Sage Journals: Discover world-class research

Abstract

Background

Porcine reproductive and respiratory syndrome virus (PRRSV) is a pathogen that affects swine and causes substantial economic losses in the global pig industry. Despite the availability of vaccines, it remains crucial to explore innovative therapeutic strategies to control PRRSV infections. Magnolol, a bioactive compound extracted from the root and bark of Magnolia officinalis, has demonstrated broad-spectrum antiviral activity in previous studies.

Methods

The cytotoxicity of magnolol was determined by the CCK-8 method. RT-qPCR, western blot, and immunofluorescence were used to study the inhibitory effect of magnolol on PRRSV N gene and protein expression through antiviral assay and viral attachment, internalization, replication and release assays. The effect of magnolol on immune-related gene expression was analysed by RT-qPCR.

Results

We found magnolol hinders multiple facets of the PRRSV lifecycle, encompassing the stages of viral attachment and replication. Furthermore, magnolol enhances the expression of pivotal cytokines, including interleukin-6 (IL-6), interleukin-8 (IL-8), and tumour necrosis factor-α (TNF-α), during PRRSV infection, thereby reinforcing the host cells’ capacity to mount an effective antiviral defence. Additionally, it exerts inhibitory effects on PRRSV replication by upregulating the expression of a disintegrin and metalloprotease 17 (ADAM17) at both the protein and mRNA levels.

Conclusions

In this study, we provide evidence demonstrating the potent efficacy of magnolol in inhibiting PRRSV replication within Marc-145 cells. Our findings underscore the potential of magnolol as a novel antiviral agent for the PRRSV control.

Graphical Abstract

Keywords

magnolol porcine reproductive and respiratory syndrome virus antiviral activity cytokines a disintegrin and metalloprotease 17

Introduction

Porcine reproductive and respiratory syndrome (PRRS), caused by the PRRS virus (PRRSV), is characterized by respiratory disorder, reproductive failure in pregnant sows, and high mortality rates among piglets.^1,2 This disease has emerged as a predominant pathogen responsible for significant economic losses in the global swine industry.^3,4 Currently, there are no effective treatments for PRRS, with management strategies primarily focused on prevention through vaccination.^5,6 Given the virus’s extensive genetic diversity and high mutation rates of PRRSV, the protection offered by existing commercially available vaccines is limited.^6,7 Consequently, there is an urgent need to develop novel anti-PRRSV strategies.

In recent years, numerous antiviral agents, including small-molecule inhibitors and natural compounds, have been investigated to combat viral infections. Notable examples include ensitrelvir,⁸ simnotrelvir,⁹ cordycepin,¹⁰ riboprine,¹¹ molnupiravir,¹² remdesivir,¹³ and natural extracts (such as strychnine bush, pineapple, and ginger ingredients),¹⁴ which have shown efficacy against various viral pathogens such as SARS-CoV-2. These compounds primarily target viral entry, replication, anti- RNA-dependent RNA polymerase (RdRp), or immune evasion mechanisms, offering valuable insights into antiviral strategies. Despite these advancements, the application of synthetic antivirals often faces challenges related to drug resistance, adverse effects, and high production costs.

In China, approximately 10% of prescriptions incorporate Traditional Chinese herbs. Valued for their efficacy, cost-effectiveness, and safety, these herbs have become a key focus for developing novel antiviral therapy.^15,16 Numerous natural compounds and herbal components have demonstrated antiviral properties.^17,18 For example, compounds such as sanggenon C,¹⁹ ginsenoside Rg1,²⁰ andrographolide,²¹ and baicalin²² have exhibited promising antiviral effects against PRRSV and other RNA viruses, mainly through the modulation of host immune responses and inhibition of viral replication pathways. Magnolol, a bioactive constituent extracted from the roots and bark of Magnolia officinalis, a renowned Chinese herb,²³ has garnered attention in previous studies due to its antiviral potential.²⁴ Specifically, magnolol has exhibited inhibitory effects against H1N1 influenza virus by stimulating the secretion of interferon-β (IFN-β).²⁵ Simultaneously, it has bolstered the resilience of grass carp against grass carp reovirus (GCRV) infection.²⁶ Moreover, magnolol’s unique structural characteristics, featuring hydroxylated phenyl groups, contribute to its antioxidant, anti-inflammatory, and antiviral properties, making it a promising candidate for combating PRRSV infection.²⁷ Nevertheless, whether magnolol exerts inhibitory effects on PRRSV infection and replication remains uncertain.

In this study, we demonstrated that rifampicin effectively inhibits PRRSV nucleocapsid protein levels in Marc-145 cells in a dose-dependent manner, effectively targeting both the attachment and replication phases of the PRRSV life cycle. Remarkably, magnolol also amplifies the Marc-145 cell’s antiviral immune response, elevating the transcription levels of interleukin-6 (IL-6), IL-8, and tumour necrosis factor-α (TNF-α) during PRRSV infection. Remarkably, we extended the investigation to assess the impact of magnolol on ADAM17 (a disintegrin and metalloprotease 17). In conclusion, the potential of magnolol as an innovative antiviral agent, opening new avenues for the controlling and preventing PRRSV infection.

