Binding of prorenin to (pro)renin receptor induces the proliferation of human umbilical artery smooth muscle cells via ROS generation and ERK1/2 activation

Abstract

Introduction:

Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin–angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects.

Materials and methods:

In this study, we investigated the effects of prorenin and PRR on the proliferation of human umbilical artery smooth muscle (HUASM) cells and explored the possible mechanisms underlying these effects.

Results:

The binding of prorenin to PRR can promote proliferation and upregulate the anti-apoptotic protein Bcl-2 and downregulate the pro-apoptotic protein Bax independently of AngII in HUASM cells. In addition, the binding of prorenin to PRR can also increase the production of reactive oxygen species (ROS) and the phosphorylation of extracellular signal-regulated kinase (ERK1/2) independently of AngII. The pretreatment of HUASM cells with an NADPH oxidase inhibitor DPI decreased the production of ROS and also decreased the phosphorylation of ERK1/2. Furthermore, pretreatment of HUASM cells with DPI and the ERK1/2 inhibitor PD98059 significantly attenuated the prorenin-induced proliferation and regulation of apoptosis factors.

Conclusion:

Binding of prorenin to PRR can induce HUASM cell proliferation via the ROS generation and ERK1/2 activation.

Keywords

(pro)renin receptor ROS atherosclerosis proliferation apoptosis

Introduction

Since the function of the (pro)renin receptor (PRR) was proposed,¹ it has been considered as a new component of the renin–angiotensin system (RAS). Prorenin, which has been generally assumed to be an inactive precursor of renin, can bind to its cognate receptor, inducing a conformational change that renders it enzymatically active.^1-4 Prorenin synthesis can occur at adrenal tissue, eye and ovaries,^5-7 and the physiological concentration of prorenin in plasma is in the picomolar range. For as of yet unknown reasons, the concentration of prorenin in human plasma is higher than that of renin⁸ and is 100 times higher in microalbuminuric diabetic subjects.^5,9,10 High levels of prorenin in human plasma may indicate that the body is in a pathological condition, thus prorenin could be predictive of disease. The binding of prorenin to PRR not only increases the production of AngII^11,12 but also activates signal transduction pathways that elicit fibrotic^13,14 and proliferative effects^15,16 independently of AngII. AngII is the key component of the RAS and can elicit proliferative, fibrotic and proinflammatory effects through a series of mechanisms that are commonly linked to the production of reactive oxygen species (ROS). ROS play an important role in cardiovascular diseases, such as hypertension, atherosclerosis and heart failure.¹⁷ The struggle between proliferation and apoptosis of vascular smooth muscle cells (VSMCs), which participate in the initiation and early progression of atherosclerosis,¹⁸ was demonstrated to be mediated by AngII through ROS production, which depends on the activation of NAD(P)H oxidase.^19-23 However, whether prorenin could induce apoptosis in human umbilical artery smooth muscle (HUASM) cells has not been reported, and whether and how prorenin and PRR affect the production of ROS in HUASM cells remain unknown.

In this study, we hypothesized that the binding of prorenin to PRR can promote proliferation and inhibit apoptosis, and we investigated the role of ROS in the prorenin-induced effects on HUASM cells. To evaluate the PRR-mediated, AngII-independent effects of prorenin, we used Valsartan (Ang II type 1 receptor blocker) and PD123319 (Ang II type 2 receptor blocker) and PRR-targeted siRNA.

Materials and methods

Chemicals

Prorenin was purchased from Cayman Chemical Company (Michigan, USA). PD123319 and DPI were purchased from Sigma-Aldrich (Saint Louis, MO, USA). Valsartan was obtained from Beijing Novartis Company (Beijing, China). The ERK1/2 inhibitor PD98059 was purchased from Abcam (Cambridge, UK). PRR siRNA and transfection reagents were purchased from Invitrogen (California, USA).

Cell culture

Human umbilical cords were collected from healthy pregnant women at The First Affiliated Hospital of Dalian Medical University. The pregnant women gave written informed consent prior to delivery. This study was approved by the Ethics Committee of The First Affiliated Hospital of Dalian Medical University.

