated.²

A growing body of evidence indicates that various cellular components in the TME, especially myeloid-derived suppressor cells (MDSCs), play an important role in inhibiting antitumour immunity.^3–4 MDSCs are phenotypically heterogeneous cell populations derived from bone marrow progenitor cells and immature myeloid cells.⁵ MDSCs proliferate in large quantities in cancer, inflammation, and infection and can inhibit antitumour immunity and promote tumour growth and metastasis through a variety of mechanisms.⁶ The presence of MDSCs (CD33⁺ HLA-DR^- CD11b⁺ lin) in lung cancer patients is associated with the clinical stage of lung cancer.⁷ In tumour-bearing mice, high levels of granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 1β (IL-1β), and vascular endothelial growth factor are involved in the proliferation, aggregation induction, and angiogenesis of MDSCs.⁸ However, no single factor has been identified that induces the MDSC phenotype, suggesting that the synergy between multiple factors plays an important role in the proliferation and activation of MDSCs.

miRNA-21 is an oncogenic miRNA, and its overexpression promotes the occurrence and development of a variety of cancers.⁹ miRNA-21 levels in tissue and serum samples from NSCLC patients are significantly higher than those in individuals without NSCLC.¹⁰ Studies have shown that miRNA-21 overexpression affects the overall survival of NSCLC patients and is an important factor for the poor prognosis of NSCLC patients. miRNA-21 is highly expressed in the serum of NSCLC patients with lymph node metastasis and poor differentiation.¹¹ miRNA-21 participates in the occurrence, development and metastasis of lung cancer by regulating the proliferation, differentiation, apoptosis and invasion of lung cancer cells.¹² In-depth studies on the relationship between miRNAs and tumours have been conducted; the results from some studies have confirmed that abnormal miRNA-21 expression affects the occurrence and development of tumours through the regulation of oncogenes. However, the specific mechanism and target of miRNA-21 have not been fully elucidated.

Therefore, this study investigated MDSCs in the peripheral blood and plasma of NSCLC patients to determine the regulatory effect of the interaction between miRNA-21 and MDSCs on NSCLC and its clinical significance.

Materials and methods

Patients

This is a single-center retrospective cohort study. A total of 60 patients with Stage III or Stage IV NSCLC who were treated at First People’s Hospital of Tongxiang City, Zhejiang Province, from July 2021 to June 2022 were included in the study. Patients with other malignant tumour diseases and complications were excluded. The normal control group included 20 individuals, and specimens were obtained from the physical examination centre at our hospital. Additional patient data were present in Table 1. This study was approved by the Ethics Committee of First People’s Hospital of Tongxiang City with the ethics number of 2020162, which accorded with the ethical standards formulated in the Helsinki Declaration. All the patients offering clinical materials were signed the informed consents.

Table 1.

Basic information of the subjects in each group.

Groups	Total samples	Age (years)	Sex (Male/Female)	Absolute monocyte count *10⁹	Absolute granulocyte count *10⁹	Absolute lymphocyte count *10⁹
Healthy donors	20	62±2.03	13/7	0.40±0.04	4.09±0.38	1.99±0.09
NSCLC patients	60	53±3.04	40/20	0.55±0.05	6.49±0.59	1.32±0.19

There was no significant difference between the two experimental groups in terms of age, monocytes, granulocytes, and absolute number of lymphocytes (p > 0.05).

Experimental method

Specimen collection and processing

Peripheral whole blood: Two millilitres of venous whole blood was collected from NSCLC patients and healthy individuals who underwent a physical examination into a tube containing an anticoagulant (EDTA-K₂, sodium dipotassium citrate). The specimens were subjected to flow cytometry detection within 24 h.

Serum: Serum was isolated from peripheral blood and stored at −80°C to assess miRNA-21 expression levels.

