Feline leprosy due to Candidatus ‘Mycobacterium tarwinense’: Further clinical and molecular characterisation of 15 previously reported cases and an additional 27 cases

Abstract

Objectives:

This paper, the first in a series of three on ‘feline leprosy’, provides a detailed description of disease referable to Candidatus ‘Mycobacterium tarwinense’, the most common cause of feline leprosy in Victoria, Australia.

Methods:

Cases were sourced retrospectively and prospectively for this observational study, describing clinical, geographical and molecular microbiological data for cats definitively diagnosed with Candidatus ‘M tarwinense’ infection.

Results:

A total of 145 cases of feline leprosy were scrutinised; 114 ‘new’ cases were sourced from the Victorian Infectious Diseases Reference Laboratory records, veterinary pathology laboratories or veterinarians, and 31 cases were derived from six published studies. Forty-two cats were definitively diagnosed with Candidatus ‘M tarwinense’ infection. Typically, cats were between 3 and 11 years of age, with no gender predilection, and were generally systemically well. All had outdoor access. Most cats underwent surgical resection of lesions with adjunctive medical therapy, often utilising a combination of oral clarithromycin and rifampicin for at least 3 months. Prognosis for recovery was generally good. Resolution of lesions was not observed in the absence of treatment, but a number of untreated cats continued to enjoy an acceptable quality of life despite persistence of the disease, which extended locally but did not appear to disseminate to internal organs. Preliminary results of draft genome sequencing confirmed that the species is a member of the Mycobacterium simiae complex.

Conclusions and relevance:

Candidatus ‘M tarwinense’, a fastidious member of the M simiae complex, is capable of causing feline leprosy with a tendency to produce lesions on the head, particularly involving the eyes and periocular skin. The disease has an indolent clinical course and generally responds favourably to therapy despite lesions often containing large numbers of organisms. Detailed genomic analysis may yield clues as to the environmental niche and culture requirement of this elusive organism. Prospective treatment trials and/or drug susceptibility testing in specialised systems would further inform treatment recommendations.

Introduction

‘Feline leprosy’ is a skin condition caused by a variety of fastidious mycobacterial species, which, by definition, will not routinely grow on synthetic media in the laboratory. The disease was first described in 1962 in urban-dwelling cats from Auckland, New Zealand, which presented with subcutaneous nodules containing acid-fast bacilli (AFB).¹ In the first decade or so after the initial report, cats with what appeared to be the same condition were reported in eastern Australia,^2,3 western Canada,⁴ the United Kingdom (UK),^5,6 southwestern USA⁷ and the Netherlands.⁸ More recently, the condition has been identified in cats domiciled in France,^9,10 New Caledonia,¹⁰ Italy,¹¹ the Greek islands¹² and Japan.¹³

Based on rodent inoculation studies,^3,8,14 and delayed-type hypersensitivity skin reactions between feline ‘lepromin’ and Mycobacterium lepraemurium,¹⁵ it was long assumed that this latter organism was the sole causative agent of feline leprosy. Hughes and colleagues,¹⁶ in a seminal paper, demonstrated that the aetiology of feline leprosy was heterogeneous and could not be ascribed to M lepraemurium alone. That, and subsequent studies by this present group and others in North America, identified the involvement of at least three other fastidious species of mycobacteria:

A novel mycobacterial species we propose be provisionally called Candidatus ‘Mycobacterium tarwinense’,¹⁷ related to the Mycobacterium simiae group;

A second novel mycobacterial species related to Mycobacterium leprae and Mycobacterium lepromatosis, which we propose be provisionally called Candidatus ‘Mycobacterium lepraefelis’, found along the eastern coast of Australia and both islands of New Zealand^9,16,18,19 (and perhaps Canada²⁰);

Mycobacterium visibile (erroneously called Mycobacterium visibilis), documented in cats from western Canada, and the states of Idaho and oregon in the Pacific Northwest of the USA.²¹

The last organism is phylogenetically similar to Candidatus ‘M lepraefelis’, although no further reports of the disease have emerged since the studies in the 1990s, so the species remains largely uncharacterised. Infections caused by members of the Mycobacterium avium complex,²² Mycobacterium ulcerans²³ and other slow-growing mycobacteria can resemble feline leprosy in some respects, but with careful specimen collection and handling it is possible to isolate these organisms by culture in liquid or on solid mycobacterial media in vitro.