Materials and methods

Cells and viruses

Marc-145 cells, a widely used cell line for the propagation of PRRSV, were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco), 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C with 5% CO₂. The PRRSV strain CHR6, classified as a classical North American type PRRSV strain,²⁸ was kindly provided by Dr Yaosheng Chen (Sun Yat-sen University). The virus was propagated in Marc-145 cells using DMEM containing 2% FBS. Virus preparations were stored at −80°C and titrated using the 50% tissue culture infective dose (TCID₅₀) method.

Antibody

The primary antibodies used in this study included anti-PRRSV N protein (1:5000 dilution, GeneTex, USA), anti-ADAM17 (1:1000 dilution, GeneTex, USA), and anti-β-actin (1:2000 dilution, Cell Signalling Technology, USA). The secondary antibody used was goat anti-rabbit IgG H&L conjugated with HRP (1:1000 dilution, ab205718, Abcam).

Preparation of magnolol

Magnolol (purity ≥99.92%) was obtained from Med Chem Express (MCE, USA) and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich, USA) to prepare stock solutions. The final concentration of DMSO in the cell culture medium was maintained below 0.4% in all experiments to avoid solvent-induced cytotoxicity.

Cytotoxicity assay

The cytotoxicity of magnolol on Marc-145 cells was evaluated using the Cell Counting Kit-8 (CCK-8, GlpBio, USA) assay.²⁹ Briefly, Marc-145 cells were seeded into 96-well plates and incubated in DMEM containing various concentrations of magnolol (0, 1, 2, 4, 8, 16, and 32 µM) for 24 or 48 h (h) at 37°C. Following incubation, the cells were washed twice with phosphate-buffered saline (PBS), and 90 µL of fresh DMEM along with 10 µL of CCK-8 solution was added to each well. Plates were then incubated for an additional 2 h at 37°C. Absorbance at 450 nm was measured using a microplate reader to determine cell viability, and cytotoxicity was calculated using the following formula:

% Cytotoxicity = \frac{(absorbance sample ‐ absorbance blank)}{(absorbance negative control ‐ absorbance blank)} \times 100 %

Antiviral activity assay

To assess the antiviral activity of magnolol against PRRSV, Marc-145 cells were seeded in 6-well plates and infected with PRRSV at a multiplicity of Infection (MOI) of 1 for 24 h in the presence of varying concentrations of magnolol. At designated time points post-infection, both cells and supernatants were collected for analysis. The mRNA expression of the PRRSV N gene was quantified by reverse transcription quantitative PCR (RT-qPCR), and the viral N protein levels were assessed by western blotting. Indirect immunofluorescence assay (IFA) was performed to determine the number of PRRSV-infected cells. To facilitate the maximal release of intracellular virions, cells and supernatants were subjected to three freeze-thaw cycles alternating between −80°C and 4°C. The viral titre in the supernatant was subsequently determined using an endpoint dilution assay in Marc-145 cells and expressed as Log₁₀ TCID₅₀/mL.³⁰

In the pre-treatment model, Marc-145 cells were mock-treated or treated with different concentrations of magnolol for 4 h, followed by three washes with PBS. The cells were then mock-infected or infected with PRRSV (MOI = 1) and cultured for an additional 24 h.

In the post-treatment model, Marc-145 cells were first mock-infected or infected with PRRSV (MOI = 1) for 4 h, after which the medium was replaced with fresh medium containing different concentrations of magnolol. The cells were then cultured for an additional 24 h.

Viral attachment, internalization, replication, and release assays

To investigate the effects of magnolol on different stages of the PRRSV life cycle, specific assays were conducted as described below:

(I) Attachment: Cells were pre-chilled at 4°C for 1 h and subsequently mock-infected or infected with PRRSV (MOI = 4) in the presence or absence of magnolol for 2 h at 4°C. The cells were then covered with fresh medium, incubated for an additional 22 h at 37°C. Viral N protein and mRNA levels were assessed by western blot and RT-qPCR, respectively.

(II) Internalization: Cells were pre-chilled at 4°C for 1 h. Then cells were mock-infected or infected with PRRSV (MOI = 4) for 2 h at 4°C to allow virus attachment without internalization. After washing twice with cold PBS to remove unbound virus, magnolol at various concentrations was added, and the cells were incubated at 37°C for 3 h to permit viral internalization. The medium was then replaced with fresh culture medium, and cells were incubated for an additional 19 h at 37°C.

(III) Replication: Cells were mock-infected or infected with PRRSV (MOI = 4) for 6 h at 37°C to allow viral entry. Subsequently, cells were treated with magnolol for 4 h and harvested at 24 h post-infection (hpi) for analysis.