Flow cytometry analysis

A BD FACSCalibur (BD Biosciences, USA) flow cytometer was employed in this study. The detection method used four-colour fluorescence labelling technology. The antibodies included fluorescein isothiocyanate (FITC)-labelled CD11b, phycoerythrin (PE)-labelled CD33, allophycocyanin (APC)-labelled CD15, and peridinin-chlorophyll protein (PerCP)-cy5.5-labelled CD14 (all purchased from BD Pharmingen, USA). Specimens underwent extracellular antibody staining. Briefly, 50 μL of fresh whole blood and 10 μL of each reagent (CD11b, CD33, CD14, and CD15) were mixed and incubated at 4°C in the dark for 20 min; 2 mL of haemolysin (BD Biosciences, USA) was added to lysis red blood cells at room temperature in the dark for 10 min; 1 mL of buffer was added; the sample was centrifuged at 250×g for 5 min and washed twice; and after the supernatant was discarded, the sample was analysed by flow cytometry. Gating was performed on a BD FACSCalibur flow cytometer (BD Biosciences, USA) based on the morphological parameters of forward scattering and side scattering (FSC/SSC) images. The numbers of CD11b⁺CD33⁺CD14⁺ and CD11b⁺CD33⁺CD15⁺ MDSCs were calculated.

RNA extraction and real-time quantitative PCR

First, a serum miRNA extraction kit (Magen) was used to extract miRNA from plasma (refer to the kit manual for the specific protocol). After determining the concentration of the extracted miRNA, it was stored at −80°C. Then, the miRNA was reverse transcribed into cDNA using a miRcute Plus miRNA First-Strand cDNA Kit from TIANGEN BIOTECH (refer to the kit manual for the specific protocol). Last, the cDNA was subjected to fluorescence quantitative PCR. A 20-μL reaction system was prepared on ice following the instructions provided with the miRcute-enhanced miRNA cDNA first-strand synthesis kit from TIANGEN BIOTECH. The reaction conditions were divided into two steps: the first step was pre-denaturation at 95°C for 30 s, and the second step was PCR, i.e., 40 cycles of 95°C for 5 s and 60°C for 30 s. Samples were mixed gently before being placed in the PCR machine. The dissolution curve was confirmed after the reaction was completed, and the experimental data were analysed. The primer sequences were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences were as follows: internal reference U6 F ’GGAACGATACAGAGAAGATTAGC and R ‘TGGAACGCTTCACGAATTTGCG’; and hsa-miR-21: F ‘ACGTTGTGTAGCTTATCAGACTG’ and R ‘AATGGTTGTTCTCCACACTCTC’.

Magnetic bead separation of MDSCs

Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral blood using the Ficoll method, and CD11b⁺ mononuclear cells were isolated from PBMCs using magnetic bead sorting. PBMCs were isolated from 20 mL of anticoagulated whole blood using the Ficoll method. After washing the cells twice with PBS buffer containing 0.5% BSA, they were diluted to a concentration of 1 × 10⁸/L. A total of 20 μL of CD11b magnetic beads (Miltenyi, Germany) was added to the cells, followed by a 20-min incubation in the dark and centrifugation. The cells were then slowly added to a separation column (Miltenyi, Germany) to isolate the CD11b⁺ cell population. Isolated cells were placed in culture medium for subsequent cell experiments.

Cell culture

Isolated MDSCs were seeded into 96-well cell culture plates (4 × 10⁵ cells/L per well). The cells were divided into four groups including control miRNA-NC mimics group, miRNA-21 mimics group, control miRNA-NC inhibtor group and miRNA-21 inhibtor group, and incubated overnight at 37°C in 5% CO₂. After 24 h of culture, transfection was performed using the transfection reagent Lipo2000. The four groups were transfected with miRNA-NC mimics, miRNA-21 mimics, miRNA-NC inhibtor and miRNA-21 inhibtor respectively. Cell proliferation was assessed using a CCK8 kit at 0 h, 24 h, 48 h, and 96 h after transfection.

The levels of INOS and ARG-1 detected by ELISA

Supernatants were collected 48 h after transfection, and iNOS and ARG-1 expression was detected by enzyme-linked immunosorbent assay (ELISA). The iNOS (CSB-EL002005HU) and ARG-1 (CSB-E08148h) detection kits were purchased from Cusabio, Wuhan, China (refer to the kit manual for the specific protocol). A standard curve was generated, and the concentration of each test sample was calculated.