Progress in unravelling the epidemiology of fastidious mycobacterial infections in cats has been hampered by the requirement to access the technological expertise and finances to establish a definitive diagnosis via molecular methodologies. Indeed, in a large case series concerning feline mycobacteriosis in the UK, the causative agent was only established in 47% of cases, principally because molecular methods were not used to augment traditional mycobacterial culture and identification methods.²⁴

Previous studies of feline leprosy have yielded preliminary insights into the epidemiology of this disease, although these investigations were limited by small case numbers and relatively short periods of follow-up. This paper, the first in a series of three, seeks to extend those findings by providing a detailed description of feline leprosy cases referable to Candidatus ‘M tarwinense’, the most common cause of this condition in Victoria, Australia. Subsequent papers will concern M lepraemurium and Candidatus ‘M lepraefelis’ (see right).

Materials and methods

Case recruitment, demographics and data retrieval

Cases were identified by a review of the record database of the Mycobacterium Reference Laboratory of the Victorian infectious Diseases Reference Laboratory (VIDRL) from 1998–2015. During the period 2008–2014, active case recruitment was carried out by contacting veterinarians and veterinary pathologists, and via notification in a variety of newsletters and other publications (eg, Journal of Feline Medicine and Surgery, Control & Therapy Series of the Centre for Veterinary Education), as well as via e-mail groups and direct mail. Prospective clinical and/or necropsy data were retrieved with owner consent from case records of the primary veterinarians, where possible. Historical cases from the literature were sourced via online resources (PubMed, Web of Knowledge, CAB Abstracts, Medline and Google Scholar) using the search terms ‘cat or cats or feline’, ‘leprosy’ and ‘mycobacteri*’. Cases were only included in the study if the causal species had been definitively identified using molecular methods.

Where available, data such as estimated age at time of diagnosis, gender, breed, geographical location of domicile (postcode), lifestyle and/or other potentially contributing factors (eg, fight wounds, immunosuppressive drug therapy), anatomical location and nature of lesions (single vs multiple, ulcerated vs intact nodules), results of necropsy examination (including cytology and/or histopathology), retroviral status (where available), treatment (drug therapy and/or surgery) and outcome were recorded.

Clinical disease was classified as: few (one to two) or multiple (three or more) nodules, generally affecting one or more of the following anatomical regions: head, forelimbs, hindlimbs, body and tail/perineum. Cats with innumerate nodules covering many areas of the body were classified as having generalised nodular skin disease.

Many cats were treated with at least some input from the authors concerning case management. Unfortunately, cats were not treated in a consistent manner, as each cat/client situation required a different approach; vis-à-vis requirement for once daily therapy vs twice daily therapy, surgery allowed vs not permitted, cat difficult to medicate, owner financially constrained, and so forth.

Cytology/histology

In most cases, fine-needle aspirates from representative lesions were stained using Ziehl–Neelsen (ZN) and/or a rapid modified Romanowsky stain (eg, Diff Quik, Rapid stain), and the presence of mycobacteria was suggested by the observation of AFB or ‘negatively stained bacilli’ (NSB), respectively. Biopsy specimens were fixed in formalin for 12–48 h, embedded in paraffin, cut to 5 μm thickness and stained using haematoxylin and eosin (H&E) and either ZN or Fite’s stain, and examined using conventional light microscopy. Such cytological and histological preparations were also used to harvest material suitable for PCR testing (see later).²⁵

Enumeration of AFB/NSB was performed on either cytological or histopathological samples and the following categories of bacterial index (BI)²⁶ ascribed:

Low bacterial index BI 1+ to 2+ (see box below) or where the pathological description noted ‘low numbers of’ or ‘few’ organisms;

High bacterial index BI 3+ to 6+ or where the description noted ‘moderate’ or ‘many’ organisms.

The terms ‘paucibacillary’ and ‘multibacillary’ have been used in previous publications to describe bacterial numbers in lesions;^19,27 however, to avoid confusion the authors have elected not to use these terms in this series of papers. These classifications have been expanded in the human leprosy field to include reference to the number and type of lesions observed, whether involvement of peripheral nerves is a feature, the presumed ‘infectiousness’ of a patient and the recommended duration and type of therapy.²⁸ These classifications do not apply for feline patients.

