In Vitro Anticancer Activity of Phytol on Human Non-Small Cell Lung Cancer A549 Cells

Abstract

Background:

Non-small cell lung cancer (NSCLC) is the most common type of lung cancer. Many researchers have previously reported that natural compounds from plants or Chinese Traditional Herbs have a potential to treat NSCLC. But it has not been reported that phytol can treat NSCLC. In this research, we first exposed this effect on A549 cells and researched the mechanism.

Methods:

In order to evaluate whether phytol has a role in human NSCLC, a human non-tumoral bronchial epithelial cell line (NL20), adenocarcinomic human alveolar basal epithelial (A549) cell line, and NCI-H69 SCLC (H69) cell line were used for related experiments. After determining that phytol had no toxicity to NL20 cells, A549 cells, or H69 cells, the inhibitory effect of phytol on cancer cell related characteristics of cells were determined by luciferase assay, QRT-PCR, proliferation, invasion, and would healing cellular response experiments. Additionally, the quantification of apoptotic cells has been achieved through flow cytometry. Then, bioinformatics was used to establish a database to screen and speculate on phytol’s corresponding targets in lung cancer. Finally, immunoblotting experiments were used to determine the specific pathways affected by phytol.

Results:

Treatment with phytol at concentrations ranging from 0 to 80 µM for 24 hours was not cytotoxic to the A549 cells and H69 cells. Phytol inhibited AP-1-mediated and NF-κB-mediated luciferase activity in a dose-dependent manner in A549 cells, but not H69 cells. Additionally, phytol significantly inhibited the levels of MMP9, IL-6, VEGFA, IL-8, and NFKBIA in A549 cells, but had no significant effects on H69 cells. Phytol induced significant dose-dependent growth inhibitory effects on A549 cells. A significant decrease in colony formation and migration was observed. Bioinformatic and immunoblotting analysis indicated that phytol inhibited proliferation and migration of A549 cells through the PI3K-Akt signaling pathway.

Conclusions:

Phytol exhibits anticancer activity by inhibiting PI3K-Akt signaling pathway and may be applicable in the clinical prevention and treatment of lung cancer in the future.

Introduction

Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, accounting for about 85% of all lung cancer cases. The main pathologic types include squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. Despite recent advances in therapeutic approaches, such as targeted therapy and immunotherapy, the early diagnosis of NSCLC is difficult and many patients are at an advanced stage at diagnosis, so the treatment for NSCLC remains a major challenge. ¹ Traditional treatments, including surgical excision, radiation, and chemotherapy, are limited due to drug resistance and side effects. Therefore, it has become a focus to search for new anticancer drugs. Natural products development is an effective way to search anticancer drugs from bionts, like foods, plants, and Chinese herbs. ² These natural compounds usually have low toxicity and good biocompatibility, and can effectively intervene in the process of cancer occurrence, development, and metastasis, such as catechins in green tea, organic sulfides in garlic, gingerol in ginger, and flavonoids in Scutellaria baicalensis.^{3 -5} So this is a potential way to search anticancer drugs.

Phytol, existing in many plants and microalgae, is a diterpenoid alcohol and one of the main products of chlorophyll catabolism. Phytol has many biological activities, including antioxidant, antibacterial, anti-inflammatory, and immunomodulatory effects. In recent years, its anticancer activity has gotten widespread attention by researchers. Phytol can interfere with the proliferation and survival of cancer cells in many ways. For example, studies have shown that phytol can induce apoptosis by increasing pro-apoptotic proteins expression and inhibiting anti-apoptotic proteins expression, thereby playing the anticancer role.^6,7 In addition, phytol can inhibit the migration and invasion of cancer cells, which might be by regulating the epithelial-mesenchymal transition (EMT) and remodeling cytoskeleton.^8,9 These studies provide strong evidence for phytol as a potential anticancer drug.