The expression of Ki67 detected by Immunohistochemistry

Immunohistochemistry was conducted to detect the expression of Ki67 in human lung cancerous tissues. Briefly, paraffin embedded tissues were cut into 5 μm slides. Tissues were incubated with anti-Ki67 antibody (Dako, China) overnight at 4°C. Next day, each sample was incubated with HRP-labeled second antibodies (Servicebio, China) for 1 h. The expression level of Ki67 was analyzed using a light microscope (Zeiss, Germany). The expression levels of Ki67 were graded based on the percentage of tumor cells stained by the antibody (Figure 5): Negative = background staining intensity; 10% Positive = weak staining intensity; 40% Positive = moderate staining intensity; 80% Positive = strong staining intensity.

Figure 5.

The expression levels of Ki67 were graded based on the percentage of tumor cells stained by the antibody. (a) Negative = background staining intensity; (b) 10% Positive = weak staining intensity; (c) 40% Positive = moderate staining intensity; (d) 80% Positive = strong staining intensity. Scale bar, 50 μm.

Statistical analysis

GraphPad Prism 6.0 software was used to prepare tables and figures and statistically analyse the experimental results. Data are expressed as the mean ± SEM. Statistics were performed using unpaired t-tests for comparisons between two groups. Correlations were analyzed using the Pearson’s rank correlation test. p < 0.05 was considered a statistically significant difference.

Results

Proportions of different MDSC subpopulations in the peripheral blood of NSCLC patients

We first investigated the presence of different subpopulations of MDSCs in the peripheral circulation of NSCLC patients. Polymorphonuclear MDSCs (PMN-MDSCs: CD15⁺CD11b⁺CD33⁺ group) and mononuclear MDSCs (M-MDSCs: CD14⁺CD11b⁺CD33⁺ group) were detected in the peripheral circulation of both the control group and the NSCLC patients (Figure 1(a) ). We observed that the percentage of PMN-MDSCs in the peripheral blood of NSCLC patients (65.85 ± 1.46%, N = 60) was significantly higher compared with control group (53.37 ± 1.89%, N = 20) (p < 0.05) (Figure 1(b)). However, the percentage of M-MDSCs was no significant difference between NSCLC patients (0.60 ± 0.07%, N = 60) and the control group (0.51 ± 0.06%, N = 20) (p > 0.05) (Figure 1(c)).

Figure 1.

Frequency and phenotype of MDSC cells in the peripheral blood of NSCLC patients and healthy donors. (a) CD14⁺ cells and CD15⁺ cells were gated on the peripheral blood CD11b⁺CD33⁺ groups, respectively. (b) The percentages of CD15⁺ MDSC cells. (c) The percentages of CD14⁺ MDSC cells. Data were presented as mean ± SEM. Unpaired t-tests was used for comparisons between two groups. ^***p < 0.001, significantly different from the values in the healthy donors.

Plasma miRNA-21 expression in NSCLC patients

Serum miRNA-21 expression was assessed by q-PCR, and its expression was significantly higher in the NSCLC group than in the control group (p < 0.05) (Figure 2(a)). In the correlation analysis, the presence of CD15⁺ MDSCs in the peripheral circulation of NSCLC patients was significantly positively correlated with serum miRNA-21 expression (p < 0.0001) (Figure 2(b)).

Figure 2.

Expression of miR-21 in serum of NSCLC patients. (a) The expression of miR-21 in serum of NSCLC patients and healthy donors. (b) Correlation of miR-21 with CD15⁺ MDSC cells. Correlation analysis was performed using the Spearman’s rank correlation test. ^*p < 0.05, significantly different from the values in the healthy donors.