Under sterile conditions, umbilical arteries were isolated from human umbilical cords. The arteries were dissected longitudinally, and the intimas of the arteries were scraped with scissors to remove the endothelium. Next, the arteries were cut into small pieces of tissue (1×1×1 mm). The tissue samples were placed in 35 mm culture plates and incubated at 37°C and 5% CO₂. After 2 h, 3 ml of Medium 231 (Gibco, California, USA) supplemented with Smooth Muscle Growth Supplement (SMGS, Gibco, California, USA) and 1× strength antibiotics/antimycotic (HyClone, Logan City, Utah, USA) was gently transferred into the culture plates. The media were refreshed every 3 days.

Cells began growing from the explants within 1 week and became confluent in approximately 3–4 weeks. The HUASM cells were cultured in Medium 231 with SMGS for trypsinization, passage, or freezing, according to standard protocols. We used second-to-fourth passage HUASM cells in our experiments.

Specific siRNA and transfection

The cDNA sequence of the PRR gene was obtained from GenBank (NM_005765.2), and the targeting sequences of the siRNAs were designed and chemically synthesized by Invitrogen (California, USA). The nucleotide sequences were as follows: 5’-GCUCCGUAAUCGCCUGUUU -3’ (sense), and 5’-AAACAGGCGAUUACGGAGC -3’ (antisense). As a negative control, a non-targeting scrambled siRNA (control siRNA) was also purchased. Cells were plated in 6-well plates, and the siRNAs were transfected into the cells using Lipofectamine RNAiMAX Reagent (Invitrogen, California, USA) according to the manufacturer’s protocols.

Immunofluorescence

HUASM cells were seeded into 24-well plates at 5000 cells per well and grown in Medium 231 supplemented with SMGS for 1–2 days. The cells were rinsed with phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde (30 min, 4°C), washed three times with PBS, and permeabilized for 20 min with 0.3% Triton-X100. The cells were washed with PBS and then incubated at room temperature for 1 h in PBS with 5% bovine serum albumin (BSA). Labeling experiments were performed with a mouse anti-human antibody against α-smooth muscle actin (1:100, BOSTER, Wuhan, China) or PRR (1:100, Abcam, Cambridge, UK). Fluorescein-conjugated AffiniPure goat anti-mouse IgG antibodies (ZSGB-BIO, Beijing, China) or Rhodamine (TRITC)-conjugated AffiniPure goat anti-rabbit IgG antibodies (ZSGB-BIO, Beijing, China) diluted 1:100 in PBS (1 h, room temperature) were used for visualization. Hoechst 33258 (37°C, 5 min) was used to stain the cell nuclei. The cells were rinsed and assessed by fluorescence microscopy.

Measurement of cell proliferation

The proliferation of HUASM cells was measured using a Cell Counting Kit-8 (CCK-8) (Beyotime, Shanghai, China), according to the manufacturer’s protocol. Briefly, the HUASM cells were cultured in triplicate at 2×10³ cells/well in 96-well plates. After different treatments, 10 μl of CCK-8 reagent was added to each well. After 1 h of incubation at 37°C, the absorbance at 450 nm was measured using a microplate reader. The relative levels of cell proliferation for each group were normalized to the levels of the control group, which represented 100%.

ROS measurement

ROS production was measured using a Reactive Oxygen Species Assay Kit (Beyotime, Shanghai, China). Briefly, 1×10⁶ HUASM cells seeded into 6-well plates were treated with prorenin for 24 h. At the end of the treatment period, the cells were washed once with PBS and then incubated with DCFH-DA (5 μM) in medium for 20 min at 37°C in the dark. Next, the cells were washed with PBS three times, trypsinized, resuspended in PBS, and analyzed by flow cytometry. The fluorescence intensity of the cells was measured at 488 nm using a flow cytometer (BD FACS AriaII, USA).

