HSPE1 Inhibits Bladder Cancer Ferroptosis via a Glutathione-Dependent Mechanism by Suppressing GPX4

Abstract

Bladder cancer (BLCA) remains a significant health risk despite advancements in medical science that have led to reduced incidence and death rates. While the molecular regulatory mechanisms of BLCA are not yet fully understood, HSPE1, a member of the heat shock protein family, is regarded as a reliable prognostic target for BLCA. Using data from The Cancer Genome Atlas (TCGA) database, the differential expression levels of HSPE1 and its relationship to GPX4 were examined. Gene Set Enrichment Analysis was used to carry out HSPE1 pathway enrichment analysis. HSPE1 and GPX4 expressions in cells were assessed using quantitative reverse-transcription polymerase chain reaction (qRT-PCR) and western blotting. Cell cycle alternations and apoptosis were evaluated using flow cytometry. Cell proliferation was assessed using EdU and colony formation assays. The lactate dehydrogenase (LDH) test, glutathione (GSH) measurement, and Liperfluo assay were utilized to evaluate the presence of ferroptosis in cells. BLCA tissues and cells had significantly elevated levels of HSPE1. In BLCA, high expression of HSPE1 inhibited apoptosis while promoting cell proliferation and cell cycle progression. Significant enrichment of HSPE1 was found in the GSH metabolism and ferroptosis pathways, according to pathway enrichment analysis. In cancer cells, HSPE1 promoted GSH accumulation, decreased lipid peroxidation, and inhibited cell ferroptosis, as demonstrated in a rescue experiment with the ferroptosis inhibitor Fer-1. Pearson correlation analysis unveiled a substantial positive correlation between HSPE1 and the ferroptosis regulator GPX4. According to the results of rescue experiments, HSPE1 regulated GPX4 to affect cell lipid peroxidation levels and GSH accumulation. HSPE1 plays a crucial role in regulating GPX4 to prevent BLCA cells from undergoing ferroptosis, with this control mechanism dependent on GSH.

Introduction

Bladder cancer (BLCA) ranks among the top 10 malignancies worldwide in terms of incidence. Nearly, 600,000 cases of BLCA were reported in 2020 alone, with approximately 200,000 resulting in fatalities (Sung et al., 2021). It is estimated that over 80,000 Americans will be diagnosed BLCA in 2024(Siegel et al., 2024). Despite advancements in medical technology and economic growth, the incidence and mortality rates of BLCA have been on a downward trend, though challenges persist.

Under stress conditions such as exposure to heavy metals, oxidative stress, and high temperatures, heat shock proteins (HSPs) are prominently expressed. Acting as molecular chaperones, these proteins aid in proper protein folding, prevent protein aggregation, and assist in repairing damaged proteins. Elevated levels of HSPs are observed in various diseases, including cancer, viral diseases, and neurological disorders. HSP90, HSP70, and other proteins have emerged as useful therapeutic targets and prognostic indicators in cancer (Ren et al., 2022; Shevtsov et al., 2018). Within the HSP family lies HSPE1 (Heat Shock Protein Family E Member 1), also known as HSP10 or EPF, which collaborates with HSP60 in the protein folding, assembly, and transport system (Caruso Bavisotto et al., 2020). Like other HSPs, HSPE1 is identified as a predictive target in BLCA, with significantly higher levels detected in patient urine and BLCA tissues, suggesting its potential as a diagnostic marker (Tsai et al., 2018). The precise impact of aberrant HSPE1 expression on BLCA, however, remains largely uncertain.

Ferroptosis, an iron-dependent programmed cell death mechanism, stands apart from traditional cell death processes like apoptosis, necrosis, and autophagy due to its reliance on intracellular iron ions. This process involves disrupted cellular iron metabolism leading to iron ion accumulation, triggering lipid peroxidation via the Fenton reaction. The resultant lipid peroxides surpass the reductive capacity of glutathione peroxidase 4 (GPX4), culminating in ferroptosis. Ferroptosis plays a critical role in various clinical conditions, including cancer, neurological disorders, and ischemia-reperfusion damage. In the context of BLCA, inhibiting ferroptosis has been linked to enhanced resistance to immune and platinum-based therapies, as well as accelerated malignant progression (Ding et al., 2023; Shen et al., 2022; Xiang et al., 2021). Evidence suggests that inducing ferroptosis in cancer cells could serve as a promising treatment strategy (Mou et al., 2019). Thus, a deeper understanding of the mechanisms underlying ferroptosis provides potential targets for innovative treatment approaches and contributes to unraveling fundamental biological processes of cell death.