Cell proliferation and migration are the main features of tumorigenesis and development. In normal cells, these processes are tightly regulated, but in cancer cells, they are often out of control due to abnormal activation of some signaling pathways. Thereinto, as a central regulatory axis, PI3K/AKT signaling pathway plays an important role in regulating cell survival, proliferation, and migration. The overactivation of the PI3K/AKT signaling pathway can promote cell cycle progression, inhibit apoptosis, and enhance cell migration and invasion by activating the downstream protein like mTOR, GSK3β, and FOXO.^{10 -12} In addition, PI3K/AKT signaling pathway also interacts with other pathways, such as MAPK and NF-κB, to form complex networks. ¹³ AKT can directly phosphorylate and activate NF-κB and promote the release of NF-κB into nucleus, thereby enhancing the activation of NF-κB signaling pathway to promote cancer cells proliferation and migration. ¹⁴

In this research, we investigated the anti-NSCLC activity of phytol and the underlying mechanisms in vitro. The studies showed that phytol can significantly inhibit cellular proliferation and migration, suggesting the anticancer activity. The results of network pharmacology analysis indicated that the potential pathway might be PI3K/AKT pathway. Further, we assessed the effect of phytol on this pathway. The results showed that phytol can significantly regulate PI3K/AKT/NF-κB pathway. So, these results implied phytol as a potential drug for treating NSCLC.

Materials and Methods

Materials

A human non-tumoral bronchial epithelial (NL20) cell line (ATCC, Cat# CRL-2503, RRID: CVCL_3756), adenocarcinomic human alveolar basal epithelial (A549) cell line (ATCC, Cat# CRM-CCL-185, RRID: CVCL_A549) and NCI-H69 SCLC (H69) cell line (ATCC, Cat# HTB-119, RRID: CVCL_1579) were purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA). 1X phosphate buffered saline (PBS), 0.25% Trypsin solution and the antibiotic reagents (penicillin and streptomycin), Roswell Park Memorial Institute 1640 (RPMI 1640), HAM’S F-12 Nutrient Mixtures (F-12), Opti-MEM Reduced Serum Medium, and Fetal bovine serum (FBS) was from Gibco (Grand Island, NY, USA). Phytol and MTT were purchased from Sigma Aldrich (St. Louis, MO, USA). Falcon cell culture inserts (0.8 mm) for culture plate and were obtained from Corning Incorporated (Corning, NY, USA). Polyvinyl difluoride (PVDF) membranes (0.45 mm) were brought from Merck Millipore (Burlington, MA, USA).

Cell Culture

NL20 cells, A549 cells, and H69 cells were cultured in F-12 and RPMI supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotic solution (Cytiva Hyclone) at 5% CO₂ at 37°C (Thermo Fisher Scientific, Waltham, MA, USA).

MTT Assay

Cells were grown overnight in 96-well plates. Phytol was treated in a concentration-gradient-dependent manner for 24 hours. After incubation, 100 μl of the supernatant was removed and 10 μl MTT (Amresco) solution was added to each well at a stock concentration of 5 mg/ml. After 4 hours, the reaction was stopped by adding an equal volume of the MTT stop solution. After incubation in a 37°C incubator for 20 hours, the absorbance (BioTek Instruments Inc., RRID: SCR_019741) was measured at 570 nm to obtain the MTT results.

Luciferase Reporter Gene Assay

A549 cells and H69 cells were seeded in 24-well plates and culture. They were co-transfected with genes encoding TRIF, NF-κB-luc, AP-1-luc, and β-galactosidase using polyetherimide (PEI, Opti-MEM Reduced Serum Medium, Sigma Chemical Company). After 24 hours of culture, the culture medium was replaced with fresh medium supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum and treated with phytol and continued to be cultured. The culture medium was then removed and treated with 300 μl of 1X reporter lysis buffer (Promega). After incubation at room temperature for 3 minutes, the cells were scraped to collect the supernatant, and 20 μl of the supernatant and 50 μl of luciferin were added to the fluorescent plate. Luminescence was measured using a photometer (BioTek Instruments Inc., RRID: SCR_019741) and normalized to β-gal activity.