Real-time PCR

Total RNA was extracted from cells using the TRIzol reagent (Invitrogen, California, USA) according to the manufacturer’s protocols. cDNA was synthesized from total RNA using the PrimeScript RT Master Mix (TaKaRa, Dalian, China). mRNA expression levels were evaluated by real-time PCR using a LightCycler (Roche Diagnostics) and SYBR Premix Ex Taq II (TaKaRa, Dalian, China). The amplification reactions were performed in a total volume of 20 μl and cycled 40 times after initial denaturation (95°C for 30 s) with the following parameters: 95°C for 5 s and 60°C for 20 s. GAPDH was used as the internal control. All of the primers were designed by TaKaRa (Table 1).

Table 1.

Primer series of Bcl-2, Bax, ATP6AP2 and GAPDH gene.

Gene	Primer sequence(5’-3’)	Sequence	Product
Bcl-2	F: AACATCGCCCTGTGGATGAC	NM_000633.2	146 bp
	R: AGAGTCTTCAGAGACAGCCAGGAG
Bax	F: TTGCTTCAGGGTTTCATCCA	NM_138761	113 bp
	R: AGACACTCGCTCAGCTTCTTG
ATP6AP2	F: TGGAAATTGGCCTATACCAGGAG	NM_005765.2	129 bp
	R: GTAGCCCGAGGACGATGAAAC
GAPDH	F: GCACCGTCAAGGCTGAGAAC	NM_002046	138 bp
	R: TGGTGAAGACGCCAGTGGA

Western blot

Cellular proteins were extracted with lysis buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 2 mg/ml aprotinin and 1 mM PMSF) for 30 min at 4°C. The extracts were centrifuged at 12,000×g for 15 min at 4°C. Then, supernatants containing the total cellular protein were harvested. The protein concentrations were quantified using the BCA Protein Assay Kit (Keygen, Nanjing, China). The total protein extracts (30 μg) were electrophoretically separated using 10% SDS-polyacrylamide gels and transferred electrophoretically onto a polyvinylidene difluoride membrane (0.45 μm pore size). The blots were blocked for 60 min at room temperature with 5% skimmed milk in PBS with Tween-20. Immunoblotting was performed using anti-phospho-ERK 1/2, anti-ERK 1/2 (Bioworld Technology, Minneapolis, USA, dilution 1:750), anti-Bcl-2 (Santa Cruz, California, USA, dilution 1:200), anti-Bax (Santa Cruz, California, USA, dilution 1:500) and anti-PRR (Abcam, Cambridge, UK, dilution 1:700) antibodies overnight at 4°C. After three washes with PBST at 10 min, the membrane was incubated with horseradish peroxidase-conjugated secondary antibodies (dilution 1:1500, ZHONGSHAN, Beijing, China) for 1 h at room temperature. The blots were visualized using ECL Plus according to the manufacturer’s protocols. Blotting with an anti-β-actin (dilution 1:1000, Bioss, Beijing, China) antibody served as an internal control.

Statistical analysis

The data were subjected to a one-way analysis of variance (ANOVA) using SPSS 16.0 software, and the least significant difference (LSD) test or the Dunnett T3 test were used for post-hoc subgroup analysis. All of the data are expressed as the mean values ± SD of three independent experiments. The data were considered statistically significant when p < 0.05.

Results

Verification of vascular smooth muscle cells and the location PRR in HUASM cells

We observed HUASM cells that appeared fusiform or polygonal in shape by light microscopy (Figure 1(a)). Because smooth muscle cells express the smooth muscle myofilament protein α-smooth muscle actin (SMA), we evaluated α-SMA (Figure 1(b–d)) by fluorescence immunohistochemistry and observed the uniform and filamentous expression of α-SMA in the HUASM cells. We also determined the distribution of PRR in HUASM cells by fluorescence immunohistochemistry and detected the cytoplasmic expression of PRR (Figure 1(e–g)). We can see that the red fluorescence represents the PRR expression, and find that around the cell nucleus the PRR expression was higher.

Figure 1.

Verification of vascular smooth muscle cells and the localization of PRR in HUASM cells.

Effect of prorenin on proliferation in HUASM cells

Cell proliferation was assayed using a CCK-8 assay. We treated HUASM cells with 0.1, 1 and 10 nM prorenin for 24 h in the presence of Valsartan and PD123319 and found that 10 nM prorenin most significantly induced the proliferation of HUASM cells independently of AngII (Figure 2(a)). Next, we observed the effect of prorenin on proliferation at different time points and found that with increasing time, the proliferative effect became more significant (Figure 2(b)).