As the availability, type and degree of detail of reported cytological and histopathological data varied widely for each patient, these data were not included in the results.

Molecular microbiology methods

DNA was extracted from fresh tissue, methanol-fixed stained and unstained cytology samples (typically aspirates of cutaneous nodules), or de-waxed paraffin-embedded tissue, using methods described elsewhere.^17,25–29

Initial identification of the aetiological agent was generally performed by amplification and sequencing of the internal transcribed spacer (ITS) region, using a nested PCR protocol described previously.¹⁷ Some later cases were identified via multiplex real-time (qPCR) assay using the following protocol (this was typically confirmed via subsequent sequencing of the ITS region). The 20 μl PCR reaction contained 10 μl of SensiFAST Probe Lo-Rox mix (Bioline Reagents) forward and reverse primers at a concentration of 8 μM (1 μl each), probe at a concentration of 2 μM (1 μl), 3.6 μl of nucleotide-free water (NFW) and 1 μl of DNA template. Internal positive control reagents (TaqMan Exogenous internal Positive Control Reagents; Applied Biosystems) were used in the following amounts per reaction: 2 μl 10x Exo IPC Mix, 0.4 μl 50x Exo IPC.

The primers for the conventional and real-time PCR assays are shown in Table 1. Amplification and detection were performed with the ABi Prism 7500 Fast Real-Time PCR system (Applied Biosystems) using the following programme: one cycle of 95°C for 5 mins and 40 cycles of 95°C for 10 s and 60°C for 30 s.

Table 1

Details of primers used in the PCR methods

Primer or probe	Sequence (5′–3′)	Target locus	Direction	Reference or source
Tarwin TF new	GCCGGGTGCACAATAACAG	ITS	Forward	This study
Tarwin TR new	GAGTGTTATCTCAGGGCCCAATA	ITS	Reverse	This study
Tarwin Probe	6FAM-CAGTCGCCAGACACG-MGBNFQ	Not applicable	Not applicable	This study
Ec16S.1390p (1st round)	TTGTACACACCGCCCGTCA	ITS(1)	Forward	30
Mb23S.44n (1st round)	TCTCGATGCCAAGGCATCCACC	ITS(1)	Reverse	30
SP1 (2nd round)	ACCTCCTTTCTAAGGAGCACC	ITS(1)	Forward	31
SP2 (2nd round)	GATGCTCGCAACCACTATCCA	ITS(1)	Reverse	31
rRNA1	AGAGTTTGATCCTGGCTCAG	16S rRNA	Forward	32
MR1	AGTCCCAGTGTGGCCGG	16S rRNA	Reverse	33
MR3	CCTACGAGCTCTTTACG	16S rRNA	Reverse	17
Tb11	ACCAACGATGGTGTGTCCAT	hsp65	Forward	34
Tb112	CTTGTCGAACCGCATACCCT	hsp65	Reverse	34
Z205 (1st round)	ACGTTCACCACAGCAAGCACCA	sodA	Forward	35
Z212 (1st round)	TCGGCCCAGTTCACGACGTT	sodA	Reverse	35
Tarwin long sodAF (2nd round)	GGGTTTGAATGACGCATCG	sodA	Forward	This study
Tarwin long sodAR (2nd round)	TTGACGTAGTCCGCCTTGAC	sodA	Reverse	This study
GrpoB1	ATCGACCACTTCGGCAACCGCC	rpoB	Forward	35
GrpoB2	GGTACGGCGTCTCGATGAASCCG	rpoB	Reverse	35
MF	CGACCACTTCGGCAACCG	rpoB	Forward	36
TBB rpoB2	TACGGCGTCTCGATGAASCC	rpoB	Reverse	36