Effect of miRNA-21 on MDSCs

Next, in vitro experiments were conducted to verify the interaction between miRNA-21 and MDSCs. MDSCs were isolated via immunomagnetic beads and were transfected with miRNA-21 mimics and miRNA-21 inhibtor; overexpression and inhibtion were verified by q-PCR (Figure 3(a)). The CCK-8 assay results indicated that miRNA-21 mimics promoted continuous proliferation of MDSCs over time (p < 0.0001) (Figure 3(b)). The ELISA results indicated that miRNA-21 overexpression promoted ARG-1 and iNOS secretion from MDSCs (p < 0.0001) (Figures 3(c) and (d)).

Figure 3.

The effect of miRNA-21 on MDSCs. MDSC cells were transfected with control mimics, miR-21 mimics, or control inhibtor and miR-21 inhibtor. (a) miRNA-21 expressions of four groups were examined by q-PCR. (b) The transfected cell viability was assessed using MTT. (c) The level of ARG-1 was detected by ELISA assay. (d) The level of iNOS was detected by ELISA assay. Unpaired t-tests was used for comparisons between two groups. **p < 0.01, ***p < 0.001, miR-21 mimics group was significantly different from the values in the control mimics group. #p < 0.05, ##p < 0.01, ###p < 0.001, miR-21 inhibtor group was significantly different from the values in the control inhibtor group.

Correlation between miRNA-21 and MDSCs and clinical symptoms

The correlation analysis results indicated that the presence of CD15⁺ MDSCs in the peripheral circulation of NSCLC patients was significantly positively correlated with serum CEA expression (Figure 4(a)) and positively correlated with plasma C-reactive protein (CRP) expression (Figure 4(b)); and the presence of CD15⁺ MDSCs in the peripheral circulation of NSCLC patients was positively correlated with ki67 expression in tumour tissue (Figure 4(c)).

Figure 4.

The serum index correlation with circulating CD15⁺ MDSC cells in NSCLC patients. (a) Correlation between serum CEA level and CD15⁺ MDSC cells in NSCLC patients. (b) Correlation between CRP level and CD15⁺ MDSC cells in NSCLC patients. (c) Correlation between ki67 percentage and CD15⁺ MDSC cells in NSCLC patients. Correlation analysis was performed using the Pearson’s rank correlation test.

Discussion

In this study, the presence of MDSC subtypes and the expression of miRNA-21 in the peripheral circulation of NSCLC patients were investigated. The presence of PMN-MDSCs and the expression of miRNA-21 were significantly higher in NSCLC patients than in controls, and there was a positive correlation between PMN-MDSCs and miRNA-21 expression. Cell experiments confirmed that miRNA-21 promoted MDSC proliferation, cytokine secretion and thus tumour growth.

An increase in immunosuppressive cells is often associated with an increase in tumour burden, leading to T-cell dysfunction, which is conducive to tumour cell proliferation and invasion. MDSCs are negatively correlated with the chemotherapy response and survival time in lung cancer patients and can lead to resistance to immune checkpoint inhibitors.¹³ MDSCs can also regulate the development of tumour-associated macrophages (TAMs) and T regulatory (Treg) cells and activate the reprogramming of immunosuppression in the TME, which is one of the main challenges of NSCLC immunotherapy.¹⁴ MDSCs can be recruited to tumour sites by CC chemokine ligand 2 (CCL2), CXC chemokine ligand 12 (CXCL12), and CXCL5.^15–17 The acquisition of immunosuppressive properties by MDSCs in the TME is mediated by STAT1, STAT3, STAT6, and nuclear factor-κB.^18,19 Then, activated MDSCs produce immunosuppressive cytokines such as ARG1, iNOS2, NADPH oxidase, and indoleamine 2,3-dioxygenase (IDO). These cytokines inhibit cytotoxic T lymphocytes, natural killer (NK) cells, and dendritic cells (DCs) and activate Treg cells.²⁰ The results of this study indicated that the number of PMN-MDSCs and expression of miRNA-21 in the peripheral circulation of NSCLC patients were significantly higher than those in normal individuals, a finding that is consistent with reports in China and elsewhere. There was no significant difference in the presence of M-MDSCs, a finding possibly related to the number of specimens and the selection of patients. PMN-MDSCs and miRNA-21 were significantly positively correlation, suggesting a mutual influence between the two that promotes the immune escape of NSCLC. However, we also admit that the number of samples is small, and expanding the sample can get more accurate conclusions. In vitro experiments confirmed the hypothesis that miRNA-21 indeed impacts MDSC proliferation and ARG-1 and iNOS secretion. However, our experiment also has some shortcomings that used CD11b to sort the cell population representing MDSCs. Furthermore, ARG-1 and iNOS deplete arginine necessary for T-cell activation in the TME, induce T-cell arrest in the G0/G1 phase, inhibit T-cell proliferation and immune function, and allow tumour cells to escape immune system surveillance, thereby inhibiting tumour formation and recurrence. Previous studies also showed that ARG-1 and iNOS expression in the tumour tissue of NSCLC patients were significantly increased and associated with lymph node metastasis.

