Sage Journals: Discover world-class research

Abstract

Based on the important role of antibiotic treatment in the research of the interaction between Wolbachia and insect hosts, this study aimed to identify the most suitable antibiotic and concentration for Wolbachia elimination in the P. xylostella, and to investigate the effect of Wolbachia and antibiotic treatment on the bacterial community of P. xylostella. Our results showed that the Wolbachia-infected strain was plutWB1 of supergroup B in the P. xylostella population collected in Nepal in this study; 1 mg/mL rifampicin could remove Wolbachia infection in P. xylostella after 1 generation of feeding treatment and the toxic effect was relatively low; among the 29 samples of adult P. xylostella in our study (10 WU samples, 10 WA samples, and 9 WI samples), 52.5% of the sequences were of Firmicutes and 47.5% were of Proteobacteria, with the dominant genera being mainly Carnobacterium (46.2%), Enterobacter (10.1%), and Enterococcus (6.2%); Moreover, antibiotic removal of Wolbachia infection in P. xylostella and transfer to normal conditions for 10 generations no longer significantly affected the bacterial community of P. xylostella. This study provides a theoretical basis for the elimination method of Wolbachia in the P. xylostella, as well as a reference for the elimination method of Wolbachia in other Wolbachia-infected insect species, and a basis for the study of the extent and duration of the effect of antibiotic treatment on the bacterial community of the P. xylostella.

Keywords

antibiotic the 16S rRNA high-throughput sequencing the bacterial community

Introduction

Wolbachia, a member of the Rickettsiaceae (α-Proteobacteria), is a gram-negative bacterium that is widespread in insect species.^1-4 It spreads vertically mainly through the maternal cytoplasm of insect hosts and can alter the sex ratio and reproductive strategy of insect hosts through various regulatory effects, thus increasing its own transmission frequency in host populations.^5,6 Wolbachia strains have different types of reproductive manipulation in insect hosts, including cytoplasmic incompatibility, male-killing, parthenogenesis and feminization.⁴ Furthermore, Wolbachia can also be involved in regulating host nutritional metabolism,⁷ resistance to pathogens,^8,9 behavior,¹⁰ developmental duration, and longevity.¹¹ Currently, it has been demonstrated that the combination of the sterile insect technique (SIT) and the incompatible insect technique (IIT) based on Wolbachia has promising applications in the biological control of mosquitoes¹²; transfection of the wStri strain Wolbachia into the agricultural pest Nilaparvata lugens not only induces high-intensity cytoplasmic incompatibility but also inhibits infection and transmission of the rice ragged stunt virus (RRSV) by N. lugens.¹³ These findings confirm that Wolbachia has good potential for the biological control of arboviruses and agricultural pests.

In the study of Wolbachia-host interactions, it is often necessary to eliminate Wolbachia infection to obtain control uninfected populations of the same genetic background for subsequent experiments, as the strain and frequency of Wolbachia infection varies among different geographic populations.^14-16 Currently, the commonly used method is antibiotic treatment. Antibiotics that have been reported to eliminate Wolbachia mainly include: (1) antibiotics that inhibit bacterial cell wall synthesis, including ampicillin and penicillin; (2) antibiotics that inhibit protein synthesis, including gentamicin and tetracycline; (3) antibiotics that interfere with nucleic acid synthesis, including rifampicin; (4) anti-metabolite sulfonamide antibiotics, etc.¹⁵ The commonly used of these antibiotics is tetracycline, which has been widely used for Wolbachia elimination in a variety of insect hosts such as Coleoptera, Hymenoptera, Lepidoptera, and Diptera. For example, tetracycline feeding treatment of 0.6 and 2.5 mg/g were effective in eliminating Wolbachia from O. furnacalis and Lissorhoptrus oryzophilus, respectively, within 1 generation.^17,18 Raising Drosophila on 0.25 mg/mL Tet-HCl containing food for 2 generations is usually enough to get rid of Wolbachia completely from flies.¹⁹ Rifampin may be effective when tetracycline is not effective in eliminating Wolbachia infection.¹⁵ In addition, high and low temperature treatment is also a method to eliminate Wolbachia infection, and the Wolbachia eliminating rate after 6 generations of the Tetranychus urticae was 100% when it was treated at 32°C.²⁰ However, high and low temperature treatments have a large impact on the insect host itself and are subject to many uncertainties, so they are not usually used as the primary means of Wolbachia elimination in insect hosts.

Although antibiotic treatment is currently the primary means of Wolbachia elimination in insect hosts, the effects of antibiotics on microorganisms are broad-spectrum, and many researchers still have questions about whether antibiotic treatment has persistent effects on other microorganisms in the host. It has been shown that antibiotic intake reduces host microbial diversity and that it is difficult to fully restore it to its original state.^14,20,21 However, the extent and duration of the effect on the host microbial community after elimination of Wolbachia from the host by antibiotic treatment is still poorly understood and deserves further investigation.