(IV) Release: Cells were mock-infected or infected with PRRSV (MOI = 4) for 24 h at 37°C. Then the medium was replaced with fresh medium containing various concentrations of magnolol. PRRSV N protein and mRNA levels in both cell lysates and culture supernatants were quantified using western blot and RT-qPCR.³¹

Real-time quantitative reverse transcriptase PCR (RT-qPCR)

The RT-qPCR was used to analyse the mRNA expression of PRRSV N, ADAM17, and cytokines (IL-6, IL-8, and TNF-α). Total RNA was extracted using the RNA simple Total RNA Kit (TIANGEN, China). RNA was reverse-transcribed into cDNA using Reverse Transcription System (Accurate Biology, China). Primers used for RT-qPCR are listed in Table 1. Real-time PCR was conducted using the LightCycler 480 Real-Time PCR System (LC480, Roche, Switzerland). The RT-qPCR was performed according to the following reaction conditions: 95°C for 10 min, then 95°C for 5 s, 55°C for 30 s and 72°C for 30 s through 40 cycles, and finally 72°C for 10 min. GAPDH was used as the internal reference gene for normalization. Relative mRNA expression levels were calculated using the 2^−ΔΔCt method.³²

Table 1.

List of RT-qPCR primers used to evaluate gene expression.

Genes	Primers (5′-3′)
PRRSV N	Forward: AAAACCAGTCCAGAGGCAAG
PRRSV N	Reverse: CGGATCAGACGCACAGTATG
GAPDH	Forward: TGACAACAGCCTCAAGATCG
GAPDH	Reverse: GTCTTCTGGGTGGCAGTGAT
IL-6	Forward: AGAGGCACTGGCAGAAAAC
IL-6	Reverse: TGCAGGAACTGGATCAGGAC
IL-8	Forward: TGGACCACACTGCGTCAATACAG
IL-8	Reverse: TCTCCACAACCCTAGACACCCATG
TNF-α	Forward: TCTGTCTGCTGCACTTTGGAGTG
TNF-α	Reverse: TTGAGGGTTTGCTACAACATGG
ADAM17	Forward: CAAGAACGCAGCAATAAGGTGTGTG
ADAM17	Reverse: GCAGCAGGTGTCGTTGTTCAAATAC

Western blot

Cells were washed three times with cold PBS and lysed using Radio Immunoprecipitation Assay (RIPA) lysis buffer (Beyotime, China) containing 1% phenylmethylsulfonyl fluoride (PMSF, Beyotime, China). Total protein (20 µg per sample) was subjected to 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred to polyvinyl difluoride (PVDF) membrane (Beyotime, China). The PVDF membranes were blocked with 5% bovine serum albumin (BSA, Ruishu, China) in TBST (Tris-buffered saline with 0.1% Tween-20) at room temperature (RT). The PVDF membrane was then incubated overnight at 4°C with the indicated antibodies. Each membrane was washed three times with TBST and incubated with the indicated secondary antibody for 1 h at RT. Finally, the membrane was washed and protein bands were visualized by Gel Imaging System (Tanon, 4200).

Indirect immunofluorescence assay (IFA)

Cells were fixed with 4% paraformaldehyde for 20 min. Then, cells were rinsed twice with PBS and permeated with 0.1% Triton X-100 for 15 min at RT. After permeabilization, cells were blocked with 3% normal goat serum for 2 h at RT and incubated overnight at 4°C with a primary antibody against PRRSV N protein (1:500 dilution, GeneTex, USA). Following primary antibody incubation, cells were washed and incubated in the dark for 2 h with a FITC-conjugated secondary antibody (1:200 dilution, Affinity). DAPI (Solarbio, China) (blue) was used to counterstain nuclei for 5 min. Finally, cells were determined by fluorescence microscopy (Leica DMi8, Germany).

Statistical analysis

All experiments were performed at least three independent replicates. Data are presented as means ± standard deviations (SD). Statistical significance was assessed by Student’s t test when only two groups were compared or by one-way analysis of variance (ANOVA) when more than two groups were compared. P values of <0.05 (*), <0.01 (**), and <0.001 (***) were considered statistically significant. P values of >0.05 (ns) were considered not-significant.

Results

Magnolol inhibits PRRSV replication in Marc-145 cells

To evaluating the antiviral activity of magnolol, the cytotoxicity of magnolol in Marc-145 cells was tested by CCK-8 assay. As shown in Figure 1A, magnolol exhibited no cytotoxic effects at concentrations up to 32 µM in Marc-145 cells. Hence, all subsequent experiments were conducted using magnolol at concentrations not exceeding 32 µM. Subsequently, we evaluated the inhibitory effects of magnolol against PRRSV (MOI = 1) through virus titration, western blot analysis, RT-qPCR, and immunofluorescence assay at 24 hpi. As depicted in Figure 1B, magnolol treatment significantly reduced PRRSV viral titres. Consistently, western blot and RT-qPCR analyses demonstrated a dose-dependent reduction in PRRSV N protein and mRNA levels (Figure 1C and D). Additionally, immunofluorescence analysis revealed a discernible reduction in PRRSV N following magnolol treatment, further confirming the inhibitory effect of magnolol on PRRSV replication (Figure 1E). These results indicate that magnolol effectively suppresses PRRSV replication in vitro.

Figure 1.

