Prevalence of feline leukaemia provirus DNA in feline lymphomas

Dear Editors,

We read with interest the paper by Weiss et al ¹ investigating the prevalence of feline leukemia virus (FeLV) proviral DNA in feline lymphomas; since its publication in 2010, this study has been cited in as many as 34 papers (Google Scholar, 24 August 2020). We identified an error in the listing of primers by Weiss et al ¹ while attempting to utilize the method for detection of FeLV proviral DNA by semi-nested PCR. As published, the primers do not perform as intended.

Upon further investigation, we noted an inadvertent interchange of primer sequences for FeLVU3f2 and FeLVU3r1 in Table 1 published by Weiss et al ¹ compared with those in the referenced publication by Suntz et al, ² thereby causing non-specific amplifications, decreased sensitivity and erroneous results (Figure 1). With two sense-oriented primers and an absent antisense-oriented primer, utilization of the first-round PCR primer sequences as published by Weiss et al ¹ causes only linear amplification of targeted proviral sequences (Figure 2) and does not yield an amplicon of expected size (185 base pairs [bp]) (Figure 1a). Moreover, a predicted size band (110 bp) is not visualized after second-round (semi-nested) amplification of up to 10,000 copies of exogenous FeLV template (Figure 1c, lanes 1–3) and is only observed with very high positive control template input (Figure 1c, lane 4). By contrast, use of the correctly listed primers in Suntz et al ² for first-round PCR yields an amplicon of the expected size (185 bp) at very high positive control template input (Figure 1b, lane 4), while second-round PCR (semi-nested) enables detection of as few as 10 copies of exogenous FeLV U3 proviral DNA (Figure 1d, lane 1).

Table 1

Corrected primer sequences, orientation and expected amplicon size

Identification	Sequences (5′‒3′)	Orientation	Amplicon size (bp)
FeLVU3f1	TTACTCAAGTATGTTCCCATG	Sense	185
FeLVU3f2	CTTGAGGCCAAGAACAGTTA	Sense	110
FeLVU3r1	AGGTCGAACTCTGGTCAACT	Antisense

bp = base pairs

Figure 1

Amplicons from first-round PCR using primers as described by (a) Weiss et al ¹ and (b) Suntz et al. ² Amplicons from second-round PCR (semi-nested) using primers as described by (c) Weiss et al ¹ and (d) Suntz et al. ² L = 100 base pair DNA ladder; (-) = genomic DNA template from feline leukemia virus (FeLV)-negative feline lymphoma (3201 cell line); lanes 1, 2 and 3 contain 10, 1000 and 10,000 copies of in-house generated FeLV U3 region standard as template, respectively, diluted in a carrier solution of sheared chum salmon (Oncorhynchus keta) sperm DNA; 4 = genomic DNA template from FeLV-positive feline lymphoma cells (FL74 cell line); NT = no template control

Figure 2

Diagram of exogenous feline leukemia virus (FeLV) proviral DNA and first-round PCR amplification of long terminal repeat (LTR) U3 regions using primers as described by (a) Weiss at al ¹ and (b) Suntz et al. ² Black dashed arrow denotes interchanged primer sequences as listed by Weiss et al ² ; gray dashed arrow denotes primer sequences as expected. Second-round PCR (semi-nested) using primers as described by (c) Weiss et al ¹ and (d) Suntz et al. ² LTR containing U3, R, U5 regions; gag, group-specific antigen gene; pol, polymerase gene; env, envelope gene. Figure is not to scale. bp = base pairs

Utilization of the correct primers presented in Table 1 here will both prevent unsuspected erroneous false-negative results and enable investigators to obtain true positive data for future in vivo and in vitro studies to assess the presence or absence of exogenous FeLV proviral DNA in blood, tissues, organs and cell cultures.

Garrick M Moll DVM¹Cheryl L Swenson DVM, PhD, DACVP (Clinical)²Vilma Yuzbasiyan-Gurkan PhD³¹Comparative Medicine and Integrative Biology, Michigan State University, East Lansing, MI, USA²Department of Pathobiology and Diagnostic Investigation, Michigan State University, East Lansing, MI, USA³Department of Small Animal Clinical Sciences, Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI, USA