Figure 2.

Effects of prorenin on the proliferation of HUASM cells.

We next determined whether prorenin could affect the expression of apoptosis-related factors. As shown in Figure 2, both protein and mRNA levels of anti-apoptotic Bcl-2 and pro-apoptotic Bax were upregulated and downregulated, respectively, in the 10 nM group compared with none and con group. These results indicated that prorenin can regulate the expression of Bcl-2 and Bax in HUASM cells.

Downregulation of PRR inhibits the prorenin-induced proliferation of HUASM cells

To determine whether the effects of prorenin are mediated by the PRR in HUASM cells, HUASM cells were transfected with PPR-targeting siRNA. At 72 hours after transfection, the levels of PRR mRNA were the most significantly reduced by 82% (Figure 3(a)), and the PRR protein was reduced to barely detectable levels (Figure 3(b)).

Figure 3.

Effect of siRNA-mediated PRR knockdown assessed at the mRNA and protein levels.

Transfection with a PRR siRNA significantly decreased the effects that prorenin (10 nM at 24 h) elicited on the proliferation of HUASM cells (Figure 4(a)). The expression of Bcl-2 and Bax were also affected by PRR. As shown in Figure 4, the upregulated expression of Bcl-2 and the downregulated expression of Bax were altered, at both the protein and mRNA levels, after transfection with the PRR siRNA. These results indicated that the prorenin-induced effects in HUASM cells were mediated by PRR.

Figure 4.

Downregulation of PRR inhibits the prorenin-induced proliferation of HUASM cells.

Prorenin promotes the production of ROS in HUASM cells

Although prorenin can promote the proliferation of HUASM cells, the underlying mechanism remains unclear. Thus, we first examined whether prorenin elicits an effect on the production of ROS in HUASM cells. We found that prorenin increases the production of ROS in a concentration-dependent manner and that the treatment with the nitric oxide synthase inhibitor DPI could inhibit this ROS production (Figure 5(a)). Transfection with a PRR siRNA significantly reduced the effects of prorenin (10 nM at 24 h) on the production of ROS (Figure 5(b)). These data indicated that prorenin can induce the production of ROS through PRR.

Figure 5.

Effect of prorenin on the production of ROS and the phosphorylation of ERK1/2 in HUASM cells.

Effect of prorenin on ERK1/2 phosphorylation

Prorenin significantly increased the phosphorylation of ERK1/2 independently of AngII, with peaks at 15 min and 30 min compared with the control (Figure 5(c)). Furthermore, pretreatment with DPI (10 μM) decreased the prorenin-induced phosphorylation of ERK1/2 to a level that was similar to that observed with PD98059 (25 μM) (Figure 5(d)). These results indicated that ROS are involved in prorenin-induced phosphorylation of ERK1/2 in HUASM cells.

Prorenin promotes proliferation via the production of ROS and the activation of the ERK1/2 pathways

Prorenin can induce the production of ROS and the phosphorylation of ERK1/2 in HUASM cells, but whether ROS and ERK1/2 are required for prorenin-induced proliferation is unknown. As shown in Figure 6, pretreatment with DPI and PD98059 significantly inhibited the production of ROS, the phosphorylation of ERK1/2 and the proliferative effects of prorenin on HUASM cells. Moreover, the pretreatment also altered the prorenin-induced upregulated expression of Bcl-2 and the downregulated expression of Bax at both the protein and mRNA levels.

Figure 6.

Effect of PD98059 and DPI on prorenin-induced proliferation in HUASM cells.

Discussion

In this study, we demonstrated that prorenin can promote the proliferation of HUASM cells and upregulate the expression of Bcl-2 and downregulate the expression of Bax through PRR independently of AngII. We also found that ROS and ERK1/2 are involved in these prorenin-induced effects.