P. xylostella is considered one of the most important pests of cruciferous vegetable crops.²² At present, chemical control is still the main means of P. xylostella control, but due to its high level of resistance, and based on the perspective of environmental friendliness, carrying out effective biological control is the focus of future research on integrated control of P. xylostella.²³ Wolbachia has good potential for biological control, but research on the interaction between Wolbachia and P. xylostella and the corresponding mechanisms is still lacking.

In this study, by comparing the elimination efficiency of different types and concentrations of antibiotics on Wolbachia and their effects on the survival rate and developmental period of the P. xylostella themselves, we identified antibiotics and concentrations that could eliminate Wolbachia and have relatively low effects on the P. xylostella itself; after eliminating Wolbachia infection by antibiotic treatment, the P. xylostella were transferred to normal conditions for 10 generations. After 10 generations of rearing under normal conditions, the 16S rRNA high-throughput sequencing was performed on male and female adults of 3 different populations (wild-type naturally uninfected population, wild-type naturally infected population, and antibiotic-treated population), focusing on the effects of different Wolbachia infection states and antibiotic treatment on the bacterial community of the P. xylostella. Our results provide a theoretical basis for the elimination of Wolbachia from the P. xylostella, as well as a reference for screening different strains of Wolbachia-infected insect species, and further explore the feasibility of antibiotic feeding to eliminate Wolbachia infection in the host. In addition, we preliminarily investigated the extent and duration of the effects on the bacterial community of Wolbachia in P. xylostella after elimination of Wolbachia by antibiotic treatment.

Materials and Methods

Sample collection and PCR assay

The population of Wolbachia-infected P. xylostella (WI population) was initially collected in Nepal (85°38′E, 27°74′N) in October 2019. The collected P. xylostella samples were brought back to the laboratory and reared under relative humidity RH = 75% ± 5%, temperature 25 ± 1°C, and photoperiod 14 hours:10 hours (light:dark). The larvae of the P. xylostella were fed with radish seedlings grown in our laboratory, and the adults were supplemented with 10% honey water. After the collected P. xylostella samples were reared in the laboratory and passed on, all individuals of the G0 generation of P. xylostella samples were collected for DNA extraction using the Wizard^®SV Genomic DNA Purification System kit from Promega (USA), referring to the kit instructions for the specific steps.

The Wolbachia infection status of the P. xylostella samples was detected by PCR amplification of the wsp gene,²⁴ and both negative and positive controls were set up in each PCR experiment. In addition, we amplified 5 MLST genes (gatB, coxA, ftsZ, fbpA, and hcpA genes)²⁵ of Wolbachia by PCR with reference to the PubMLST database (https://pubmlst.org/organisms/wolbachia-spp), and all primers used and PCR systems used are shown in Table 1.

Table 1.

Primer sequences and amplicon information of target genes.

Gene	Primers	Sequence (5′-3′)	Amplicon length (bp)	Annealing (°C)	References
Wsp	wsp_81F	TGGTCCAATAAGTGATGAAGAAAC	602	51	Zhou et al²⁴
	wsp_691R	AAAAATTAAACGCTACTCCA
gatB	gatB_F1adp	TGTAAAACGACGGCCAGTGAKTTAAAYCGYGCAGGBGTT	≈500	57	Baldo et al²⁵
	gatB_R1adp	CAGGAAACAGCTATGACCTGGYAAYTCRGGYAAAGATGA
coxA	coxA_F1adp	TGTAAAACGACGGCCAGTTTGGRGCRATYAACTTTATAG	≈500	57
	coxA_R1adp	CAGGAAACAGCTATGACCCTAAAGACTTTKACRCCAGT
ftsZ	ftsZ_F1adp	TGTAAAACGACGGCCAGTATYATGGARCATATAAARGATAG	≈500	50
	ftsZ_R1adp	CAGGAAACAGCTATGACCTCRAGYAATGGATTRGATAT
fbpA	fbpA_F1adp	TGTAAAACGACGGCCAGTGCTGCTCCRCTTGGYWTGAT	≈500	57
	fbpA_R1adp	CAGGAAACAGCTATGACCCCRCCAGARAAAAYYACTATTC
hcpA	hcpA_F3	ATTAGAGAAATARCAGTTGCTGC	≈500	55
	hcpA_R3	CATGAAAGACGAGCAARYTCTGG

Phylogenetic analysis

All gene sequences obtained by PCR amplification (wsp, gatB, coxA, ftsZ, fbpA, and hcpA genes) were first confirmed as target sequences by NCBI blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi), and then aligned using the MAFFT plugin of the PhyloSuite software for alignment.^26,27 The nucleotide substitution models were selected using the ModelFinder plugin in the PhyloSuite software.^27,28 The TPM3 + F + R2 model was used for the wsp gene, and the TVM + F + I model was used for the tandem sequences of the 5 MLST genes. The phylogenetic tree of Wolbachia was constructed based on the maximum likelihood method (ML) using wsp genes and the tandem sequences of 5 MLST genes respectively, and bootstrap values were generated with 1000 replicates.²⁹