Quantitative Real-Time PCR (QRT-PCR)

We introduced A549 cells and H69 cells into a 6-well plate. RNA was isolated using TRIzol reagent (Bio-D Inc.). Perform cDNA synthesis using the cDNA synthesis kit (Thermo Fisher Scientific, Cat# K1621). After preparing cDNA with reverse transcriptase, qPCRBIO SyGreen Blue Mix Lo-ROX (Bio-Rad CFX96 Real-Time PCR Detection System, RRID:SCR_018064) and CFX96 Touch real-time PCR detection system (Bio-Rad, RRID:SCR_018064) were utilized. The relevant primer information is presented in Table 1 (GAPDH served as an internal control).

Table 1.

DNA sequences of qRT-PCR primers.

Primer name	Sequence
GAPDH_F	GAAGGTGAAGGTCGGAGTCA
GAPDH_R	TTGAGGTCAATGAAGGGGTC
MMP9_F	GGGACGCAGACATCGTCATC
MMP9_R	TCGTCATCGTCGAAATGGGC
Bcl-2_F	GACTGAGTACCTGAACCGGC
Bcl-2_R	CAGCCAGGAGAAATCAAACAG
VEGFC_F	GTGTCCAGTGTAGATGAACTC
VEGFC_R	ATCTGTAGACGGACACACATG
IL-6_F	AGTGAGGAACAAGCCAGAGC
IL-6_R	CATTTGTGGTTGGGTCAGG
NFKBIA_F	GTCAAGGAGCTGCAGGAGAT
NFKBIA_R	TCATGGATGATGGCCAAGT
IL-8_F	CGGAAGGAACCATCTCACTG
IL-8_R	AGCACTCCTTGGCAAAACTG

Protein Quantitation and Immunoblotting Analysis

The harvested A549 cells were lysed in RIPA buffer (Cincinnati), and the protein concentration was determined by Bradford protein assay (BIO-RAD, Hercules, California, USA, RRID:SCR_019037). A total of 30 μg of protein extracted from all samples was loaded on SDS gels and then transferred to PVDF membranes. The membranes were blocked with 3% BSA for 1 hour at room temperature and then incubated with primary antibodies anti-p-PI3K, anti-PI3K, anti-p-AKT, anti-AKT, anti-p-PDK1, anti-PDK1, anti-p-p65, anti-p65, anti-p50, anti-p-mTOR, anti-mTOR, anti-β-actin (Cell Signaling Technology, Cat# 4292, RRID:AB_329869; Cat# 4228, RRID:AB_659940; Cat# 4056, RRID:AB_331163; Cat# 9272, RRID:AB_329827; Cat# 3061, RRID:AB_2161919; Cat# 3062, RRID:AB_2236832; Cat# 3033, RRID:AB_331284; Cat# 3033, RRID:AB_331284; Cat# 8242, RRID:AB_10859369; Cat# 13586, RRID:AB_2665516; Cat# 5536, RRID:AB_10691552; Cat# 2983, RRID:AB_2105622; Cat# 4967, RRID:AB_330288), and anti-p-p50 (Santa Cruz Biotechnology, Cat# sc-271908, RRID:AB_10612088) at 4°C overnight. β-actin was used as a loading control. After incubation, the membranes were washed 3 times with TBST for 10 minutes each. Subsequently, the membranes were incubated with the corresponding secondary, antibodies rabbit antibody and mouse antibody (Cell Signaling Technology, Cat# 7074, RRID: AB_2099233 and Cat# 7076, RRID: AB_330924) for 3 hours at room temperature. The dilution of primary and secondary antibodies with BSA was 1:2500. Finally, all membranes were visualized using chemiluminescent western blotting reagents Bio Rad ChemiDoc MP Imaging System (RRID:SCR_019037) and EzWestLumi plus (ATTO Corporation, Taito-ku, Tokyo, Japan). In addition, all bands of protein expression were analyzed and quantified by using Image J (ImageJ, RRID:SCR_003070).