First, we confirmed the expression of PRR in HUASM cells, consistent with previous studies.^1,13,24 The functional PRR was first proposed by Nguyen et al.,¹ who demonstrated that PRR is present in several organs, including the heart, brain, placenta, kidney and the liver. The role of PRR has been investigated in many cell and tissue types. The activation of PRR promotes the expression of fibrosis-related genes in HEK cells¹⁴ and VSMCs,^13,16 and induces oxidative stress in neuronal cells.²⁵ In animal models, PRR has been shown to be involved in the regulation of myocardial fibrosis and the deterioration of cardiac function.²⁶ In diabetic rats, the expression of PRR is upregulated²⁷ and contributes to the development of glomerulosclerosis,^28,29 diabetic nephropathy,³⁰ and elevated blood pressure and heart rate.³¹ Extensive evidence has shown that PRR is associated with cardiovascular disease.³²

Prorenin, which is considered as an inactive renin precursor, can bind to PRR within the nanomolar range^1,2,33 and trigger a series of molecular events. The binding of prorenin to PRR might not only promote the production of AngII but also might play a role similar to, but independently of, AngII. In this study, we demonstrated that prorenin can promote the proliferation of HUASM cells through PRR independently of AngII and can further regulate the expression of Bcl-2 and Bax. Proliferation and apoptosis are imbalanced processes during the early progression of atherosclerosis.

VSMCs have two types of phenotype: synthetic phenotype and contractile phenotype. VSMCs undergo a phenotypic change from contractile phenotype to synthetic phenotype in response to external stimulation such as growth factors and shear stress.³⁴ This transformation directly causes abnormal proliferation and migration of VSMCs from the medial layer to the intimal layer, and VSMCs can synthesize extracellular matrix which is responsible for formation of atherosclerotic plaque.¹⁸ Phenotype modulation of VSMCs contributes to the remodeling of vessels, which further leads to the occurrence of cardiovascular diseases. Apoptosis occurs at different stages of atherosclerosis. In the early progression of atherosclerosis, phenotype-transformed VSMCs may express adhesion molecules such as vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 like endothelial cells, and these adhesion molecules could promote VSMC proliferation and also prevent apoptosis of these cells.¹⁸ The Bcl-2 family proteins are important regulators of cellular apoptosis pathways, and Bcl-2 is an anti-apoptotic protein, whereas Bax is a pro-apoptotic protein.³⁵ These proteins contribute to the balance between proliferation and apoptosis.³⁶ Our study showed that prorenin can regulate the expression of apoptosis proteins through PRR independently of AngII in HUASM cells, and this anti-apoptotic effect may contribute to the formation of early atherosclerosis.

ROS are known to participate in the development of many cardiovascular diseases.³⁷ In VSMCs, various stimuli can induce the production of ROS, which might induce further proliferation,³⁸ increase inflammatory gene expression³⁹ and modulate matrix remodeling.⁴⁰ In endothelial cells, ROS can regulate the expression of adhesion molecules, including vascular cell adhesion molecule-1 and intracellular adhesion molecule-1.⁴¹ The production of ROS, which can represent a second messenger, can trigger a series of downstream signal transduction pathways, such as those mediated by Akt²² or ERK1/2.^42,43 A weakened antioxidative defense system and oxidative stress can contribute to the dysfunction of vascular cells, increasing the relative inflammatory gene expression.⁴⁴ Based on the effect of ROS on VSMCs and endothelial cells, ROS can participate in the pathogenesis of atherosclerosis. Our study showed that prorenin can promote the production of ROS through PRR independently of AngII. In HEK¹⁴ and neuronal²⁵ cells, ROS are also involved in prorenin-induced effects through PRR. In addition, the expression of PRR is regulated by ROS in diabetic rats.²⁷ In previous studies, the prorenin-induced phosphorylation of ERK1/2 has been shown in VSMCs.^15,16,45 Our study further confirmed that the prorenin-induced phosphorylation of ERK1/2 is mediated by ROS production, and that the inhibition of ROS production reduced the phosphorylation of ERK1/2. Early studies have also reported that ROS can mediate ERK1/2 phosphorylation in response to AngII.⁴⁶ A recent study claimed that in neuronal cells, the production of ROS through PRR is regulated by ERK1/2 and PI3K/Akt.²⁵ There may be a crosstalk between ROS production and the phosphorylation of ERK1/2, which remains to be elucidated. Overall, ROS and ERK1/2 play pivotal roles in terms of prorenin-induced effects.