Antibiotic treatment

In this study, tetracycline hydrochloride and rifampicin were used to soak the leaves of radish seedlings fed by P. xylostella in different concentrations to simulate the way that P. xylostella was exposed to antibiotics during feeding. Briefly, the leaves of radish seedlings were soaked with tetracycline hydrochloride and rifampicin at 0.05, 0.1, 0.5, 0.8, 1, 2, and 5 mg/mL respectively to feed the diamondback moth infected with Wolbachia. The soaking time of antibiotics at each concentration was 5 minutes. After soaking, the leaves were naturally air-dried on the clean bench with ddH₂O as the control. The antibiotic treatment lasted for the whole larval period, and the number of larval mortality, larval developmental duration, number of pupae, pupae mortality and fecundity were recorded. About 20 larvae were placed in each treatment and 5 replicates were set up. After 24 hours of treatment, the antibiotic-treated radish seedling leaves were replaced. After 1 generation of treatment, the average survival rate of P. xylostella in each treatment group to survive to the adult stage was calculated (total number of P. xylostella samples that survive to the adult stage in 5 replicates/100). In order to test whether Wolbachia was eliminated, DNA of all P. xylostella samples was extracted using the method mentioned above, and the infection rate in each treatment group was detected by PCR and qPCR. Both positive and negative controls were set in each PCR assay. The results of positive PCR amplification indicated that Wolbachia infection still existed, which was regarded as the sample that had not been eliminated by antibiotics. PCR-negative samples are then tested by qPCR, and both PCR and qPCR-negative samples are considered to have been successfully eliminated by antibiotics. After all P. xylostella samples were detected, the antibiotic elimination rate of P. xylostella samples in each treatment group was calculated (total number of P. xylostella samples that successfully eliminated by antibiotics in 5 replicates/100).

After the elimination efficiency of Wolbachia and the development of P. xylostella were counted and compared that treated by different kinds and concentrations of antibiotics, we have selected 1 mg/mL rifampicin solution, which could effectively remove Wolbachia infection within 1 generation and had low toxic effect on P. xylostella, to eliminate Wolbachia in P. xylostella. The P. xylostella treated with 1 mg/mL rifampicin for 1 generation were transferred to normal radish seedlings for propagation and reared for a long period of time for subsequent testing (WA population). Several P. xylostella were randomly selected and tested for Wolbachia infection per generation to confirm that Wolbachia had not returned to infection.

16S rRNA high-throughput sequencing

To assess the effects of Wolbachia infection and antibiotic treatment on the bacterial community of the P. xylostella, we collected P. xylostella samples from the WA population (antibiotic-treated Wolbachia-infected P. xylostella population, and the 10th generation of non-infected WA population after the first generation treated with 1 mg/mL rifampicin mentioned above), the WI population (100% Wolbachia-infected P. xylostella population from Nepal), and the WU population (100% Wolbachia-uninfected P. xylostella population reared in the laboratory), respectively. The WU and WA population were not infected by Wolbachia, the WI and WU population were not treated with antibiotics, the WI and WA population had the same genetic background.

The 1-day-old adult P. xylostella samples were used for the 16S rRNA sequencing. The total DNA of collected adults was extracted using DNeasy^® PowerSoil^® Pro Kit (QIAGEN, USA) and tested for quality. The V3-V4 region of the 16S rRNA gene was amplified using primers 338F-806R (338F: ACTCCTACGGGAGGCAGCAG, 806R: GGACTACHVGGGTWTCTAAT).³⁰ About 5 adult moths were placed in each sample, 3 PCR replicates were set up, and the PCR products from the 3 replicates were mixed and detected using 2% agarose gel electrophoresis. PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen, USA), and the specific steps were referred to the kit instructions. Libraries were built using NEXTFLEX Rapid DNA-Seq Kit and sequenced using Illumina’s Miseq PE300 platform (Shanghai Meiji Biomedical Technology Co., Ltd., China).

Data analysis

The data related to antibiotic treatment were analyzed using the IBM Statistical Package for the Social Sciences (SPSS) version 24.0 (Chicago, IL, USA). The one-way ANOVA were used for comparison between multiple groups of data in the experiment, and Turkey test was used for multiple comparisons of results; t-test was used for comparison between 2 groups of data.