Our bioinformatics analysis revealed high HSPE1 expression in BLCA, significantly enriched in pathways related to glutathione (GSH) and ferroptosis. Through rescue experiments, we demonstrated that HSPE1 could inhibit ferroptosis in BLCA cells by regulating GSH accumulation and lipid peroxidation levels through modulation of GPX4.

Materials and Method

Cell Culture

BeNa Culture Collection (China) provided the human bladder epithelial immortalized cell line SV-HUC-1 (BNCC100273), as well as the human BLCA cell lines TCCSUP (BNCC359891), RT-112 (BNCC353302), and 5637 (BNCC339635). In Dulbecco's modified eagle medium (DMEM) media, RT-112 and 5637 cells were cultivated. A TCCSUP-specific medium was used to cultivate the cells. The culture media used for SV-HUC-1 cells was F-12K complete. Ten percent fetal bovine serum (FBS) and 1% penicillin-streptomycin were added to each medium supplement. Cells were kept in an incubator (Thermo Fisher, Waltham, MA, USA) at 37°C in a humidified environment with 5% CO₂. We bought FBS and penicillin-streptomycin from Gibco (Grand Island, NY, USA). For the rescue experiments, ferroptosis inhibitor Fer-1 was procured from MCE (Monmouth Junction, NJ, USA).

Cell Transfection

Genepharma (Shanghai, China) supplied the pcDNA3.1 empty vector (oe-NC), pcDNA3.1-HSPE1 overexpression plasmid (oe-HSPE1), pcDNA3.1-GPX4 overexpression plasmid (oe-GPX4), pLKO.1-Puro empty vector (sh-NC), and pLKO.1-HSPE1 shRNA interference plasmid (sh-HSPE1). For 30 min, plasmids and Lipofectamine 2000 (Invitrogen, Carisbad, CA, USA) were combined at a 1:1 ratio after being diluted in 100-μL serum-free media. Following cell seeding in 6-well plates, the Lipofectamine 2000–plasmid combination was dropwise applied to the wells once the cells had reached 80% confluence. Following a 24-hr incubation period at 37°C, the medium was changed to one containing serum. mRNA expressions were measured 3 to 4 days after transfection.

Bioinformatics Analysis

The differential expression of HSPE1 in BLCA tissues relative to normal tissues was examined using the TCGA database. Gene Set Enrichment Analysis (GSEA) was used to perform pathway enrichment analysis of HSPE1. A Pearson correlation analysis was used to look at the relationship between the expression of GPX4 and HSPE1.

RNA Extraction and qRT-PCR

To lyse the cells, 1 mL of Trizol (Solarbio, Beijing, China) was given to each well. The cells were then collected into a centrifuge tube. After centrifuging and adding 200 μL of chloroform to extract the RNA, the supernatant was transferred to isopropanol after centrifugation. After standing for 20 min, centrifugation was done to remove the supernatant, and 1 mL of anhydrous ethanol was added to resuspend. The samples were centrifuged to remove the supernatant and air-dried. After dissolving the RNA in diethyl pyrocarbonate (DEPC) water, a nanodrop 2000 (Eppendorf, Hamburg, Germany) was used to adjust the concentration to 1,000 ng/mL. Using a reverse transcription kit (Vazyme, Nanjing, China), reverse transcription into cDNA was carried out right away. The reference gene utilized in the experiment was β-actin, and the fluorescent dye employed was SYBR Green I (Vazyme, China). The fluorescence signal was measured in triplicate for each sample using a fluorescence quantitative PCR instrument (Eppendorf, Germany). Using primer information from Table 1, the relative quantification approach (2^-ΔΔct) was utilized to examine the gene expression findings.

Table 1.