In recent years, miRNA dysregulation has been confirmed to be an important factor or mechanism for the occurrence and development of tumours. It affects tumour proliferation, angiogenesis, metastasis and acquired drug resistance through interactions between malignant cells, nonmalignant stromal cells and noncellular components in the TME. Studies have demonstrated that miRNA-21 is an important regulatory factor for the growth and invasion of NSCLC and can directly regulate the expression of human salivary histatin tissue 1 (HTN1) in the H1650 NSCLC cell line.²¹ miRNA-21 promotes the migration and invasion of lung cancer cells by binding to the 3′-UTR of HTN1, indirectly confirming that miRNA-21 has a certain interference effect on the growth and invasion behaviour of lung cancer cells.²² In addition, in lung cancer cell experiments, miRNA-21 reduced the number of G2 cells and increased the number of S-phase cells among lung cancer cells through the AKT/P-AKT/cleaved-caspase3/MMP-2/MMP-9 cell signalling pathway, thereby promoting human lung cancer cell proliferation and inhibiting apoptosis.²³

Conclusion

Our experimental results confirmed that miRNA-21 affected the proliferation and function of MDSCs in NSCLC; however, the specific signalling pathways and regulatory mechanisms are still unclear. Further experimental studies are needed to confirm the results herein.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by Health Bureau of Zhejiang Province, Zhejiang, China (2020KY971), Science and Technology Bureau of Tongxiang, Zhejiang, China (201902302).

Ethics approval

Ethical approval for this study was obtained from the ethics committee of First People’s Hospital of Tongxiang City with the ethics number of 2020162.

ORCID iD

Jun Cao

Appendix

References

Bray

Ferlay

Soerjomataram

, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018; 68: 394–424.

Lee

Cheah

. The Interplay between MicroRNAs and cellular components of tumour microenvironment (TME) on Non-Small-Cell Lung Cancer (NSCLC) progression. J Immunol Res 2019; 2019: 3046379.

Zhang

, et al. Suppressing MDSC infiltration in tumor microenvironment serves as an option for treating ovarian cancer metastasis. Int J Biol Sci 2022; 18: 3697–3713.

Liu

Zhu

, et al. Targeting MDSC for immune-checkpoint blockade in cancer immunotherapy: current progress and new prospects. Clin Med Insights Oncol 2021; 15: 11795549211035540.

Hegde

Leader

Merad

. MDSC: Markers, development, states, and unaddressed complexity. Immunity 2021; 54: 875–884.

Law

Valdes-Mora

Gallego-Ortega

. Myeloid-derived suppressor cells as a therapeutic target for cancer. Cells 2020; 9: 561.

Yang

Guo

Weng

, et al. Myeloid-derived suppressor cells-new and exciting players in lung cancer. J Hematol Oncol 2020; 13: 10.

Bremnes

Busund

Kilvaer

, et al. The role of tumor-infiltrating lymphocytes in development, progression, and prognosis of non-small cell lung cancer. J Thorac Oncol 2016; 11: 789–800.