The 16S rRNA raw data were quality-controlled using fastp (https://github.com/OpenGene/fastp, version 0.20.0) software,³¹ and then spliced using FLASH (http://www.cbcb.umd.edu/software/flash, version 1.2.7) software for splicing.³² OTU clustering of the spliced sequences was performed based on 97% similarity using UPARSE software (http://drive5.com/uparse/, version 7.1).³³ RDP classifier (http://rdp.cme.msu.edu/, version 2.11)³⁴ was used for OTU species taxonomy annotation with a confidence threshold of 70% and counted the community composition of each sample. Alpha diversity indices Chao 1, Shannon, ACE, and simpson were calculated based on mothur software (http://www.mothur.org/wiki/Calculators),³⁵ and intergroup variance analysis of Alpha diversity was performed using the IBM Statistical Package for the Social Sciences (SPSS) version 24.0 (Chicago, IL, USA). PCoA analysis (Principal Component Analysis) based on the bray-curtis algorithm was used to test the similarity of microbial community structure between samples.

Results

Wolbachia infection in the P. xylostella

PCR assays based on the Wolbachia wsp gene showed 100% Wollbachia infection of the P. xylostella population collected in Nepal. The phylogenetic tree constructed based on the Wolbachia wsp gene showed that the Wolbachia infected in this population was the B supergroup plutWB1 strain reported in a previous study.³⁶ Consistent with the results of the previous study, the phylogenetic tree we constructed for the Wolbachia wsp gene also indicated that the plutWB1 strain was more closely related to the Wolbachia strain in the African butterfly Acraea pentapolis (Figure 1A).

Figure 1.

Phylogenetic tree of Wolbachia. Maximum-likelihood tree of Wolbachia wsp sequences (A) and MLST sequences (B) from Plutella xylostella. (A) ML tree constructed from Wolbachia wsp sequences of 10 random P. xylostella specimens from WI population. Colors represent the different strains (mint green: plutWB1, yellow: plutWA1, pink: plutWA2). (B) ML tree constructed from MLST sequences of plutWB1 strain Wolbachia. Colors represent the different supergroups (purple: supergroup A, mint green: supergroup B, pink: supergroup D).

The phylogenetic tree constructed based on the 5 MLST genes similarly indicated that the plutWB1 strain belonged to supergroup B (Figure 1B). In addition, the ST typing of the 5 MLST genes in the PubMLST database was 108 (gatB-71, coxA-67, ftsZ-65, fbpA-6, and hcpA-74), which was first reported for the Bfel_B strain Wolbachia of Brangas felderi, a family of Lycaenidae in Lepidoptera.

Effect of antibiotic treatment on the P. xylostella

Wolbachia in different P. xylostella individuals were treated with different concentrations of tetracycline hydrochloride and rifampicin solutions, respectively, and the survival rate of P. xylostella individuals was found to decrease continuously with increasing antibiotic concentrations, and Figure 2A indicates the average survival rate of P. xylostella individuals treated with different antibiotic concentrations. The survival rate of the P. xylostella individuals was slightly higher when treated with 0.05 and 0.1 mg/mL of rifampicin solution compared to the control group, while the survival rate of the P. xylostella individuals was 56% and 69% when treated with 1 mg/mL of tetracycline hydrochloride solution and rifampicin solution, respectively; the high concentration of antibiotic solution had a high lethality rate for the P. xylostella individuals, and the survival rate of the P. xylostella individuals was less than 50% when fed with 2 mg/mL of tetracycline hydrochloride solution and rifampicin solution. The survival rate of the P. xylostella individuals was less than 50% when fed with 2 mg/mL of tetracycline hydrochloride solution and rifampicin solution.

Figure 2.

Survival rate and infection rate of P. xylostella treated with different concentrations of antibiotics. (A) Survival rate of P. xylostella treated with different concentrations of antibiotics. (B) Infection rate of P. xylostella treated with different concentrations of antibiotics.

In order to evaluate the effect of tetracycline hydrochloride and rifampicin treatments on the growth and development of the P. xylostella individuals, developmental duration of the P. xylostella larvae was recorded during feeding. The development duration of P. xylostella larvae after feeding on tetracycline hydrochloride treated radish seedlings was significantly prolonged to 14.00 days when 0.5 mg/mL was treated, about twice that of the control group (Table 2). The larval developmental duration of the P. xylostella larvae of radish seedlings fed on rifampicin was also prolonged to some extent, and the average larval developmental duration of the P. xylostella larvae was 8.98 days at a concentration of 1 mg of rifampicin, which was significantly higher than that of the control P. xylostella larvae at 7.43 days. By comparing the 2 antibiotics, the larval developmental duration of the P. xylostella larvae treated with tetracycline hydrochloride was significantly higher than that of the rifampicin treatment for the same concentration of both antibiotics.

Table 2.

Development period of P. xylostella larvae treated with different concentrations of antibiotics (mean ± standard error).