Cytotoxicity and anti-PRRSV activity of magnolol in Marc-145 cells. (A) Marc-145 cells were treated with magnolol at indicated concentrations for 24 or 48 h. (B) Marc-145 cells were mock-infected or infected with PRRSV (MOI = 1) and treated with different concentrations of magnolol (0, 16, and 32 µM) for 24 h. Viral titres in the supernatant were determined using endpoint dilution assays. (C) PRRSV N protein expression was analysed by western blot to evaluate viral protein levels. (D) The mRNA expression of viral ORF7 (N gene) was quantified by RT-qPCR to assess viral gene replication in Marc-145 cells. (E) Cells grown in 24-well plates were infected with PRRSV (MOI = 1) for 24 h in the presence of different concentrations of magnolol (0, 4, 8, 16, and 32 µM). Intracellular viral load was visualized by immunofluorescence staining. ns, not-significant; *P < .05; **P < .01 compared with the virus control (0 μM magnolol). Scale bar, 500 µm.

Magnolol more effective as a post-treatment in inhibiting PRRSV replication

Given magnolol’s demonstrated ability to inhibit PRRSV replication, we further investigated its antiviral efficacy when administered either before (pre-treatment) or after (post-treatment) viral infection (MOI = 1), as illustrated in Figure 2A. In the pre-treatment model, magnolol exhibited minimal impact on PRRSV N protein expression and mRNA levels (Figure 2B and C). In contrast, post-infection treatment with magnolol resulted in a significant reduction in both PRRSV N protein and mRNA expression (Figure 2D and E). These results suggest that magnolol exerts greater antiviral efficacy when applied after viral entry, indicating its predominant role in inhibiting viral replication rather than preventing initial infection.

Figure 2.

Magnolol more effective as a post-treatment in inhibiting PRRSV replication. (A) Schematic representation of the experimental design. Cell harvest is represented by purple vertical bars, while PRRSV infection is represented by red bars, and magnolol treatment is represented by blue bars. Western blot was used to determine PRRSV N protein expression in pre-treatment model (B) and post-treatment model (D). RT-qPCR was used to determine PRRSV N mRNA expression in pre-treatment model (C) and post-treatment model (E). ns, not-significant; *P < .05; **P < .01 compared with the virus control (0 μM magnolol).

Magnolol blocks viral attachment and replication

The PRRSV infection cycle comprises four principal processes: attachment, internalization, replication, and release.³³ Given the observed inhibitory effect of magnolol on PRRSV replication, we systematically designed experiments targeting these four phases, informed by previous investigations, to determine the specific stage of PRRSV infection affected by magnolol treatment,^28,34,35 as illustrated in Figure 3A.

Figure 3.

Magnolol blocks viral attachment and replication. (A) Schematic diagram of magnolol treatments. Cell harvest is represented by purple vertical bars, while PRRSV infection is represented by red bars and magnolol treatment is represented by blue bars. For the viral attachment (B, C), internalization (D, E), replication (F, G), and release (H, I) assay, western blot and RT-qPCR were used to determine the expression of PRRSV N protein and mRNA. ns, not-significant; *P < .05; **P < .01 compared with the virus control (0 μM magnolol).

As shown in Figure 3B and C, magnolol treatment at 16 µM and 32 µM significantly reduced PRRSV N protein and mRNA expression during the attachment phase, suggesting that magnolol interferes with viral binding to host cells. Conversely, no significant changes in N protein or mRNA levels were observed during the internalization phase (Figure 3D and E), indicating that magnolol does not impact viral entry once attachment has occurred.

Further evaluation during the replication phase revealed a substantial decrease in both N protein and mRNA levels following magnolol treatment (Figure 3F and G), thereby indicating the inhibition of the replication phase of PRRSV.

To assess its influence on viral release, PRRSV N mRNA levels were measured in both cell lysates and culture supernatants. The ratio of PRRSV N mRNA in cells and supernatant provides insight into the virus release rate. As depicted in Figure 3H and I, magnolol does not exert inhibitory effects on the release phase of PRRSV.

Collectively, these findings demonstrate that magnolol primarily exerts its antiviral effects by targeting the attachment and replication stages of PRRSV infection, without affecting internalization or release.

Magnolol enhances the expression of immune-related genes in Marc-145 cells

To evaluate the immunomodulatory effects of magnolol, we assessed the transcriptional levels of key proinflammatory cytokines in Marc-145 cells, such as IL-6, IL-8, and TNF-α. As shown in Figure 4, the mRNA expression of these cytokines was significant promoted in magnolol and PRRSV co-treated Marc-145 cells compared to those treated with PRRSV or magnolol alone. These results suggested that magnolol enhances the host antiviral immune response by promoting the expression of immune-related genes in Marc-145 cells during PRRSV infection.

Figure 4.

The mRNA expression of IL-6, IL-8, and TNF-α in Marc-145 cells treated with magnolol during PRRSV infection. Marc-145 cells were mock-infected or infected with PRRSV (MOI = 1) in the presence or absence of magnolol (32 µM) for 24 h. (A-C) Relative expressions of IL-6, IL-8, and TNF-α were analysed using RT-qPCR. ns, not-significant; **P < .01; ***P < .01 compared with the control (Mock).

Magnolol upregulates ADAM17 expression

A disintegrin and metalloprotease 17 (ADAM17) has been implicated in the suppression of PRRSV infection through modulation of viral entry and immune signalling pathways.³⁶ Moreover, cytokines such as IL-8 and TNF-α have been shown to induce ADAM17 expression.⁷ To further elucidate the mechanism by which magnolol exerts its antiviral effects, we investigated the potential impact of magnolol on ADAM17 expression.