Amplification of the hsp65, rpoB and sodA regions was also performed using the primers listed in Table 1 and under the conditions described by Devulder and colleagues,³⁵ except for sodA, which was run as a nested PCR. Briefly, 5 μl of template DNA was added to 20 μl of the first-round PCR mixture containing 5 μl 10x PCR buffer with 1.5 mM MgCl₂, 10 μl Q solution (Qiagen), 200 μM deoxynucleoside triphosphates (dNTPs), primers Z205 and Z212 (at 2 μM each), and 0.25 μl of Taq DNA polymerase (Qiagen) and 10.75 μl NFW. The amplification was performed with a Mastercycler gradient (Eppendorf) using the following profile: 95°C for 5 mins, followed by 38 cycles of 94°C for 1 min, 62°C for 1 min and 72°C for 1 min. The second-round PCR mixture contained 2.5 μl of the first-round PCR product in a final 50 μl volume containing PCR buffer with 1.5 mM MgCl₂ (Qiagen), 200 μM dNTPs, primers ‘Tarwin long sodAF’ and ‘Tarwin long sodAR’ (at 2 μM each), and 0.25 μl Taq DNA polymerase (Qiagen). After mid-2013, MyTaq Mix (Bioline) was used, as per the manufacturer’s instructions, instead of the Qiagen reagents in conventional PCR assays. Negative extraction controls were included in each instance.

Genetic analysis

DNA sequencing was performed as previously described¹⁷ using the primers listed in Table 1. Negative PCR controls were used in each instance. Sequence data were edited and analysed using either the Bionumerics v4.0 (Applied Maths) or MacVector v14.0.4 (MacVector) programs. Sequences were aligned using ClustalW and curated manually from chromatographic data.

Mycobacterial culture

Attempts at culture of this organism have been described previously.¹⁷ In summary, fresh tissue samples were homogenised in bead bottles with Ringer’s solution and were decontaminated with an equal volume of 2% sodium hydroxide, incubating at room temperature for 15 mins and neutralising with 10% orthophosphoric acid (modified Petroff method). Samples were centrifuged at 4000 rpm for 20 mins and pellets resuspended in 2 ml Ringer’s solution. A quantity of 400 μl of the decontaminated suspension was used as an inoculum for a variety of liquid and solid media, including Mycobacteria Growth Indicator Tube (MGIT) broths with PANTA added according to the manufacturer’s recommendations (BD), Löwenstein–Jensen medium (with and without a 1% ferric ammonium citrate supplement), Brown and Buckle medium, chocolate agar, 7H10 slopes with antibiotics (25 μg/ml piperacillin, 50 μg/ml amphotericin, 25 μg/ml vancomycin, 800 mg/ml actidione, 4 μg/ml aztreonam) and buffered charcoal yeast extract medium. Cultures were incubated aerobically, and in some cases microaerophilically, at 31°C, 36°C and 43°C and were monitored weekly for up to 12–16 weeks.

Statistical analysis

Two-tailed Fisher’s exact and X² tests were used to assess associations between categorical variables, and the Mann–Whitney test was used to compare continuous variables, using an online epidemiological statistical resource (OpenEpi). P values <0.05 were considered significant.

Results

Clinical data

A total of 145 cases of feline leprosy were scrutinised as part of this study; 114 cases were sourced from the VIDRL records, veterinary pathology laboratories or veterinarians, with an additional 31 cases derived from six published studies.^{10,12,16,17,19,20} Of this total, 42 cats were infected with Candidatus ‘M tarwinense’. Twenty-seven were ‘new’ cases, while 15 had been previously reported, all by the current group of authors. For the 15 previously reported cases, the follow-up obtained for this case series was more detailed and of a much longer duration (15 years in one instance).

Median age at diagnosis was 6.8 years (range 1–18). Where gender was recorded, 17/39 (44%) Candidatus ‘M tarwinense’ cases were male. Where breed was recorded, 25/36 cats were domestic shorthair, 1/36 was a domestic mediumhair, 6/36 were domestic longhair, and there was one each of Burmese cross, Abyssinian cross, Russian Blue cross and Ragdoll. Geographical location data were recorded for 37 cats (Figure 1), revealing that all but two were domiciled in a restricted area of south-eastern Victoria. The two discordant cases were from Lane Cove, Sydney, and the Central Coast of New South Wales (NSW), near Gosford.³⁷

Figure 1

Geographical distribution of feline infections caused by Candidatus ‘M tarwinense’ (shown in green). All except for two cases in New South Wales (one in a suburban area of Sydney, another on the Central Coast near Gosford; arrows) are clustered in south-eastern Victoria. No cases were encountered in New Zealand, Tasmania or anywhere else in the world

Where lifestyle was recorded, all cats had unsupervised outdoor access and many were known hunters and/or fighters. only one cat (case 8) had previous immunosuppressive drug therapy prior to the diagnosis of feline leprosy. Feline immunodeficiency virus (FIV) status was only recorded in seven cases, with 3/7 cats being antibody positive. As far as could be ascertained from the case records, none of the FIV-positive cases had received prior FiV vaccination. No cats were tested for feline leukaemia virus antigen.