Concentration (mg/mL)	Developmental period (d)
Concentration (mg/mL)	Tetracycline hydrochloride	Rifampicin
CK	7.43 ± 0.15^a	7.43 ± 0.15^a
0.05	9.18 ± 0.20^b*	7.46 ± 0.15^a*
0.1	9.52 ± 0.21^b*	7.48 ± 0.15^a*
0.5	9.95 ± 0.38^b*	8.05 ± 0.15^b*
0.8	14.00 ± 0.35^c*	8.70 ± 0.16^d*
1	15.10 ± 0.34^d*	8.98 ± 0.20^de*
2	16.55 ± 0.42^de*	9.44 ± 0.25^e*
5	18.33 ± 0.52^e*	9.15 ± 0.39^e*

Different letters indicate significant differences among different concentrations of the same antibiotic.

Indicates significant differences between different antibiotics (P < .05).

Seven different concentrations of tetracycline hydrochloride and rifampicin solutions were used to feed the larvae of the P. xylostella, respectively. The results showed that both tetracycline hydrochloride and rifampicin could effectively remove Wolbachia from the P. xylostella individuals, and the effect of Wolbachia treatment is shown in Figure 2B: Wolbachia infection rate of P. xylostella individuals was not affected when the concentrations of tetracycline hydrochloride and rifampicin were less than 0.5 mg/mL; after feeding rifampicin solution at 0.8 mg/mL for 1 generation, Wolbachia infection was 65% of adult P. xylostella individuals. Wolbachia infection was 65% of the adult P. xylostella individuals after 1 generation of rifampicin solution at 0.8 mg/mL treatment; Wolbachia infection was completely undetectable after 1 generation of tetracycline hydrochloride at 2 mg/mL and rifampicin at 1 mg/mL.

Effect of rifampicin treatment on the bacterial community of the P. xylostella

Using the Illumina Miseq PE300 platform, 1157449 sequences with an average length of 428 bp were obtained using the 16S rRNA gene V3 to V4 variable region as the target. About 68 OTUs were obtained in all 29 samples of the WI, WU, and WA population (IF, IM, UF, UM, AF, AM) according to 97% similarity, belong to 7 phyla, 12 orders, 31 families, 44 families, and 55 genera of bacteria. Among the all 29 P. xylostella samples, 52.5% of the sequences were from the Firmicutes, 47.5% were from the Proteobacteria, and the dominant genera were Carnobacterium (46.2%), Enterobacter (10.1%), and Enterococcus (6.2%) (Figure 3). Sequences of Wolbachia accounted for 3.9% and 0.3% of the total sequences in the female and male adult samples from the WI population (IF, IM), respectively. Moreover, Wolbachia were not detected in other samples from the WA and WU population (UF, UM, AF, AM).

Figure 3.

Relative abundance of different samples of P. xylostella adults at the genus level. IF: female samples of the 100% Wolbachia-infected P. xylostella populations; IM: male samples of the 100% Wolbachia-infected P. xylostella populations; UF: female samples of the 100% Wolbachia-uninfected P. xylostella populations; UM: male samples of the 100% Wolbachia-uninfected P. xylostella populations; AF: female samples of the antibiotic-treated Wolbachia-infected P. xylostella population; AM: male samples of the antibiotic-treated Wolbachia-infected P. xylostella population. (A) Community barplot of 29 P. xylostella specimens, taxonomic composition and relative abundance of bacteria at genus level for all 29 P. xylostella specimens. (B) Community heatmap of 29 P. xylostella specimens, the relative abundances of the top 50 species with total abundances at the taxonomic level in different samples at the taxonomic level.

The OTU coverage rate of all samples in our study was above 99.9%, indicating that the sequencing depth was high and could better reflect the true situation of bacterial composition in the samples. From the antibiotic-treated groups, there were no significant differences in ACE index, chao index, shannon index, and simpson index between the antibiotic-treated groups and the non-antibiotic-treated groups; from the infection status groups, there were no significant differences in ACE index, chao index, shannon index, and simpson index between the Wolbachia-infected groups and the Wolbachia-uninfected groups (Figure 4A–D). Bray–Curtis based PCoA was used to estimate the β-diversity of bacterial communities, but none of the 3 populations clustered significantly separately (Figure 4E).

Figure 4

α-Diversity index analysis and β-diversity analysis of P. xylostella adults. (A) Shannon’ diversity index. (B) Chao1 estimated richness. (C) Simpson’ diversity index. (D) Chao1 estimated richness. (E) Principal coordinates analysis (PCoA) plot.