Primers’ Information

Genes	Primers (5′—3′)
β-actin-F	CATGTACGTTGCTATCCAGGC
β-actin-R	CTCCTTAATGTCACGCACGAT
HSPE1-F	GGTTGAAAGGAGTGCTGCTG
HSPE1-R	GTTGAATCTCTCCACCCTTTCCT
GPX4-F	CCAAGTTTGGACACCGTCTCT
GPX4-R	TCCTTCTCTATCACCAGGGGC

Western Blotting

Using the Mini-Protean III system (Bio-Rad, Beijing, China), total protein extracts from cells were prepared using RIPA lysis buffer (Beyotime, Shanghai, China) and separated by SDS-PAGE. Trans-Blot Turbo transfer technique (Bio-Rad, Beijing, China) was then used to transfer the proteins onto polyvinylidene fluoride (PVDF) membranes. Primary antibodies, such as anti-β-actin (ab213262, abcam, UK), anti-HSPE1 (ab108600, abcam, UK), and anti-GPX4 (ab125066, abcam, Cambridge, UK), were incubated on the membranes for a whole night at 4°C. The membranes were then treated with a secondary IgG antibody (ab205718, abcam, UK) that was conjugated to horseradish peroxidase (HRP). Using an enhanced chemiluminescence detection kit (Amersham Life Science, Stamford, CT, USA), target proteins were located and made visible. UVP BioDoc It (Upland, Austin, TX, USA) was used to take and process the images.

Cell Apoptosis Detection

In a 6-well plate, cells were planted at a density of 5 × 10⁵ per well. After a 10-min incubation at room temperature in the dark, the ANNEXIN V-FITC/PI apoptosis detection kit (Yeasen, Shanghai, China) was used to measure the apoptosis levels of the cell groups. Cell apoptosis levels were measured using a flow cytometer, CyFlow Cube 6 (Ploidy expert, Beijing, China).

EdU Assay

In a 96-well plate, cells were uniformly planted at a density of 1 × 10⁵ cells per well. Using the EdU detection kit (RiboBio, Guangzhou, China), the levels of cell proliferation were measured after an overnight incubation. After adding 100 μL of culture media with 50 μM EdU to each well, the experiment was incubated for 2 hr. Two phosphate buffered saline (PBS) washes lasting 5 min each were performed on the cells. The cells were then fixed for 30 min at room temperature using 50 μL of fixative. Fifty microliters of glycine (2 mg/mL) were added to each well after the fixative was removed, and it was then incubated for 5 min. The cells underwent two rounds of washing after glycine solution was removed, permeabilization solution treatment for 10 min, and then another wash. Hundred microliters of staining solution were added to each well, and cells were incubated for 30 min at room temperature away from light, then 100 μL of permeabilizer was added again, and washed by shaking the bed three times for 10 min each time, and the permeabilizer was discarded. Finally, 100 μL of Apollo dye and 4’,6-diamidino-2-phenylindole (DAPI) staining solution were added to each well for staining and incubated for 30 min at room temperature away from light, followed by discarding the reaction solution and repeating the washing procedure. Observation was performed using a fluorescence microscope (Zeiss, Jena, Germany).

Cell Cycle Analysis

Using the cell apoptosis/cell cycle detection kit (Beyotime, China), cell cycle alterations were found. After collecting the cells, they were fixed in 70% ethanol for 30 min, rinsed twice with PBS, and then exposed to 50 μL ribonuclease and 200 μL propidium iodide (PI) solution for 30 min in the dark. Each set of cells had their cell cycle examined using a flow cytometer (Ploidy expert, China).

Cell Colony Experiment

In culture dishes, cells were planted, and they were kept there for 2 to 3 weeks until colonies could be seen. Following the removal of the supernatant, the cells underwent two meticulous PBS washes. Following a 15-min fixation with 5 mL 4% paraformaldehyde, the cells were stained for 20 min with GIMSA dye, cleaned, and allowed to air dry. Using an optical microscope (Zeiss, Germany), the number of colonies in the growth dish was determined.

LDH Assay

To measure the amount of cell death, the total lactate dehydrogenase activity in the cell supernatant was measured using the LDH cytotoxicity detection kit (Beyotime, China). A 96-well cell culture plate was used to seed the cells, and at the time of testing, the cell density was kept between 80% and 90%. As a maximal enzyme activity control, 10% of cell lysis buffer were added to each well 1 hr prior to detection, and the samples were then incubated. After incubation, samples were centrifuged for 5 min, and 120 μL of supernatant were taken and added with 60 μL of LDH detection solution to each well. After a 30-min incubation in the dark, the absorbance at 490 nm was measured using a microplate reader (Thermo Fisher, USA). Cell death rate (%) = (Absorbance of treated sample − Absorbance of sample control well) / (Absorbance of maximum enzyme activity of cells − Absorbance of sample control well) × 100.