Where clinical features and clinical course were well documented in the available case records, 30/40 (75%) cats with Candidatus ‘M tarwinense’ infection had only a few localised nodular lesions. These were predominantly (33 cases) located on the head (specifically in ocular and periocular locations in 13 cases; Figures 2 and 3) and forelimbs (12 cases; Figure 4). Four cats had intraoral lesions (Figure 5). Eight cases had multiple lesions, often at disparate anatomical sites, with two cats having generalised nodular cutaneous disease (one of these cats was recorded as FiV negative). There was no difference in age within this cohort between cats with a few lesions (median 6 years, range 1–17) vs those with multiple nodules (median 6.5 years, range 3–14) (P = 0.58232). There also did not appear to be an association between the number of lesions and the likelihood of resolution of disease with therapy (P = 0.3544, data not shown).

Figure 2

Representative photographs of Candidatus ‘M tarwinense’ infection in cats fromVictoria, Australia, chosen to illustrate the occurrence of lesions near the eyes. These six photographs of different patients emphasise the propensity of lesions to occur on ocular structures, including the nictitating membrane (a), conjunctiva (b,d–f) and eyelids (c)

Figure 3

Representative photographs of Candidatus ‘M tarwinense’ infection in cats fromVictoria, Australia, chosen to illustrate the presence of lesions on the oculonasal skin. These six photographs of different patients illustrate the range of lesions that may be encountered, including an ulcerated lesion on the nasal planum (a), involvement of the bridge of the nose (b,c) and lips (d,e), and a lesion adjacent to the naris (f). (a) Image courtesy of Dr Robert Hilton; reproduced from Malik et al,²⁷ with permission; (d) reproduced from Little,³⁸ with permission

Figure 4

Representative photographs of Candidatus ‘M tarwinense’ infection in two cats fromVictoria, Australia, illustrating the presence of lesions on the distal forelimbs

Figure 5

Representative photograph of Candidatus ‘M tarwinense’ infection in a cat in Victoria, Australia, illustrating the presence of a lesion on the gum. Reproduced from Little,³⁸ with permission

The influence of bacterial number in lesions and clinical presentation, disease course and outcome could not be assessed due to a paucity of cases classified as having ‘low BI’ lesions.

One cat in the study cohort underwent necropsy examination (case 5). The cat had been diagnosed with the disease 8 years previously and had received no treatment. Histological examination of all internal organs, excluding the central nervous system, failed to demonstrate any evidence of systemic mycobacteriosis (ie, infection was limited to superficial structures, with no involvement of the chest or abdomen).

Treatment and outcome data

As there are no published guidelines concerning the management of fastidious mycobacterial infections in cats, treatment protocols varied widely and often were influenced by practical considerations such as owner finances and commitment, and patient temperament.

Where it was possible to implement medical therapy, protocols typically included several months of treatment with one or more of the following drugs: rifampicin, clarithromycin, clofazimine, a fluoroquinolone (enrofloxacin, marbofloxacin or moxifloxacin) and doxycycline. Most cases also underwent surgical resection of most, if not all, lesions (often as the initial procedure used to establish a diagnosis).

Reliable follow-up was available for 18 cases (range 1–15 years, mean 5.6 ± 4.6). In the 13 cases where treatment was successful, rifampicin plus clarithromycin (with or without surgery) was utilised most commonly (six resolved cases); clarithromycin plus moxifloxacin with surgery was utilised in two resolved cases, and clarithromycin monotherapy (with or without surgery) was utilised in three resolved cases. Clofazimine monotherapy plus surgery was also successful in one case. one cat was treated successfully with surgical resection alone (albeit in two attempts when more lesions developed). overall a combination of surgical resection (often with incomplete margins due to the anatomical location of the lesions) and follow-up medical therapy was used in 10 cases. Medical therapy alone was used in three cases.