Discussion

Wolbachia infections

In this study, the P. xylostella samples were initially collected in Nepal (85°38′E, 27°74′N) in October 2019 and were brought back to our laboratory. After feeding for 1 generation in the laboratory, all P. xylostella samples of G0 generation were collected and the wsp gene of Wolbachia was used for infection detection.²⁴ The infection rate of Wolbachia in this P. xylostella population was 100%. A previous study on global Wolbachia infection of the P. xylostella showed that the natural infection rate of Wolbachia in P. xylostella was very low, with the global average infection rate only 5%, and the highest infection rate in the population was only 40%.³⁶ This may be due to the difference of Wolbachia infection in different geographic populations. Moreover, this is consistent with the views of many researchers: although some studies have estimated that about 2/3 of insect species are infected with Wolbachia at present,³⁷ this data is still very conservative due to the limitations of sample size and detection methods.³⁸ The wide distribution of Wolbachia in insect species and its various regulatory effects on the host indicate that Wolbachia has a promising application prospect in biological control.³⁷

The phylogenetic tree constructed based on Wolbachia wsp gene and 5 MLST genes showed that Wolbachia infected by P. xylostella of Nepal population belonged to plutWB1 of supergroup B (Figure 1). Futhermore, the phylogenetic tree constructed based on the Wolbachia wsp gene is consistent with the results of the previous study.³⁶ Compared with the Wolbachia strains reported in P. xylostella (wXylB1, plutWA1, and plutWA2), plutWB1 is more closely related to the Wolbachia strains in the African butterfly Acraea pentapolis (Figure 1A).^3,36 The typing result of 5 MLST genes of plutWB1 strain Wolbachia in PubMLST database was 108 (gatB-71, coxA-67, ftsZ-65, fbpA-6, and hcpA-74), and the 108 ST was first reported the Bfel_B strain Wolbachia of Brangas felderi, a family of Lycaenidae in Lepidoptera.²⁵ These results may indicate widespread horizontal transmission of Wolbachia between lepidopteran butterfly species and moth species, which was also confirmed by the results of a previous study.³⁸

Antibiotic treatment

The interaction between Wolbachia and the host is currently a hot topic of Wolbachia-related research, and due to the different strains and frequency of Wolbachia infection in different geographical populations, manual removal of Wolbachia from the host is often required to ensure consistent genetic background in control group. Antibiotic treatment is the most widely used method to remove Wolbachia from hosts, which has less effect on the hosts themselves and is more stable than other methods. The types and concentrations of antibiotics used to remove different Wolbachia strains from different insect hosts vary.

In order to identify the most suitable antibiotic and concentration for the elimination of Wolbachia in P. xylostella, 2 antibiotics, tetracycline hydrochloride and rifampicin, which are currently widely used for the elimination of Wolbachia in different insect species,¹⁵ were used and fed at different concentration gradients in the larval stage of P. xylostella. The results showed that both antibiotics could obtain Wolbachia-uninfected P. xylostella after 1 generation of feeding treatment (Figure 2B), but the antibiotic also had some effects on the P. xylostella individuals themselves (Figure 2A). Different types and concentrations of antibiotics showed different degrees of toxic effects on the larvae of P. xylostella individuals, mainly in the form of a significantly longer larval developmental duration and increased mortality of P. xylostella individuals (Table 2). This phenomenon is not surprising considering the mechanism of antibiotics. For example, tetracycline inhibits protein synthesis and can remove Wolbachia from E. formosa at lower treatment concentrations, but feeding 50 mg/mL of tetracycline can kill all female individuals within 3 days.³⁹ Therefore, before using antibiotic-treated insect individuals in experiments, a blank treatment period of several generations is usually taken to avoid the effects of antibiotic treatment on the growth and development of the insect hosts themselves. It has been shown in Drosophila that selective autophagy contributes to the elimination of antibiotics (Tetracycline) damaged Wolbachia.⁴⁰ In diamondback moth, whether autophagy can help eliminate damaged Wolbachia remains to be further studied. The results showed that 1 mg/mL rifampicin could remove Wolbachia infection after feeding treatment of P. xylostella larvae for 1 generation, and the toxic effect was low. Therefore, 1 mg/mL rifampicin was used to feed the Wolbachia-infected P. xylostella individuals, and after the treatment, the P. xylostella individuals was transferred to normal feeding conditions for several generations for subsequent experiments. In addition, we tested the infection status of Wolbachia in a random sample of each generation of antibiotic-treated P. xylostella populations.

The bacterial community

In this study, the bacterial community of P. xylostella were studied and compared for 3 populations of P. xylostella (WI, WA, and WU). In general, among the 29 samples of P. xylostella, the bacterial sequences were dominated by Firmicutes (52.5%) and Proteobacteria (47.5%); the dominant genera were Carnobacterium (46.2%), Enterobacter (10.1%), and Enterococcus (6.2%) (Figure 3). The bacterial sequences of Wolbachia accounted for 3.9% and 0.3% of the total sequences in the female and male P. xylostella samples of the WI population, respectively, which is consistent with the transmission characteristics of Wolbachia, a maternally transmitted endosymbiotic bacterium that spreads vertically, mainly through the cytoplasm of the eggs.⁴ The bacterial sequences of Wolbachia were not detected in other P. xylostella samples, which further indicated that 1 mg/mL rifampicin was effective in eliminating Wolbachia from the P. xylostella. In addition, we also confirmed by molecular assays and phylogenetic analysis that the Wolbachia strain infecting the WI P. xylostella population belongs to the previously reported strain B supergroup plutWB1, and that infection by this strain can lead to sex-ratio distortion in P. xylostella.³⁶