The RAS plays a key role in cardiovascular and renal diseases, and the blockade of the RAS is considered to be beneficial and to reduce cardiovascular risks, despite the fact that its inhibition cannot completely inhibit the development of these diseases. The answer to this question might reside in the AngII-independent effects induced by the binding of prorenin with PRR. Ichihara et al.⁴⁷ developed a decoy-epitope peptide of the prorenin prosegment, which is called the ‘handle-region peptide’(HRP) and which can block the binding of prorenin to the PRR. In in vivo studies, the subcutaneous administration of HRP significantly attenuated renal and cardiac damage.^48,49 However, certain studies have failed to find any effects elicited by HPR in this regard.^50,51 Although discrepancies remain regarding HRP, PRR is clearly a key component of the RAS, in addition to AngII, and PRR represents a potential pharmacological target.

In conclusion, our study has shown that prorenin can promote the proliferation of HUASM cells, upregulate the expression of Bcl-2 and downregulate the expression of Bax through PRR independently of AngII. Moreover, we demonstrated that ROS and ERK1/2 are involved in prorenin-induced effects.

Footnotes

Conflict of interest

None declared.

Funding

This work was supported by the National Natural Science Foundation of China (No.3027143).

References

Nguyen

Delarue

Burcklé

. Pivotal role of the renin/prorenin receptor in angiotensin II production and cellular responses to renin. J Clin Invest 2002; 109: 1417–1427.

Batenburg

Krop

Garrelds

. Prorenin is the endogenous agonist of the (pro)renin receptor. Binding kinetics of renin and prorenin in rat vascular smooth muscle cells overexpressing the human (pro)renin receptor. J Hypertens 2007; 25: 2441–2453.

Nabi

Suzuki

. Biochemical properties of renin and prorenin binding to the (pro)renin receptor. Hypertens Res 2010; 33: 91–97.

Nurun

Uddin

Nakagawa

. Role of “handle” region of prorenin prosegment in the non-proteolytic activation of prorenin by binding to membrane anchored (pro)renin receptor. Front Biosci 2007; 12: 4810–4817.

Danser

van den Dorpel

Deinum

. Renin, prorenin, and immunoreactive renin in vitreous fluid from eyes with and without diabetic retinopathy. J Clin Endocrinol Metab 1989; 68: 160–167.

Itskovitz

Rubattu

Levron

. Highest concentrations of prorenin and human chorionic gonadotropin in gestational sacs during early human pregnancy. J Clin Endocrinol Metab 1992; 75: 906–910.

Clausmeyer

Sturzebecher

Peters

. An alternative transcript of the rat renin gene can result in a truncated prorenin that is transported into adrenal mitochondria. Circ Res 1999; 84: 337–344.

Danser

Derkx

Schalekamp

. Determinants of interindividual variation of renin and prorenin concentrations: Evidence for a sexual dimorphism of (pro)renin levels in humans. J Hypertens 1998; 16: 853–862.

Danser

Deinum

. Renin, prorenin and the putative (pro)renin receptor. Hypertension 2005; 46: 1069–1076.

10.

Deinum

Ronn

Mathiesen

. Increase in serum prorenin precedes onset of microalbuminuria in patients with insulin-dependent diabetes mellitus. Diabetologia 1999; 42: 1006–1010.

11.

Schefe

Menk

Reinemund

. A novel signal transduction cascade involving direct physical interaction of the renin/prorenin receptor with the transcription factor promyelocytic zinc finger protein. Circ Res 2006; 99: 1355–1366.

12.

Nguyen

. Renin/prorenin receptors. Kidney Int 2006; 69: 1503–1506.

13.

Zhang

Noble

Border

. Receptor-dependent prorenin activation and induction of PAI-1 expression in vascular smooth muscle cells. Am J Physiol Endocrinol Metab 2008; 295: E810–E819.

14.