Among the 18 cases with follow-up data, at least two cats went on to have complete clearance of lesions despite having multiple cutaneous lesions persisting at the time when medical therapy was discontinued. Also, four cases had persistent disease where therapy was either declined or suboptimally administered.

Five treated cases had no follow-up data and were not included in the results above. Unfortunately, case numbers were not sufficient to undertake statistical comparison of treatment protocols and outcome.

The overall outcome was typically favourable, with complete resolution of lesions in 68% of cases where follow-up was available. Even if lesions did not resolve completely (or at all), two cats continued to live for a relatively long time (8 and 10 years) (Figure 6). Where cats were euthanased because of the disease, this was typically due to progressive or persistent cutaneous lesions, rather than evidence of systemic illness, such as lethargy, anorexia or weight loss. Sadly, two cats in the study were also euthanased at the time of diagnosis due to (likely erroneous) perceived zoonotic risks.

Figure 6

Demonstration of the unrelenting progression of lesions in a cat (case 35). Infection was initially diagnosed in 2006 (a) and over the subsequent 8 years only poor attempts at therapy were made. Images (b) and (c) were obtained in 2014. This cat was apparently still alive at the time of writing. (a) Reproduced from Fyfe et al,¹⁷ with permission

A summary of data concerning age, gender, anatomical distribution of lesions and outcome for cats infected with Candidatus ‘M tarwinense’ is provided in Table 2.

Table 2

Detailed case data for 42 cats infected with Candidatus ‘Mycobacterium tarwinense’

Case	Age at diagnosis (years)	Gender	Breed	Location	Lifestyle	Bacterial index	Clinical details	Retroviral status	Treatment	Outcome	Reference or source
1	14	FN	DSH	Inverloch, VIC, Australia	NR	High	Lesions on left forelimb; progressed to lesions all over body	NR	No treatment	Euthanased due to progressive skin disease 18 months after first diagnosis	This study
2	7	FN	DSH	Lilydale, VIC, Australia	NR	NR	Lesions on leg and left nostril	NR	NR	NR	This study
3	15	FN	DSH	Bunyip, VIC, Australia	NR	NR	NR	NR	NR	NR	This study
4	NR	NR	NR	NR	NR	NR	Lesions on face	NR	NR	NR	This study
5	8	FN	Russian Blue cross	Kilcuna/Moolami, VIC, Australia	Indoor/outdoor	High	Facial swelling and nasal deformity	NR	No treatment	Never resolved. Necropsy 8 years later – no internal mycobacteriosis detected	This study
6	7	FN	DSH	Boronia, VIC, Australia	NR	NR	Buccal, conjunctival and hock lesions	NR	NR	NR	This study
7	3	FE	DSH	Kew, VIC, Australia	Indoor/outdoor (mostly indoor)	Low	Single cutaneous nodule in left axilla	NR	Surgery, CLM, 3 months	Resolved	This study
8	‘Old’	FN	NR	Yallambie/Macleod, VIC, Australia	NR	NR	Lymphoma 2007; 6 month multidrug chemotherapy completed when diagnosed with leprosy. Location of lesion(s) NR	NR	NR	NR	This study
9	13	ME	DSH	Research, VIC, Australia	NR	NR	Eroded nodule on nose	NR	No treatment	Not resolved; died 2 years later (cause NR)	This study
10	5	F?	NR	Boronia, VIC, Australia	NR	NR	Lesion on eyelid	NR	MOXIFLX	NR	This study
11	NR	MN	Ragdoll	Rye, VIC, Australia	Indoor/outdoor (co-habitating with case 35)	NR	Lesions on eyelids	NR	Short courses (<1 month) of CLM and RIF	Not resolved (5 year follow-up)	This study
12	12	F?	DLH	Wandin, VIC, Australia	NR	NR	Three lesions on head, one on eyelid	NR	NR	NR	This study
13	4	MN	DLH	Mulgrave, VIC, Australia	Indoor/outdoor	NR	Multiple lesions on face and right forelimb. Mass on leg ulcerated	FIV +ve	CLM, CLFZ and RIF. Masses reduced in size with ENFLX	NR	This study
14	1.5	MN	DSH	Dromana, VIC, Australia	Outdoor	NR	Buccal lesion next to right lower canine	NR	Medical treatment only. CLM 9 months – 6 months until clinical resolution. Unwell after 2 weeks on RIF so ceased therapy	Resolved (2 year follow-up)	This study