Proliferation Assay

Cell proliferation assay was used to evaluate the effect of phytol on the growth rate of A549 cells. Cells were seeded into 60 mm plates and 24 hours after the addition of phytol, the cells were detached with trypsin and replated. The next day, 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) was added. After 4 hours, MTT stop solution was added and incubated in a 37°C cell culture incubator for 16 to 20 hours. The absorbance at 570 nm was then measured by a microplate reader. Repeat on days 0, 2, 4, and 6, and the cell growth rate was calculated at the end.

Would Healing Assay

Two groups of A549 cells with and without phytol were prepared in advance. After inoculating the cells and culturing for 24 hours, a straight line was drawn in the middle of each well. The cell confluence was monitored under a microscope every 6 hours. The confluence of each well was calculated using Image J.

Invasion Assays

For the Transwell invasion experiment, cells (1 × 105) were suspended a in 0.5 ml serum-free medium and inserted onto the upper compartment of an invasion chamber coated with Matrigel (BD Biosciences). A chemoattractant was placed in the lower compartment. Invasive cells were fixed, stained, and counted under a microscope after 24 hours.

Bioinformatic Data Analysis

First, we analyzed phytol gene targets (http://www.swisstargetprediction.ch/) and related diseases (https://www.genecards.org/). KEGG pathway enrichment analysis was then used to identify common target genes and signaling pathways related to anticancer response. Subsequently, the obtained results were visualized using an online bioinformatics platform (URL http://www.bioinformatics.com.cn/).

Data Analysis and Statistics

In the present study, all experiments were performed a minimum of 3 times. The statistical analysis was conducted using GraphPad Prism 8.0 software (RRID:SCR_002798). The differences between the groups were determined by a 2-tailed Student’s t-test, while the differences between 3 (or more) groups were analyzed using analysis of variance (1-way ANOVA). The level of significance was designated as follows: *P < .05; **P < .01; ***P < .001; ****P < .0001.

Results

Cytotoxicity of Phytol to A549 Cells, NL-20 Cells, and H69 Cells

In this study, we first treated NL-20 cells, H69 cells, and A549 cells with different concentrations (10, 20, 40, 60, 80, 100, and 200 µM) of phytol for 24 hours and then performed MTT assay to determine the cytotoxicity of phytol. Phytol treatment at concentrations ranging from 40 to 80 µM for 24 hours did not significantly affect the viability of A549 cells compared to the DMSO-treated control group. However, prolonged exposure to phytol at these concentrations resulted in a significant reduction in A549 cell viability (Figure 1B), and its effect was similar with Camptothecin (Figure S2). In contrast, the viability of NL20 and H69 cells remained unaffected after 72 hours of phytol treatment (Figure 1C). The calculated IC50 values for A549, NL20, and H69 cells were 62.64 ± 5.91 µM, 258.5 ± 34.85 µM, and 293.3 ± 62.35 µM, respectively. These findings indicate that phytol effectively inhibits the proliferation of A549 cells while exhibiting minimal cytotoxicity in normal lung cells.

Figure 1.

Effect of phytol on cell viability of A549, NL-20, H69 cells and the transcriptional activation of NF-kB and AP-1. (A) The structure of phytol. (B) MTT assays of cell viability of A549 with different concentrations of phytol treatment for different times. (C) MTT assays of cell viability of A549, NL-20, and H69 with different concentrations of phytol treatment for 72 hours. (D-G) A549 and H69 cells were co-transfected NF-κB-luc or Ap-1-luc and TRIF, respectively. After 24 hours, the cells were treated with Phytol for 12 hours, and then the luminescence of each well was measured.

Effects of Phytol on the Transcriptional Activation of NF-kB and AP-1

We employed a luciferase assay to determine whether phytol could regulate the NF-κB and AP-1 promoter assays. We demonstrated that phytol inhibited NF-κB-mediated luciferase activity (Figure 1D) and AP-1-mediated luciferase activity (Figure 1F) in a dose-dependent manner in A549 cells, but not H69 cells (Figure 1E and G).