Clavreul

Sansilvestri-Morel

Magard

. (Pro)renin promotes fibrosis gene expression in HEK cells through a Nox4-dependent mechanism. Am J Physiol Renal Physiol 2011; 300: F1310–F1318.

15.

Liu

Hitomi

Hosomi

. Prorenin induces vascular smooth muscle cell proliferation and hypertrophy via epidermal growth factor receptor-mediated extracellular signal-regulated kinase and Akt activation pathway. J Hypertens 2011; 29: 696–705.

16.

Batenburg

Leijten

. Renin- and prorenin-induced effects in rat vascular smooth muscle cells overexpressing the human (pro)renin receptor: does (pro)renin-(pro)renin receptor interaction actually occur? Hypertension 2011; 58: 1111–1119.

17.

Chen

Keaney

Jr.

Evolving concepts of oxidative stress and reactive oxygen species in cardiovascular disease. Curr Atheroscler Rep 2012; 14: 476–483.

18.

Doran

Meller

McNamara

. Role of smooth muscle cells in the initiation and early progression of atherosclerosis. Arterioscler Thromb Vasc Biol 2008; 28: 812–819.

19.

Gao

Qian

. NPRA-mediated suppression of AngII-induced ROS production contribute to the antiproliferative effects of B-type natriuretic peptide in VSMC. Mol Cell Biochem 2009; 324: 165–172.

20.

Touyz

Yao

Quinn

. p47phox associates with the cytoskeleton through cortactin in human vascular smooth muscle cells: role in NAD(P)H oxidase regulation by angiotensin II. Arterioscler Thromb Vasc Biol 2005; 25: 512–518.

21.

Dikalova

Clempus

Lassegue

. Nox1 overexpression potentiates angiotensin II-induced hypertension and vascular smooth muscle hypertrophy in transgenic mice. Circulation 2005; 112: 2668–2676.

22.

Schreiner

Kumerz

Gesslbauer

. Resveratrol blocks Akt activation in angiotensin II- or EGF-stimulated vascular smooth muscle cells in a redox-independent manner. Cardiovasc Res 2011; 90: 140–147.

23.

Tabet

Schiffrin

Callera

. Redox-sensitive signaling by angiotensin II involves oxidative inactivation and blunted phosphorylation of protein tyrosine phosphatase SHP-2 in vascular smooth muscle cells from SHR. Circ Res 2008; 103: 149–158.

24.

Greco

Camera

Facchinetti

. Chemotactic effect of prorenin on human aortic smooth muscle cells: A novel function of the (pro)renin receptor. Cardiovasc Res 2012; 95: 366–374.

25.

Peng

Seth

. (Pro)renin receptor mediates both angiotensin II-dependent and -independent oxidative stress in neuronal cells. PloS One 2013; 8: e58339.

26.

Moilanen

Rysa

Serpi

. (Pro)renin receptor triggers distinct angiotensin II-independent extracellular matrix remodeling and deterioration of cardiac function. PloS One 2012; 7: e41404.

27.

Siragy

Huang

. Renal (pro)renin receptor upregulation in diabetic rats through enhanced angiotensin AT1 receptor and NADPH oxidase activity. Exp Physiol 2008; 93: 709–714.

28.

Kaneshiro

Ichihara

Sakoda

. Slowly progressive, angiotensin II-independent glomerulosclerosis in human (pro)renin receptor-transgenic rats. J Am Soc Nephrol 2007; 18: 1789–1795.

29.

Ichihara

Suzuki

Nakagawa

. Prorenin receptor blockade inhibits development of glomerulosclerosis in diabetic angiotensin II type 1a receptor-deficient mice. J Am S Nephrol 2006; 17: 1950–1961.

30.

Matavelli

Huang

Siragy

. (Pro)renin receptor contributes to diabetic nephropathy by enhancing renal inflammation. Clin Exp Pharmacol Physiol 2010; 37: 277–282.

31.

Burckle

Jan Danser

Muller

. Elevated blood pressure and heart rate in human renin receptor transgenic rats. Hypertension 2006; 47: 552–556.

32.

Cousin

Bracquart

Contrepas

. Potential role of the (pro)renin receptor in cardiovascular and kidney diseases. J Nephrol 2010; 23: 508–513.