15	3	MN	DLH	Rosebud, VIC, Australia	Indoor/outdoor	NR	Ulcerated lesion on nasal bridge	FIV −ve	Surgery and DOXY – recurred. RIF and CLM, 1 month (discontinued due to RIF reaction)	Euthanased due to road trauma 1 month later	This study
16	4	FN	DSH	Yarrambat, VIC, Australia	Indoor/outdoor	NR	Lesion on left upper lip	NR	No treatment	Cat died of road trauma shortly after diagnosis	This study
17	9	FN	DSH	Dromana, VIC, Australia	Outdoor	High	Lesions on gingiva, third eyelid and nasal planum	NR	DOXY – no response. Surgery alone. More lesions developed. Further surgery	No recurrence but was euthanased due to unrelated problem 12 months later	This study
18	11	FN	DSH	Moorolbark, VIC, Australia	Indoor/ outdoor and may have been in a cat fight	High	Lesion above lip	NR	ENFLX. Subjectively slow growth of the lesion, but did not resolve	Euthanased at time of definitive diagnosis	This study
19	14	MN	DSH	Sorrento, VIC, Australia	Indoor/outdoor	NR	Lesion on nasal bridge	NR	Surgery, MOXIFLX and CLM	Resolved (18 months follow-up)	This study
20	10	FN	DSH	Rosebud, VIC, Australia	NR	High	Lesion on conjunctiva and lower right eyelid	NR	No response to DOXY. Surgery, MOXIFLX and CLM, 2 months	Resolved	This study
21	2	FN	DSH	Beaconsfield, VIC, Australia	NR	NR	Lesion on left third eyelid, and muzzle	FIV +ve	Surgery, RIF and CLM	Resolved	This study
22	12	FN	DSH	Cranbourne North, VIC, Australia	Suburban, near a park	NR	Ulcerated lesion on first digit of left forelimb	NR	RIF and CLM. Initial improvement (one lesion resolved completely); larger lesion initially reduced in size but regrew. Surgically debulked, then MOXIFLX and CLM, 3 months	Resolved	This study
23	10	FN	DSH	St Andrew’s Beach, VIC, Australia	Outdoor, fighter	High	Lesions on lip and right forelimb. Subsequently developed lesions on tail base, lateral canthus of left eye, top of head, left conjunctiva, left flank and left lumbar area	FIV −ve	Surgery, RIF, CLM	Regrowth of lip lesion on medications. Underwent surgery again. Growth of many new lumps while on medications. Stopped medications and lesions resolved spontaneously	This study
24	6.5	FN	DMH	Frankston, VIC, Australia	NR	NR	Lesions on conjunctiva, lower eyelid and hindlimb	NR	Surgery, then CLM and DOXY	LTFU	This study
25	4	MN	DSH	NR	NR	High	Lesions on dorsal left paw	NR	Surgery	NR	This study