Effects of Phytol on the Cancer Markers

In lung cancer cells, MMP-9, IL-6, Bcl-2, VEGFA, IL-8, and NFKBIA play important roles in the occurrence, development and metastasis of tumors. As shown in Figure 2A, the level of MMP9 decreased with 60 μM phytol to 40% of the control (0 μM; P < .01), and 80 μM reduced it by 50% (P < .01). VEGFA levels were reduced to 25% of the control after 60 μM phytol treatment (P < .01) and 40% after 80 μM phytol treatment (P < .001). Likewise, IL-8, IL-6, and NFKBIA levels with 80 μM phytol were reduced to 50% (P < .01), 60% (P < .001), and 65% (P < .001), respectively. Although the levels of Bcl-2 were not statistically significant, they also showed a downward trend. Taken together, Phytol significantly inhibited the levels of MMP9, IL-6, VEGFA, IL-8, and NFKBIA in A549 cells, but had no significant effects on H69 cells (Figure 2B). Based on above data, we would focus on A549 cells.

Figure 2.

Effects of phytol on the cancer markers. (A and B) Different concentrations (0, 40, 60, and 80 μM) of Phytol on MMP-9, IL-6, Bcl-2, VEGFA, IL-8, and NFKBIA in A549 and H69 cells at RNA expression level. The control group was incubated in the medium without Phytol.

Inhibition of Phytol on the Proliferation of A549 Cells

The anti-proliferative effect of phytol on A549 cells was detected by MTT assay. After treatment with phytol (20, 40, 60, and 80 µM) for 2 to 6 days, the cell viability of A549 cells was evaluated. As shown in Figure 3A, the proliferation of A549 cells treated with phytol was significantly inhibited compared with the untreated group in a dose- and time-dependent manner. Furthermore, we further confirmed these effects by performing colony formation assays. After treatment with different concentrations of phytol, A549 cells were cultured for another 14 days, and colonies were counted. As shown in Figure 3B, phytol reduced colony formation in a dose-dependent manner. These results suggested that phytol suppressed the growth of lung cancer cells in vitro.

Figure 3.

Effect of phytol on proliferation and migration of A549 cells. (A) The effect of phytol on the proliferation of A549 cells was evaluated by MTT assay. (B) Colony formation assay was performed to measure the colony forming ability. (C) Wound healing assay in A549 cells after treating phytol for 0 hour, 24 hours. (D) Migration rate. (E) Invasion test was used to determine the effect of phytol on the invasion of A549 cells.

Inhibition of Phytol on the Migration of A549 Cells

The effect of phytol on A549 cell migration was determined by wound-healing assay, in which cells were stimulated to migrate by physically wounding cells seeded on plates. As illustrated in Figure 3C, a significant increase of cells in the denuded area was observed under light microscopy at the cells treated with DMSO for 24 hours. In contrast, A549 cells exposed to 40, 60, and 80 µM phytol showed a reduced ability to migrate and fill the wound area. The quantitative data in Figure 3D suggested that phytol inhibited the migration of A549 cells in a dose-dependent manner.

Inhibition of Phytol on the Invasion of A549 Cells

Cell invasion is one of the important factors of tumor cell metastasis. The invasion test was used to determine the effect of phytol on the invasion of A549 cells. As shown in Figure 3E, the number of invaded cells increased significantly after DMSO treatment for 24 hours. In contrast, A549 cells exposed to 40, 60, and 80 µM phytol showed a reduced ability to invade.