In Figure 5, both the mRNA and protein levels of ADAM17 were significantly upregulated in Marc-145 cells co-treated with magnolol and PRRSV, relative to cells infected with PRRSV or magnolol alone. These findings suggest that magnolol may suppress PRRSV replication, at least in part, through the upregulation of ADAM17, further supporting its role as an immunomodulatory antiviral agent.

Figure 5.

Magnolol upregulated the protein and mRNA expression of ADAM17. Marc-145 cells were mock-infected or infected with PRRSV (MOI = 1) in the presence or absence of magnolol (32 µM) for 24 h. (A) The protein expression of ADAM17 was detected by western blot. (B) The mRNA expression of ADAM17 was analysed using RT-qPCR. ns, not-significant; **P < .01.

Discussion

The emergence of PRRSV as a pathogen was first documented in the late 1980s.³⁷ Since then, it has been widely spread around the world, significantly impacting the global swine industry and causing substantial economic losses.^38,39 Over the past decades, researchers spanning various nations have diligently strived to uncover effective strategies for PRRSV management.^40,41 However, the task of preventing and curtailing PRRSV is becoming progressively intricate due to its capacity to induce immunosuppression and establish persistent infections.^2,3,42 The abuse of vaccines also makes it more and more difficult to control PRRSV.⁴³ Hence, there is an urgent need to explore novel and effective strategies to combat this widespread and economically damaging pathogen.

In recent years, with the deep research and development on Chinese herbal medicine, it has been found that natural herbal extracts and products have shown notable antiviral effects, such as ginsenoside Rg1,²⁰ andrographolide,²¹ and Magnolia officinalis.⁴⁴ Magnolol, a primary active component of Magnolia officinalis, has demonstrated a wide range of pharmacological properties,⁴⁴ including antifungal,⁴⁵ antimicrobial,⁴⁶ and antiviral activities.^25,47 Particularly, magnolol has exhibited promising antiviral potential against foodborne viruses like norovirus, making it a candidate for foodborne pathogen control.⁴⁷ Given the limited understanding of magnolol’s effects on PRRSV infection and replication, this study aims to provide comprehensive insights into its antiviral potential and underlying mechanisms.

The nucleocapsid protein (N protein) of PRRSV, the most abundant structural proteins, interacts with viral RNA to form nucleocapsids and participates in virion assembly. Additionally, N protein has been proved to regulate the host immune response.^48,49 Hence, PRRSV N is a critical target gene and protein for viral detection and replication. Here, we systematically evaluated magnolol’s potential to inhibit PRRSV replication in Marc-145 cells. Our results demonstrated that magnolol effectively reduced PRRSV N mRNA levels and protein expression in a dose-dependent manner, with the best inhibitory effect was at 32 μM, which is consistent with other natural herbal extracts and small-molecule chemical compound, such as glycyrrhizin,⁵⁰ rifampicin,⁵¹ baicalin,²² echinacea, Ilex purpurea Hassk, Ganoderma lucidum Kars, Taraxacum mongolicum, and Ilex rotunda Thunb.⁵² Subsequently, we devised distinct temporal treatment models to dissect magnolol impact on PRRSV replication and intriguingly, the results revealed that magnolol exerts inhibitory effect on PRRSV replication detectable in the post-treatment model but not in the pre-treatment model. This indicated that magnolol may directly affect the PRRSV replication, but the specific infection route needs to be further explored.

Given the importance of the timing of magnolol administration, we hypothesized that magnolol may interfere with specific stages of the PRRSV replication cycle, including viral attachment, internalization, replication, and release.^3,53 Therefore, we conducted a series of assays to determine which stage(s) of PRRSV infection were affected by magnolol treatment. Notably, we observed that magnolol significantly inhibited viral attachment and replication, while having no apparent effect on internalization or viral release.

Viral invasion can be recognized by host pattern-recognition receptors (PRRs), which initiate effective antiviral responses, including the production of various cytokines and the induction of inflammatory responses.^54,55 In this study, we investigated the expression levels specific immune-related genes and found that magnolol upregulated the transcription of IL-6, IL-8, and TNF-α genes during PRRSV infection. This indicates that magnolol enhances the antiviral immune response of Marc-145 cells during PRRSV infection. These proinflammatory cytokines contribute to the establishment of an antiviral state in uninfected neighbouring cells, facilitate the recruitment of lymphocytes to the site of infection, and promote the cytolysis of virus-infected cells.⁵⁵ Therefore, the magnolol-induced enhancement of the cellular antiviral immune response may underlie its inhibitory effect during PRRSV infection. Furthermore, the efficacy of magnolol can be compared with other antiviral agents that target RNA viruses. For instance, small-molecule inhibitors such as ensitrelvir⁸ and simnotrelvir,⁹ developed against SARS-CoV-2, act by targeting viral proteases, while nucleoside analogs like molnupiravir¹² interfere with viral RNA replication. Unlike these compounds, magnolol appears to exert dual antiviral effects by both preventing viral attachment and promoting immune responses through cytokine regulation. This multifaceted mechanism of action could reduce the resistance development, a critical advantage over single-target antivirals such as remdesivir, which primarily inhibits RNA polymerases.