Kumarswamy

Volkmann

Thum

. Regulation and function of miRNA-21 in health and disease. RNA Biol 2011; 8: 706–713.

10.

Hetta

Zahran

Shafik

, et al. Circulating miRNA-21 and miRNA-23a expression signature as potential biomarkers for early detection of non-small-cell lung cancer. Microrna 2019; 8: 206–215.

11.

Markou

Zavridou

Lianidou

. miRNA-21 as a novel therapeutic target in lung cancer. Lung Cancer (Auckl) 2016; 7: 19–27.

12.

Wang

, et al. Clinical significance of the expression of miRNA-21, miRNA-31 and miRNA-let7 in patients with lung cancer. Saudi J Biol Sci 2019; 26: 777–781.

13.

Salehi-Rad

Crosson

, et al. Inhibition of granulocytic myeloid-derived suppressor cells overcomes resistance to immune checkpoint inhibition in LKB1-deficient non-small cell lung cancer. Cancer Res 2021; 81: 3295–3308.

14.

Genova

Dellepiane

Carrega

, et al. Therapeutic implications of tumor microenvironment in lung cancer: focus on immune checkpoint blockade. Front Immunol 2021; 12: 799455.

15.

Wang

Zhang

Yang

, et al. Blockade of CCL2 enhances immunotherapeutic effect of anti-PD1 in lung cancer. J Bone Oncol 2018; 11: 27–32.

16.

Shi

Han

Sun

, et al. Chemokine (C-X-C motif) ligand 1 and CXCL2 produced by tumor promote the generation of monocytic myeloid-derived suppressor cells. Cancer Sci 2018; 109: 3826–3839.

17.

Cao

Huang

Chen

, et al. Chronic restraint stress promotes the mobilization and recruitment of myeloid-derived suppressor cells through beta-adrenergic-activated CXCL5-CXCR2-Erk signaling cascades. Int J Cancer 2021; 149: 460–472.

18.

Munera

Popovic

Bryk

, et al. Stat 6-dependent induction of myeloid derived suppressor cells after physical injury regulates nitric oxide response to endotoxin. Ann Surg 2010; 251: 120–126.

19.

Mao

Feng

Gong

. The antitumor and immunomodulatory effect of yanghe decoction in breast cancer is related to the modulation of the JAK/STAT signaling pathway. Evid Based Complement Alternat Med 2018; 2018: 8460526.

20.

Mukherjee

Lin

. Coordinated regulation of myeloid-derived suppressor cells by cytokines and chemokines. Cancers (Basel) 2022; 14: 1236.

21.

Sun

Hang

Guo

, et al. Expression and significance of miRNA-21 and BTG2 in lung cancer. Tumour Biol 2013; 34: 4017–4026.

22.

Yang

. Expression and clinical significance of microRNA-21, PTEN and p27 in cancer tissues of patients with non-small cell lung cancer. Oncol Lett 2020; 20: 49.

23.

Sun

Liu

Zhao

, et al. Down-regulating the expression of miRNA-21 inhibits the glucose metabolism of A549/DDP cells and promotes cell death through the PI3K/AKT/mTOR/HIF-1α pathway. Front Oncol 2021; 11: 653596.

Correlation between circulating myeloid-derived suppressor cells and serum miRNA21 in non-small cell lung cancer and its clinical significance

Abstract

Keywords

Introduction

Materials and methods

Patients

Experimental method

Specimen collection and processing

Flow cytometry analysis

RNA extraction and real-time quantitative PCR

Magnetic bead separation of MDSCs

Cell culture

The levels of INOS and ARG-1 detected by ELISA

The expression of Ki67 detected by Immunohistochemistry

Statistical analysis

Results

Proportions of different MDSC subpopulations in the peripheral blood of NSCLC patients

Plasma miRNA-21 expression in NSCLC patients

Effect of miRNA-21 on MDSCs

Correlation between miRNA-21 and MDSCs and clinical symptoms

Discussion

Conclusion

Footnotes

Declaration of conflicting interests

Funding

Ethics approval

ORCID iD

Appendix

References