Bioinformatic Analysis of Phytol Inhibiting A549 Cells

We used network pharmacology to evaluate the ability of phytol to inhibit A549 cell viability and induce apoptosis. A method was used to establish a compound-target network. As shown in Figure 4A, putative targets of phytol from Swiss Target Prediction and Targetnet, and lung cancer-related targets from Genecards were constructed. The interaction network of phytol comprised 100 putative targets of phytol and 999 lung cancer-related targets, 22 targets for phytol in lung cancer were identified. KEGG pathway analysis resulted in significantly enriched pathways, including cancer pathways, PI3K-Akt signaling pathway, cancer proteoglycans, EGFR tyrosine kinase inhibitor resistance, focal adhesion, JAK-STAT signaling pathway, apoptosis, etc. Figure 4C showed the top 10 enriched pathways. Among them, the most significantly enriched pathway is the PI3K-Akt signaling pathway, followed by pathways related to non-small cell lung cancer. The ROC curve results also showed the sensitivity and specificity of the PI3K/AKT pathway (Figure 4D).

Figure 4.

Bioinformatic analysis of phytol inhibiting A549 cells. (A) The interaction network comprised predicted phytol targets and lung cancer-related targets. (B) GO enrichment analysis. (C) KEGG pathway enrichment analysis. (D) ROC curve analysis.

Effects of Phytol on the PI3K/Akt Signaling

To further investigate the PI3K-Akt signaling, a series of studies were performed to check the expression of candidate signaling molecules after phytol stimulation. Consistent with above results, incubation of A549 cells with phytol for 24 hours decreased the levels of phosphorylated PI3K, PDK1, Akt, mTOR, p65, and p50 (Figure 5). Quantitative results showed that 80 μM phytol reduced the expressions of phosphorylated PI3K, PDK1, Akt, mTOR, p65, and p50 by 66%, 58%, 68%, 67%, 78%, and 80% of the control (0 μM; P < .001), respectively. Our results indicated that phytol inhibited proliferation and migration of A549 cells through the PI3K-Akt signaling pathway.

Figure 5.

Effects of phytol on the expressions of PI3K/Akt pathway related proteins. The protein expressions involved in the PI3K/Akt pathway such as (A) p-PI3K, PI3K, p-PDK1, PDK1, p-Akt, and Akt, (B) p-mTOR, mTOR, p-p65, p65, p-p50, and p50 were determined by Western blot assay. All bands were quantified by Image J.

Discussion

Lung cancer continues to be 1 of the leading causes of cancer-related deaths globally, with non-small cell lung cancer (NSCLC) accounting for approximately 85% of all cases. ¹⁵ The high mortality rate is largely attributed to late-stage diagnosis and the aggressive nature of the disease. ¹⁶ In addition, metastasis to lymph nodes or distant organs is often present in the early stages of NSCLC, significantly increasing the complexity of treatment. Its tumor microenvironment also has immune escape properties, making it more difficult for the immune system to recognize and eliminate tumor cells. ¹⁷ Non-small cell lung cancer is currently treated mainly through surgery, radiotherapy, chemotherapy, and targeted and immunotherapy. ¹⁸ Targeted and immunotherapies significantly extend survival, but there are problems with drug resistance and ineffectiveness in some patients. Side effects and treatment costs are major limitations.

At present, the research on the activity of natural products attracts more and more attention. It shows potential in the treatment of non-small cell lung cancer due to its multi-target action and low side effects. Many natural compounds have anti-tumor, anti-metastasis and immunomodulatory properties and can be used in combination with other therapies. ¹⁹ Phytol (Figure 1A) is a natural terpene compound, which is mainly extracted from the leaves, flowers, and seeds of plants, especially in green algae, Perilla, and peppermint. It is commonly found in vegetable oils and can be produced by the degradation of fatty acids. ²⁰ Phytol has pharmacological activities such as anti-tumor, anti-inflammatory, antioxidant, and immunomodulatory, which can inhibit tumor cell proliferation, reduce inflammatory response, remove free radicals, and enhance immune function.^21,22 However, up to now, phytol has not been reported on whether it can inhibit the development of NSCLC and its mechanism of action.