Previous studies have shown that the modulation of ADAM17 impacts PRRSV entry and infection dynamics. Specifically, inhibition of ADAM17 has been shown to enhance PRRSV entry, whereas its overexpression suppresses PRRSV infection. Additionally, activation of ADAM17 may contribute to the stimulation of host immune responses.³⁶ In the present study, we observed that magnolol treatment significantly increased both the mRNA and protein expression levels of ADAM17, exceeding the levels induced by PRRSV infection alone. Ren et al. reported that TNF-α suppresses PRRSV infection in Marc-145 cells and ADAM17 mediates the production of soluble TNF-α.⁵⁶ Given that magnolol upregulates ADAM17 expression, we speculate that the upregulation of TNF-α expression by magnolol may be mediated through ADAM17 activity. The role of magnolol in enhancing cytokine production and ADAM17 expression in Mac-145 cells may provide insight into its efficacy in post-treatment model. This might be attributed to its capacity to rapidly modulate the host cell response, thereby facilitating viral clearance.

Magnolol, a type of bisphenol compound, is characterized by a biphenyl structure with two hydroxyl groups. The structural modification of magnolol can not only increase the structural diversity, but also improve the activities and bioavailability.⁵⁷ This underscores the potential of magnolol as a lead compound for drug development. Therefore, studies focussing on the structure-activity relationships of magnolol derivatives are essential to fully realize its therapeutic potential. In practical applications, magnolol offers significant advantages due to its natural origin, low toxicity, and immunomodulatory effects- particularly in livestock management where reducing antibiotic usage is a growing priority. Moreover, the potential antiviral activity of magnolol suggests its utility in combination therapy strategies to enhance efficacy and mitigate drug resistance. While our study provides robust evidence of magnolol’s antiviral activity in Marc-145 cells, it is important to note that these cells do not fully mimic the natural host environment of PRRSV infection in swine. Future studies utilizing porcine alveolar macrophages (PAMs) and animal models will be essential to validate these findings and evaluate the therapeutic efficacy, pharmacokinetic profile, and safety of magnolol. Furthermore, a limitation of this study is the absence of positive control compounds to contextualize magnolol’s antiviral potency. Future investigation will include comparative analyses with clinically relevant antivirals, such as remdesivir or ribavirin, to establish relative efficacy and explore potential synergies.

Conclusions

In summary, our findings demonstrate that magnolol effectively inhibits PRRSV infection in a dose-dependent manner by targeting both the viral attachment and replication stages of the PRRSV life cycle. Moreover, magnolol treatment enhances the antiviral immune response of Marc-145 cells and is associated with increased transcription and protein expression levels of ADAM17. Its multi-target mechanism and potential for combination therapies highlight promise for PRRSV control. Further in vivo and in vitro studies are warranted to validate the mechanistic role of magnolol in antiviral defence and host immune regulation and comparative efficacy with existing antivirals.

Footnotes

Acknowledgements

The authors would like to thank Prof Yaosheng Chen for providing the PRRSV strain utilized in this study.

ORCID iD

Qiang Fu

Author contributions

Conceptualization: S.L. and Q.F.; investigation: M.Z. and J.D.; writing—original draft: S.L.; supervision: Q.F.; writing—review and editing: S.L., Y.L., Y.H., B.G., Q.L., and Q.F. All authors have read and agreed to the published version of the manuscript.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was supported by the National Natural Science Foundation of China (32473024, 31872443); National Natural Science Foundation of Guangdong Province (2022A1515140052); Project of Science and Technology of Guangdong Province (KTP20240768); Project of Department of Education of Guangdong Province (2022ZDJS036); Natural Science Foundation of Foshan (2420001004253).

Declaration of conflicting of interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

References

Ruedas-Torres

Rodríguez-Gómez

Sánchez-Carvajal

, et al. The jigsaw of PRRSV virulence. Vet Microbiol 2021; 260: 109168.

Kimman

Cornelissen

Moormann

, et al. Challenges for porcine reproductive and respiratory syndrome virus (PRRSV) vaccinology. Vaccine 2009; 27: 3704–3718.

Lunney

Fang

Ladinig

, et al. Porcine reproductive and respiratory syndrome virus (PRRSV): pathogenesis and interaction with the immune system. Annu Rev Anim Biosci 2016; 4: 129–154.

Nan

Xiao

, et al. Antiviral strategies against PRRSV infection. Trends Microbiol 2017; 25: 968–979.

Cruz

Zuniga

Becares

, et al. Vectored vaccines to protect against PRRSV. Virus Res 2010; 154: 150–160.

Bello-Onaghise

Wang

Han

, et al. Antiviral strategies of Chinese herbal medicine against PRRSV infection. Front Microbiol 2020; 11: 1756.

Zhu

Zhang

, et al. Lipopolysaccharide downregulates CD163 expression to inhibit PRRSV infection via TLR4-NF-κB pathway. Front Microbiol 2020; 11: 501.