Quantification of GSH

Reduced GSH colorimetric test kit (Elabscience, Wuhan, China) was used to determine the amount of GSH present in cell supernatants. Homogenates were gathered, samples and reagents were added, and the plate was agitated for 1 min before being incubated for 5 min. A microplate reader (Thermo Fisher, USA) was used to measure the absorbance at 405 nm after 25 min.

Liperfluo Detection

The liperfluo test kit (DOJINDO, Kumamoto, Japan) was utilized to measure the amounts of cellular lipid peroxidation. In a 6-well plate, cells were planted at a density of 1 × 10⁵ per well and cultivated for an entire night. After removing the growth media, each well received 2 mL of 1 μmol/L Liperfluo solution, and it was incubated for 30 min at 37°C. Two milliliters of Hank’s Balanced Salt Solution (HBSS) were used to wash the cells twice after the supernatant was removed. After adding 2 mL of 500 μmol/L tert-Butyl hydroperoxide (t-BHP) solution, the cells were incubated for 60 min at 37°C. Trypsin was then used to break down the cells, which were then moved to centrifuge tubes and resuspended in HBSS. For detection, flow cytometry (Ploidy expert, China) was employed.

Statistical Analysis

All experiments were independently repeated at least three times, and results are presented as mean ± standard deviation. Experimental data and images were processed using Graphpad Prism 8.0 (GraphPad, La Jolla, CA, USA). One-way analysis of variance was utilized for comparisons among multiple groups, while Student’s t-test was employed for analyzing differences between two groups. A p-value of less than .05 was considered statistically significant.

Results

Aberrant Overexpression of HSPE1 in BLCA Cells

Initially, we assessed the differential expression levels of HSPE1 in BLCA tissues compared to normal tissues using an analysis based on the TCGA database. As depicted in Figure 1A, the expression levels of HSPE1 were higher in tumor tissues. Human bladder epithelial cells and various BLCA cell lines were employed for cellular-level validation. Each BLCA cell line showed a significant upregulation of HSPE1 mRNA, with Western blotting analysis confirming elevated levels of HSPE1 protein, suggesting aberrant overexpression of HSPE1 in BLCA (Figure 1B and 1C). Subsequent validations were conducted utilizing the 5637 and RT-112 cell lines, chosen due to their highest expression levels of HSPE1.

Figure 1.

HSPE1 Overexpression in BLCA. (A) Analysis of HSPE1 Expression Differences in BLCA Tissues and Normal Tissues Based on the TCGA Database. (B) qRT-PCR Evaluation of HSPE1 mRNA Expression Levels in Normal Cells and Bladder Cell Lines. (C) Western Blotting Analysis of HSPE1 Protein Expression in Cells

HSPE1 Suppresses Apoptosis and Accelerates Cell Cycle Progression in BLCA Cells

We also investigated the impact of this dysregulated expression on the phenotypic characteristics of cancer cells. In BLCA cell lines 5637 and RT-112, HSPE1 was either overexpressed or knocked down, with the effectiveness of these manipulations confirmed by qRT-PCR (Figure 2A). Flow cytometry was utilized to evaluate cellular apoptotic levels, revealing a significant reduction in apoptosis in BLCA cells with HSPE1 overexpression (Figure 2B). Proliferative capabilities were assessed through EdU assays and colony formation assays. As shown in Figure 2C, HSPE1 overexpression led to a notable increase in the proportion of EdU-positive cells. Denser cell colonies were observed with higher HSPE1 expression levels, indicating that HSPE1 promoted BLCA cell proliferation (Figure 2D). Cell cycle responses to DNA damage can be regulated by HSPs (Dubrez et al., 2020). Our observations of cell cycle alterations in BLCA cells revealed that HSPE1 overexpression increased the percentage of cells in the S phase while decreasing the proportion in the G0/G1 phase. Conversely, HSPE1 reduction resulted in a decrease in S phase cells and an increase in G0/G1 and G2/M phase cells, suggesting that HSPE1 promoted enhanced cell proliferation rates (Figure 2E). In summary, HSPE1 could promote a malignant phenotype, accelerate the cell cycle, and prevent apoptosis in BLCA cells.

Figure 2.