The proliferation, migration and clonal formation of tumor cells are the key processes of tumor development and metastasis. ²³ Proliferation drives the continuous division and expansion of tumor cells and promotes the growth of tumor volume. ²⁴ Migration causes tumor cells to shed from the primary site, enter the blood or lymphatic system, and metastasize to other organs and clonal formation is the growth and reproduction of tumor cells in a new environment, which further promotes the spread and drug resistance of tumors. ²⁵ Based on the IC50 value in different cell lines, 40, 60, and 80 µM were selected as the subsequent experimental concentrations. NF-κB regulates the expression of several pro-inflammatory cytokines, which not only promote inflammation, but also stimulate tumor cell proliferation. In addition, NF-κB up-regulates vascular endothelial growth factor (VEGF) and promotes epithelial-mesenchymal transformation, thereby promoting tumor progression. Luciferase results also showed that phytol may regulate the progression of non-small cell lung cancer by regulating NF-κB and AP-1 pathways, but it had no significant effect on small cell lung cancer (Figure 1B). MMP9 promotes tumor cell invasion and metastasis through matrix degradation. VEGFA induces angiogenesis, which provides nutrients and oxygen for tumor growth, and NFKBIA influences inflammatory responses and tumor cell survival by regulating the NF-κB signaling pathway. They play an important role in tumorigenesis and development, and together they participate in the remodeling and regulation of the tumor microenvironment. The results of Figure 2 showed that Phytol can significantly reduce the expression of cancer-promoting factors in non-small cell lung cancer A549 but cannot reduce the expression in small cell lung cancer H69. According to the results in Figure 3, phytol can reduce the proliferation, migration and cloning ability of A549 cells in a concentration-dependent manner, but there is no effect on apoptosis (Figure S1), indicating that Phytol can epigenetically reduce the development of non-small cell lung cancer.

The PI3K-AKT signaling pathway plays a key role in tumor regulation, accelerating tumor growth and spread by promoting cell proliferation, inhibiting apoptosis, enhancing migration and invasion, and promoting angiogenesis and metabolic reprograming. PDK1 (3-phosphoinositol-dependent protein kinase 1), as an important upstream regulator of the PI3K-AKT signaling pathway in tumors, plays a variety of key roles in promoting the occurrence and development of tumors.^21,26,27 Phytol has been reported in several articles to have antioxidant, anti-apoptotic and immunomodulatory properties, but there has been no report on whether it can inhibit the proliferation of lung cancer cells.^22,28 According to bioinformatics analysis and KEGG-GO analysis, phytol has a major regulatory role in the PI3K-AKT signaling pathway and non-small cell lung cancer (Figure 4). In addition, western blot results also showed that phytol can reduce the phosphorylation levels of PI3K, PDK1, and AKT in a concentration-dependent manner (Figure 5A). mTOR plays a very important role in the process of tumor development, promoting the rapid development of tumors by regulating cell growth, proliferation and metabolism, and participating in anti-apoptosis and neovascularization. ²⁹ p65 (RelA) and p50, as core subunits of the NF-κB signaling pathway, work together to activate gene expression related to inflammation, cell survival, and anti-apoptosis, enhance tumor cell survival, and promote invasion and metastasis.^30,31 According to the results of Figure 5B, phytol can reduce the expression of mTOR, p65, and p50 phosphorylation levels in A549 cells in a concentration-dependent manner.

Phytol inhibits the transcriptional activity of NF-κB by inhibiting the PI3K-Akt signaling pathway (Figure 6), and thus exhibits anticancer activity, which provides a possibility for drug discovery in the treatment of non-small cell lung cancer.

Figure 6.

Schematic summary of the phytol-mediated anti-cancer in human non-small cell lung cancer A549 cells.

Supplemental Material

sj-docx-1-ict-10.1177_15347354251344592 – Supplemental material for In Vitro Anticancer Activity of Phytol on Human Non-Small Cell Lung Cancer A549 Cells

Supplemental material, sj-docx-1-ict-10.1177_15347354251344592 for In Vitro Anticancer Activity of Phytol on Human Non-Small Cell Lung Cancer A549 Cells by Jie Yu, Feng Jin, Yingqi Tang and Yumin Huang in Integrative Cancer Therapies