Eltayb

Abdalla

Rabie

. Novel investigational anti-SARS-CoV-2 agent ensitrelvir “S-217622”: a very promising potential universal broad-spectrum antiviral at the therapeutic frontline of coronavirus species. ACS Omega 2023; 8: 5234–5246.

Cao

Wang

, et al. Oral simnotrelvir for adult patients with mild-to-moderate covid-19. N Engl J Med 2024; 390: 230–241.

10.

Rabie

. Potent inhibitory activities of the adenosine analogue cordycepin on SARS-CoV-2 replication. ACS Omega 2022; 7: 2960–2969.

11.

Rabie

Abdalla

. Evaluation of a series of nucleoside analogs as effective anticoronaviral-2 drugs against the Omicron-B.1.1.529/BA.2 subvariant: a repurposing research study. Med Chem Res 2023; 32: 326–341.

12.

Jayk Bernal

Gomes da Silva

Musungaie

, et al. Molnupiravir for oral treatment of covid-19 in nonhospitalized patients. N Engl J Med Overseas Ed 2022; 386: 509–520.

13.

Sise

Santos

Goldman

, et al. Efficacy and safety of remdesivir in people with impaired kidney function hospitalized for COVID-19 pneumonia: a randomized clinical trial. Clin Infect Dis 2024; 79: 1172–1181.

14.

Rabie

. New potential inhibitors of coronaviral main protease (CoV-mpro): strychnine bush, pineapple, and ginger could be natural enemies of COVID-19. Int J Network Commun 2022; 9: 225–237.

15.

Zhang

Liu

, et al. Considerations for the quality control of newly registered traditional Chinese medicine in China: a review. J AOAC Int 2019; 102: 689–694.

16.

Song

Shi

, et al. Quality control of traditional Chinese medicines: a review. Chin J Nat Med 2013; 11: 596–607.

17.

Chen

. Research progress on antiviral constituents in traditional Chinese medicines and their mechanisms of action. Pharm Biol 2022; 60: 1063–1076.

18.

Peng

. Traditional Chinese herbal medicine as a source of molecules with antiviral activity. Antivir Res 2013; 97: 1–9.

19.

Liu

Zhu

Wang

, et al. The natural compound Sanggenon C inhibits PRRSV infection by regulating the TRAF2/NF-κB signalling pathway. Vet Res 2023; 54: 114.

20.

, et al. Ginsenoside Rg1 suppresses type 2 PRRSV infection via NF-κB signaling pathway in vitro, and provides partial protection against HP-PRRSV in piglet. Viruses 2019; 11: 1045.

21.

Gao

Zhang

, et al. Andrographolide and its derivative potassium dehydrographolide succinate suppress PRRSV replication in primary and established cells via differential mechanisms of action. Virol Sin 2021; 36: 1626–1643.

22.

Chang

Wang

, et al. Antiviral activity and underlying mechanisms of baicalin against porcine reproductive and respiratory syndrome virus in vitro. Microb Pathog 2024; 193: 106712.

23.

Tang

Lai

Huang

, et al. Magnolol reduces myocardial injury induced by renal ischemia and reperfusion. J Chin Med Assoc 2022; 85: 584–596.

24.

Lin

Zeng

, et al. Pharmacology, toxicity, bioavailability, and formulation of magnolol: an update. Front Pharmacol 2021; 12: 632767.

25.

Zhang

Yin

Yan

, et al. Pharmacokinetics and pharmacodynamics of huanglian-houpo decoction based on berberine hydrochloride and magnolol against H1N1 influenza virus. Eur J Drug Metab Pharmacokinet 2022; 47: 57–67.

26.

Chen

Shan

, et al. Magnolol and honokiol from Magnolia officinalis enhanced antiviral immune responses against grass carp reovirus in Ctenopharyngodon idella kidney cells. Fish Shellfish Immunol 2017; 63: 245–254.

27.

Zhang

Chen

Huang

, et al. Insights on the multifunctional activities of magnolol. BioMed Res Int 2019; 2019: 1847130–1847215.

28.

Wang

Dong

Zhang

, et al. Antiviral mechanism of tea polyphenols against porcine reproductive and respiratory syndrome virus. Pathogens 2021; 10: 202.

29.

Feng

Bai

Cui

, et al. In vitro antiviral activity of germacrone against porcine reproductive and respiratory syndrome virus. Curr Microbiol 2016; 73: 317–323.

30.

But

, et al. Antiviral Chinese medicinal herbs against respiratory syncytial virus. J Ethnopharmacol 2002; 79: 205–211.

31.

Zhu

Guo

, et al. Chlorine dioxide inhibits the replication of porcine reproductive and respiratory syndrome virus by blocking viral attachment. Infect Genet Evol 2019; 67: 78–87.

32.

Wang

, et al. qPCRtools: an R package for qPCR data processing and visualization. Front Genet 2022; 13: 1002704.

33.

Cai

Zhang

Cheng

, et al. Progress in PRRSV infection and adaptive immune response mechanisms. Viruses 2023; 15: 1442.

34.