HSPE1 Suppresses Apoptosis and Accelerates Cell Cycle Progression in BLCA Cells. (A) qRT-PCR Evaluation of Knockdown and Overexpression Efficiency. (B) ANNEXIN V-FITC/PI Analysis of Apoptotic Levels in Each Group of Cells. (C) EdU Analysis of Cell Proliferation Levels in Each Group. (D) Cell Colony Experiments Assessing Cell Proliferative Capacity. (E) Flow Cytometry Analysis of Cell Cycle Changes in Each Group of Cells

HSPE1 Alleviates Ferroptosis in BLCA Cells

We delved deeper into the cellular processes influenced by HSPE1. Through GSEA, we observed higher enrichment scores for HSPE1 in the GSH metabolism and ferroptosis pathways (Figure 3A). Building upon the preceding data, we hypothesized that HSPE1 might play a role in preventing cellular ferroptosis. To explore this, we conducted rescue experiments using the ferroptosis inhibitor Fer-1 in combination with HSPE1 knockdown in cell lines. Initially, flow cytometry was utilized to quantify lipid peroxidation levels in different cell types. Suppression of HSPE1 led to an increase in lipid peroxidation, a response that was mitigated by the ferroptosis inhibitor, suggesting that HSPE1 reduction triggered cellular ferroptosis (Figure 3B). Analysis of LDH levels in the cell supernatant after HSPE1 knockdown indicated elevated LDH levels, which could be restored by Fer-1, indicating increased cell death upon HSPE1 knockdown (Figure 3C). GSH depletion is a major driver of lipid peroxidation in ferroptosis. Upon HSPE1 knockdown, a significant decrease in cellular GSH levels was observed, which could be restored by Fer-1, highlighting the role of HSPE1 in preserving GSH levels (Figure 3D). Collectively, these results suggested that HSPE1 may serve as a potential target for mitigating ferroptosis in BLCA cells.

Figure 3.

HSPE1 Alleviates Ferroptosis in BLCA Cells. (A) GSEA Pathway Enrichment Analysis of HSPE1 Pathways. (B) Liperfluo Assessment of Lipid Peroxidation Levels in Cells. (C) LDH Analysis Evaluating Cell Death. (D) Reagent Kit Assessment of Cellular GSH Levels

HSPE1 Inhibits Ferroptosis in BLCA Cells in a GSH-Dependent Manner Through GPX4

Finally, we investigated downstream targets of HSPE1. GPX4, an oxidoreductase that prevents ferroptosis by converting lipid peroxidation into nontoxic lipid alcohols, operates in conjunction with GSH. Correlation analysis revealed a strong positive relationship between HSPE1 and GPX4 (Figure 4A). Subsequently, we generated cell lines that overexpressed GPX4 and conducted rescue studies involving GPX4 overexpression and HSPE1 knockdown. Analysis of the protein and mRNA expression levels of HSPE1 and GPX4 in each set of cells showed that knockdown of HSPE1 effectively reduced GPX4 protein levels, which could be reversed by GPX4 overexpression, underscoring a positive interaction between HSPE1 and GPX4, with HSPE1 acting upstream of GPX4. HSPE1 knockdown did not significantly increase GPX4 mRNA expression. Remarkably, rather of directly controlling transcription, HSPE1 influenced GPX4 indirectly by affecting its protein expression (Figure 4B and 4C). Assessment of lipid peroxidation levels revealed that HSPE1 knockdown elevated lipid peroxidation levels, which could be rescued by GPX4 overexpression (Figure 4D). GSH assays demonstrated that GPX4 overexpression substantially increased GSH levels, which had been diminished by HSPE1 downregulation (Figure 4E). In conclusion, HSPE1 could inhibit ferroptosis in BLCA by regulating GSH levels through its interaction with GPX4.

Figure 4.