Several studies have shown that the use of antibiotics leads to changes in the microbial community of insects. However, our results showed that there was no significant difference in microbial community diversity of diamondback moth reared for 10 generations under normal conditions after 1 generation of antibiotic treatment (Figure 4). Our research shows that after 10 generations of normal conditions, the impact of antibiotic treatment on the generation has been basically eliminated, and the bacterial abundance and microbial community diversity of diamondback moth have returned to normal. In addition, there was no significant difference in bacterial abundance and diversity among diamondback moth populations with different genetic backgrounds. Although the original sampling sites were located in different geographical locations and genetic backgrounds, they were raised for many generations under the same conditions in the laboratory. The presence or absence of Wolbachia has no significant difference in bacterial abundance and diversity within the adult population of diamondback moth. The possible reason for this result is that we only measured the samples of adults. Whether Wolbachia has an impact on the bacterial abundance and microbial community diversity of other instars of diamondback moth needs further study.

Conclusions

In conclusion, in this study, we clarified the optimal antibiotic type and concentration for the elimination of Wolbachia in the P. xylostella by comparing the elimination efficiency of 2 different antibiotics (tetracycline hydrochloride and rifampicin) at different concentration gradients and their effects on the developmental duration of P. xylostella larvae. By molecular detection and the 16S rRNA high-throughput sequencing, we confirmed that 1 mg/mL of rifampicin was effective in eliminating Wolbachia of the P. xylostella. In addition, we also comparatively analyzed the bacterial community of 3 different populations of the P. xylostella (WI, WA, and WU), which can provide a reference for the elimination of Wolbachia in other insect species and the effect of antibiotic treatment on the microbial communities of insect hosts.

Footnotes

Funding:

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was funded by the National Key Research and Development Program of China (2017YFE0122000), the Fujian Natural Science Fund for Distinguished Young Scholars (2022J06013), the National Natural Science Foundation of China (31972271), Outstanding Young Scientific Research Talents Program of Fujian Agriculture and Forestry University (xjq201905), the Fujian Agriculture and Forestry University Science and Technology Innovation Fund Project (CXZX2019001G, CXZX2017206).

Declaration of Conflicting Interests:

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

ORCID iD

Shijun You

References

Hertig

Wolbach

SB.

Studies on rickettsia-like micro-organisms in insects. J Med Res. 1924;44:329-374.7.

Hertig

The Rickettsia,Wolbachia pipientis(gen. Et sp.n.) and associated inclusions of the mosquito, Culex pipiens. Parasitology. 1936;28:453-486.

Jeyaprakash

Hoy

MA.

Long PCR improves Wolbachia DNA amplification: Wsp sequences found in 76% of sixty-three arthropod species. Insect Mol Biol. 2000;9:393-405.

Werren

Baldo

Clark

ME.

Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol. 2008;6:741-751.

LePage

Metcalf

Bordenstein

, et al. Prophage WO genes recapitulate and enhance Wolbachia-induced cytoplasmic incompatibility. Nature. 2017;543: 243-247.

Perlmutter

Bordenstein

Unckless

, et al. The phage gene wmk is a candidate for male killing by a bacterial endosymbiont. PLoS Pathog. 2019;15: e1007936.

Bing

Zhao

, et al. Wolbachia supplement biotin and riboflavin to enhance reproduction in planthoppers. ISME J. 2020;14:676-687.

Cai

Zhang

Liu

, et al. Wolbachia enhances expression of NlCYP4CE1 in Nilaparvata lugens in response to imidacloprid stress. Insect Sci. 2021;28: 355-362.

Moreira

Iturbe-Ormaetxe

Jeffery

, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, chikungunya, and Plasmodium. Cell. 2009;139:1268-1278.

10.

Wang

YF.

The effect of the endosymbiont Wolbachia on the behavior of insect hosts. Insect Sci. 2020;27:846-858.

11.

Carrington

Leslie

Weeks

Hoffmann

AA.

The popcorn Wolbachia infection of Drosophila melanogaster: can selection alter Wolbachia longevity effects?

Evol. 2009;63:2648-2657.

12.

Zheng

Zhang

, et al. Incompatible and sterile insect techniques combined eliminate mosquitoes. Nature. 2019;572:56-61.

13.

Gong

, et al. Stable introduction of plant-virus-inhibiting Wolbachia into planthoppers for rice protection. Curr Biol. 2020;30:4837-4845.e5.

14.

Zhang

Zhou

, et al. Antibiotic exposure perturbs the bacterial community in the small brown planthopper Laodelphax striatellus. Insect Sci. 2020;27: 895-907.