Zhang

Long

, et al. Platycodin D suppresses type 2 porcine reproductive and respiratory syndrome virus in primary and established cell lines. Viruses 2018; 10: 657.

35.

Zhang

Chen

, et al. Inhibition of proanthocyanidin A2 on porcine reproductive and respiratory syndrome virus replication in vitro. PLoS One 2018; 13: e0193309.

36.

Guo

Niu

, et al. Modulation of CD163 expression by metalloprotease ADAM17 regulates porcine reproductive and respiratory syndrome virus entry. J Virol 2014; 88: 10448–10458.

37.

Qiu

, et al. Emergence, prevalence and evolution of porcine reproductive and respiratory syndrome virus 1 in China from 1994 to 2024. Virology 2025; 605: 110457.

38.

Zhao

Feng

, et al. 2',5'-Oligoadenylate synthetase 1(OAS1) inhibits PRRSV replication in Marc-145 cells. Antivir Res 2016; 132: 268–273.

39.

Wei

Qiao

, et al. Porcine reproductive and respiratory syndrome virus utilizes viral apoptotic mimicry as an alternative pathway to infect host cells. J Virol 2020; 94: e00709–e00720.

40.

Liu

Feng

. New perspective of host microRNAs in the control of PRRSV infection. Vet Microbiol 2017; 209: 48–56.

41.

Zhu

Liu

Yuan

, et al. Induction of UPR promotes interferon response to inhibit PRRSV replication via PKR and NF-κB pathway. Front Microbiol 2021; 12: 757690.

42.

Fang

Snijder

. The PRRSV replicase: exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus Res 2010; 154: 61–76.

43.

Evans

Dong

Loyd

, et al. Identification and characterization of small molecule inhibitors of porcine reproductive and respiratory syndrome virus. Antivir Res 2017; 146: 28–35.

44.

Ranaware

Banik

Deshpande

, et al. Magnolol: a neolignan from the Magnolia family for the prevention and treatment of cancer. Int J Mol Sci 2018; 19: 2362.

45.

Bang

Kim

Min

, et al. Antifungal activity of magnolol and honokiol. Arch Pharm Res (Seoul) 2000; 23: 46–49.

46.

Chang

Lee

, et al. Antimicrobial activity of magnolol and honokiol against periodontopathic microorganisms. Planta Med 1998; 64: 367–369.

47.

Kim

Lim

Chung

. Magnolia officinalis and its honokiol and magnolol constituents inhibit human norovirus surrogates. Foodb Pathog Dis 2021; 18: 24–30.

48.

Chen

, et al. The phosphorylation of the N protein could affect PRRSV virulence in vivo. Vet Microbiol 2019; 231: 226–231.

49.

Yang

Liu

Lou

, et al. Glycyrrhiza polysaccharides inhibits PRRSV replication. Virol J 2023; 20: 140.

50.

Duan

Wang

Fang

, et al. Suppression of porcine reproductive and respiratory syndrome virus proliferation by glycyrrhizin. Antivir Res 2015; 120: 122–125.

51.

Wei

Chen

, et al. Inhibition of porcine reproductive and respiratory syndrome virus replication by rifampicin in vitro. Front Vet Sci 2024; 11: 1439015.

52.

Sun

Liu

, et al. Chinese herbal extracts with antiviral activity: evaluation, mechanisms, and potential for preventing PRV, PEDV and PRRSV infections. Animal Dis 2023; 3: 35.

53.

Wei

Z-Y

Wang

X-B

Zhang

H-Y

, et al. Inhibitory effects of indigowoad root polysaccharides on porcine reproductive and respiratory syndrome virus replication in vitro. Antivir Ther 2010; 16: 357–363.

54.

Kawai

Akira

. Innate immune recognition of viral infection. Nat Immunol 2006; 7: 131–137.

55.

, et al. Molecular and cellular mechanisms for PRRSV pathogenesis and host response to infection. Virus Res 2020; 286: 197980.

56.

Guo

, et al. Production of porcine TNFα by ADAM17-mediated cleavage negatively regulates porcine reproductive and respiratory syndrome virus infection. Immunol Res 2016; 64: 711–720.

57.

. Magnolol: chemistry and biology. Ind Crop Prod 2023; 205: 117493.

Magnolol inhibits viral replication and enhances antiviral immune responses against porcine reproductive and respiratory syndrome virus (PRRSV) in Marc-145 cells

Abstract

Background

Methods

Results

Conclusions

Keywords

Introduction

Materials and methods

Cells and viruses

Antibody

Preparation of magnolol

Cytotoxicity assay

Antiviral activity assay

Viral attachment, internalization, replication, and release assays

Real-time quantitative reverse transcriptase PCR (RT-qPCR)

Western blot

Indirect immunofluorescence assay (IFA)

Statistical analysis

Results

Magnolol inhibits PRRSV replication in Marc-145 cells

Magnolol more effective as a post-treatment in inhibiting PRRSV replication

Magnolol blocks viral attachment and replication

Magnolol enhances the expression of immune-related genes in Marc-145 cells

Magnolol upregulates ADAM17 expression

Discussion

Conclusions

Footnotes

Acknowledgements

ORCID iD

Author contributions

Funding

Declaration of conflicting of interests

References