33.

Nabi

Kageshima

Uddin

. Binding properties of rat prorenin and renin to the recombinant rat renin/prorenin receptor prepared by a baculovirus expression system. Int J Mol Med 2006; 18: 483–488.

34.

Lagna

Nguyen

. Control of phenotypic plasticity of smooth muscle cells by bone morphogenetic protein signaling through the myocardin-related transcription factors. J Biol Chem 2007; 282: 37244–37255.

35.

Cory

Adams

. The Bcl2 family: Regulators of the cellular life-or-death switch. Nat Rev Cancer 2002; 2: 647–656.

36.

Geng

. Progression of atheroma: A struggle between death and procreation. Arterioscler Thromb Vasc Biol 2002; 22: 1370–1380.

37.

Lakshmi

Padmaja

Kuppusamy

. Oxidative stress in cardiovascular disease. Ind J Biochem Biophys 2009; 46: 421–440.

38.

Brown

Miller

Jr. Li

. Overexpression of human catalase inhibits proliferation and promotes apoptosis in vascular smooth muscle cells. Circ Res 1999; 85: 524–533.

39.

De Keulenaer

Ushio-Fukai

Yin

. Convergence of redox-sensitive and mitogen-activated protein kinase signaling pathways in tumor necrosis factor-alpha-mediated monocyte chemoattractant protein-1 induction in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 2000; 20: 385–391.

40.

Grote

Flach

Luchtefeld

. Mechanical stretch enhances mRNA expression and proenzyme release of matrix metalloproteinase-2 (MMP-2) via NAD(P)H oxidase-derived reactive oxygen species. Circ Rese 2003; 92: e80–e86.

41.

Chappell

Varner

Nerem

. Oscillatory shear stress stimulates adhesion molecule expression in cultured human endothelium. Circ Res 1998; 82: 532–539.

42.

Yoshizumi

Abe

Haendeler

. Src and Cas mediate JNK activation but not ERK1/2 and p38 kinases by reactive oxygen species. J Biol Chem 2000; 275: 11706–11712.

43.

Chen

Harris

. Angiotensin II induces epithelial-to-mesenchymal transition in renal epithelial cells through reactive oxygen species/Src/caveolin-mediated activation of an epidermal growth factor receptor-extracellular signal-regulated kinase signaling pathway. Mol Cell Biol 2012; 32: 981–991.

44.

Kondo

Hirose

Kageyama

. Roles of oxidative stress and redox regulation in atherosclerosis. J Atheroscler Thromb 2009; 16: 532–538.

45.

Feldt

Maschke

Dechend

. The putative (pro)renin receptor blocker HRP fails to prevent (pro)renin signaling. J Am Soc Nephrol 2008; 19: 743–748.

46.

Zhang

Lei

. Angiotensin II reduces cardiac AdipoR1 expression through AT1 receptor/ROS/ERK1/2/c-Myc pathway. PloS One 2013; 8: e49915.

47.

Ichihara

Hayashi

Kaneshiro

. Inhibition of diabetic nephropathy by a decoy peptide corresponding to the “handle” region for nonproteolytic activation of prorenin. J Clin Invest 2004; 114: 1128–1135.

48.

Ichihara

Kaneshiro

Takemitsu

. Nonproteolytic activation of prorenin contributes to development of cardiac fibrosis in genetic hypertension. Hypertension 2006; 47: 894–900.

49.

Ichihara

Kaneshiro

Takemitsu

. Contribution of nonproteolytically activated prorenin in glomeruli to hypertensive renal damage. J Am Soc Nephrol 2006; 17: 2495–2503.

50.

Batenburg

van den Heuvel

van Esch

. The (pro)renin receptor blocker handle region peptide upregulates endothelium-derived contractile factors in aliskiren-treated diabetic transgenic (mREN2)27 rats. J Hypertens 2013; 31: 292–302.

51.

Krebs

Weber

Steinmetz

. Effect of (pro)renin receptor inhibition by a decoy peptide on renal damage in the clipped kidney of Goldblatt rats. Kidney Int 2008; 74: 823–824.