15.

Floate

Fields

Pang

BP.

Review of treatment methods to remove Wolbachia bacteria from arthropods. Symbiosis. 2014;62:1-15.

16.

Wang

Jiang

YX.

Incomplete removal of Wolbachia with tetracycline has two-edged reproductive effects in the thelytokous wasp Encarsia formosa (Hymenoptera: Aphelinidae). Sci Rep. 2017;7:44014.

17.

Kageyama

Nishimura

Hoshizaki

Ishikawa

Feminizing Wolbachia in an insect, Ostrinia furnacalis (Lepidoptera: Crambidae). Heredity. 2002;88: 444-449.

18.

Chen

Cheng

Jiang

Way

MO.

Identification and biological role of the endosymbionts Wolbachia in rice water weevil (Coleoptera: Curculionidae). Environ Entomol. 2012;41:469-477.

19.

O’Shea

Singh

ND.

Tetracycline-exposed Drosophila melanogaster males produce fewer offspring but a relative excess of sons. Ecol Evol. 2015;5: 3130-3139.

20.

van Opijnen

Breeuwer

. High temperatures eliminate Wolbachia, a cytoplasmic incompatibility inducing endosymbiont, from the two-spotted spider mite. Exp Appl Acarol. 1999;23:871-881.

21.

Dethlefsen

Relman

DA.

Incomplete recovery and individualized responses of the human distal gut microbiota to repeated antibiotic perturbation. Proc Natl Acad Sci USA. 2011;108 Suppl 1:4554-4561.

22.

You

, et al. Variation among 532 genomes unveils the origin and evolutionary history of a global insect herbivore. Nat Commun. 2020;11:2321.

23.

Feng

Liu

You

Furlong

MJ.

Biology, ecology, and management of the diamondback moth in China. Annu Rev Entomol. 2016;61:277-296.

24.

Zhou

Rousset

O’Neil

. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc Biol Sci. 1998;265:509-515.

25.

Baldo

Dunning Hotopp

Jolley

, et al. Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Appl Environ Microbiol. 2006; 72:7098-7110.

26.

Katoh

Rozewicki

Yamada

KD.

MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2019; 20:1160-1166.

27.

Zhang

Gao

Jakovlić

, et al. PhyloSuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol Ecol Resour. 2020;20:348-355.

28.

Kalyaanamoorthy

Minh

Wong

TKF

von Haeseler

Jermiin

LS.

ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017;14:587-589.

29.

Nguyen

Schmidt

von Haeseler

Minh

BQ.

IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015;32:268-274.

30.

Srinivasan

Hoffman

Morgan

, et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PLoS One. 2012;7:e37818.

31.

Chen

Zhou

Chen

Fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34:i884-i890.

32.

Magoč

Salzberg

SL.

FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics. 2011;27:2957-2963.

33.

Edgar

RC.

UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat Methods. 2013;10:996-998.

34.

Wang

Garrity

Tiedje

Cole

JR.

Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol. 2007;73:5261-5267.

35.

Schloss

Westcott

Ryabin

, et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol. 2009;75: 7537-7541.

36.

Delgado

Cook

JM.

Effects of a sex-ratio distorting endosymbiont on mtDNA variation in a global insect pest. BMC Evol Biol. 2009;9:49.

37.

Hilgenboecker

Hammerstein

Schlattmann

Telschow

Werren

JH.

How many species are infected with Wolbachia? – a statistical analysis of current data. FEMS Microbiol Lett. 2008;281:215-220.

38.

Ahmed

Breinholt

Kawahara

AY.

Evidence for common horizontal transmission of Wolbachia among butterflies and moths. BMC Evol Biol. 2016; 16:118.

39.

Stouthamer

Mak

Influence of antibiotics on the offspring production of the Wolbachia-infected parthenogenetic parasitoid Encarsia formosa. J Invertebr Pathol. 2002;80:41-45.

40.

Hargitai

Kenéz

Al-Lami

Szenczi

Lőrincz

Juhász

Autophagy controls Wolbachia infection upon bacterial damage and in aging Drosophila. Front Cell Dev Biol. 2022;10:976882.

Effects of Antibiotic Treatment on the Development and Bacterial Community of the Wolbachia -Infected Diamondback Moth

Abstract

Keywords

Introduction

Materials and Methods

Sample collection and PCR assay

Phylogenetic analysis

Antibiotic treatment

16S rRNA high-throughput sequencing

Data analysis

Results

Wolbachia infection in the P. xylostella

Effect of antibiotic treatment on the P. xylostella

Effect of rifampicin treatment on the bacterial community of the P. xylostella

Discussion

Wolbachia infections

Antibiotic treatment

The bacterial community

Conclusions

Footnotes

Funding:

Declaration of Conflicting Interests:

ORCID iD

References