HSPE1 Inhibits Ferroptosis in BLCA Cells in a GSH-Dependent Manner Through GPX4. (A) Correlation Analysis Between HSPE1 and GPX4. (B) qRT-PCR Analysis of HSPE1 and GPX4 mRNA Expression Levels in Each Group. (C) Western Blotting Analysis of GPX4 and HSPE1 Protein Expression Levels in Cells. (D) Liperfluo Assessment of Lipid Peroxidation Levels in Cells. (E) GSH Testing Kit Evaluation of Cellular GSH Levels

Discussion

In summary, HSPE1 exhibits significant overexpression in BLCA, contributing to cell proliferation, cell cycle progression, and apoptosis inhibition in BLCA cells. Pathway enrichment analysis revealed substantial enrichment of HSPE1 in the GSH metabolism and ferroptosis pathways. Our findings demonstrated that HSPE1 promoted GSH accumulation, suppressed ferroptosis, and reduced lipid peroxidation in cancer cells through rescue experiments involving ferroptosis inhibitors. Exploration of its downstream targets unveiled a robust positive correlation between HSPE1 and the ferroptosis regulator GPX4. By modulating GPX4, HSPE1 acted upstream to regulate cellular lipid peroxidation levels and ferroptosis, as evidenced by rescue experiments.

The HSP family plays a pivotal role in cancer regulatory mechanisms. Beyond well-known proteins like HSP70 and HSP90, HSP family proteins influence cancer progression through various pathways. In melanoma, HSPB8 indirectly triggers autophagy, which inhibits the development of tumor cells. However, in specific cancer types, such as BLCA, HSPB8 exhibits dual functions, both promoting and suppressing malignancy. High expression of HSPB8 and upregulation of HSP27 in BLCA enhance proliferation and migration, with high expression serving as a prognostic indicator for BLCA (Du et al., 2024). HSPE1, a member of the HSP family, has been linked to poor prognosis and aberrant expression in several malignancies. In lung adenocarcinoma, HSPE1, an oxidative stress-related gene, predicts a poorer prognosis post-therapy (Duan et al., 2023). Through qRT-PCR, Western blot validation, and bioinformatics analysis, we confirmed elevated HSPE1 expression in BLCA. High HSPE1 levels in BLCA cells correlated with increased proliferation, apoptosis resistance, and accelerated cell cycle progression to the G2 phase. These findings suggest that HSPE1 plays a critical role in the malignant development of BLCA and may serve as a prognostic marker for poor outcomes in BLCA patients.

We found through pathway enrichment analysis that HSPE1 potentially plays a role in regulating ferroptosis. Ferroptosis is characterized by the presence of reactive oxygen species (ROS) and lipid peroxidation. Lipid peroxidation occurs when free radical or nonradical oxidants damage carbon-carbon double bonds in lipids, particularly polyunsaturated fatty acids (PUFAs), which are crucial for cell membrane integrity. PUFAs, abundant in cell membrane lipids, are vital for cell structure and function but are also susceptible to oxidative stress during ferroptosis (Rochette et al., 2022). Peroxidized lipids generate harmful byproducts like 4-hydroxynonenal and malondialdehyde, exacerbating cellular damage and compromising membrane integrity. GPX4, an essential enzyme, protects cell membranes from lipid peroxidation by converting GSH to glutathione disulfide (GSSG) and peroxidized lipids to safe lipid alcohols. GPX4 and GSH deficiencies can lead to ferroptosis. Targeting GPX4 to induce ferroptosis is a key focus in cancer research due to its role in conferring resistance to ferroptosis in various cancers. Strategies to degrade GPX4 or reduce its expression involve targeting pathways like Wnt/β-catenin and STAT3 (Wang et al., 2022; Zhang et al., 2022). Some HSPs may target GPX4 to trigger ferroptosis. For example, in non-small cell lung cancer, HSP90 interacts with a steroid glycoside to promote GPX4 degradation, leading to ROS accumulation, GSH depletion, and ferroptosis (Zhou et al., 2023). Analysis combining qRT-PCR, Western blotting, and bioinformatics revealed a positive connection between HSPE1 and GPX4. Rescue experiments demonstrated that HSPE1 upregulated GPX4 and GSH levels while reducing lipid peroxidation, suggesting HSPE1 as a potential target for ferroptosis-focused treatments.

Finally, we confirmed high HSPE1 expression in BLCA, facilitating malignant progression. Bioinformatics analysis indicated that HSPE1 reduced ferroptosis by GSH-dependent regulation of GPX4, shedding light on HSPE1’s mechanisms and the HSP family’s role in cancer. Nonetheless, limitations include the lack of in vivo validation in animal models and the absence of confirmation in clinical samples regarding HSPE1 upregulation in cancer tissues. Given the involvement of HSPE1 in mitochondrial protein folding and the known influence of other HSPs on cancer cell glycolysis, we propose that HSPE1 may impact mitochondrial function. However, more investigations are required for verification.