26	8	MN	NR	NR	NR	High	Lesion on left upper eyelid, and lesion inside right nostril	NR	NR	NR	This study
27	2	FN	DSH	Inverloch, VIC, Australia	Rural, near coast; occasional hunter	High	Lesion on caudal right hock then front lateral digit	FIV −ve	Surgery, CLFZ	Resolved (15 year follow-up)	Case 2¹⁹ Case 1¹⁷
28	10	FN	DLH	Berwick, VIC, Australia	Indoor/outdoor	High	Raised corneal lesion (5 month history)	NR	Surgery (superficial keratectomy), topical OFLX and ketorolac and then dexamethasone drops. DOXY, aspirin	Possibly recurred after 2 years. LTFU	This study
29	17	FN	Burmese cross	Yea, VIC, Australia	Mostly indoor	High	Central corneal lesion	NR	Surgery (superficial keratectomy), topical OFLX and ketorolac, oral DOXY. Oral meloxicam	Recurred after 6 months. LTFU	Case 3¹⁷
30	3	MN	DLH	Blairgowrie, VIC, Australia	Indoor/outdoor, fighter	High	Lesion on left forelimb digit; 1 week later lesion appeared on right lip/chin	NR	Toe amputation. CLM, RIF (3 months). Lesion resected from chin	Resolved (10 year follow-up)	Case 4¹⁷
31	3	MN	DSH	Blairgowrie, VIC, Australia	NR	NR	Lesion on left forelimb digit and left lip. New lesion appeared on side of head after stopping medications for a week. Still had lesions on head when medications stopped	NR	Surgery, RIF and CLM, 1.5 months	Resolved (5 year follow-up)	Case 5¹⁷
32	8	FN	Abyssinian cross	Gladysdale, VIC, Australia	NR	NR	Firm, rapidly growing lesion over frontal sinus	NR	NR	NR	Case 6¹⁷
33	4	MN	DLH	Boolara, VIC, Australia	Indoor/outdoor, fighter	NR	Lesion on eyelid, 1 cm diameter	NR	Surgery, CLM, RIF (stopped due to compliance issues), DOXY	Resolved	Case 7¹⁷
34	3	MN	DSH	Upwey, VIC, Australia	Indoor/outdoor, hunter	High	Lesions on right forelimb digit, left medial antebrachium, face and base of lower canines. Developed further lesions (compliance issues?) 1 week after these lesions were removed. One further lesion developed on lower right lip and right forelimb digit and left carpus while on adequate doses	FIV −ve	CLM, RIF. Some masses resected, others left in situ. Continued CLM, RIF. Further lesions developed so started DOXY (7 d?)	Resolved	Case 8¹⁷
35	6	MN	DSH	Rye, VIC, Australia	Indoor/outdoor, hunter (cohabitating with case 11)	High	Multiple lesions on head, forelimbs and feet	NR	Short courses of CLM and RIF (<1 month)	Never resolved (10 year follow-up)	Case 9¹⁷

36	3	MN	DSH	Leongatha, VIC, Australia	Indoor/outdoor, hunter	NR	Lesions between toes on left hindlimb; enlarged regional lymph node	NR	Surgery, DOXY, surgical removal of popliteal lymph node, then RIF, CLM	Resolved	Case 10¹⁷
37	10	FN	DSH	Warawee, NSW, Australia	Indoor/outdoor	High	Nasal stertor for 1 month. Lesions above incisors and in caudal nasal cavity	FIV +ve	None	Euthanased prior to treatment	Case 11¹⁷
38	6	MN	DSH	Whittlesea, VIC, Australia	NR	High	Lesions on upper and lower eyelids	NR	NR	NR	Case 12¹⁷
39	13	MN	DSH	Upper Beaconsfield, VIC, Australia	Outdoor, hunter	High	Swelling lateral to nose	NR	CLM	Resolved. Euthanased due to renal disease several years later	Case 13¹⁷
40	2	FN	DSH	NR	Indoor/outdoor, hunter	NR	Lesions on left forelimb	NR	NR	NR	Case 14¹⁷
41	13.5	MN	DMH	NR	Mainly outdoor	NR	Lesion on mandible just under chin	NR	NR	NR	Case 15¹⁷
42	5	FN	DSH	Gosford, NSW, Australia (no history of travel)	Indoor/outdoor, suburban	High	Two adjacent lesions on right upper lip	NR	Surgery, RIF, CLM	NR	Torii et al³⁷

F = female; FN = female spayed; M = male; MN = male castrated; ? = neuter status unknown; DSH = domestic shorthair; DMH = domestic mediumhair; DLH = domestic longhair; NSW = New South Wales; VIC = Victoria; FIV = feline immunodeficiency virus; FeLV = feline leukaemia virus; +ve = positive; −ve = negative; NR = not recorded; CLFZ = clofazamine; RIF = rifampicin; CLM = clarithromycin; DOXY = doxycycline; ENFLX = enrofloxacin; OFLX = ofloxacin; MOXIFLX = moxifloxacin; LTFU = lost to follow-up

Microbiological and molecular data

All attempts at isolation, including use of MGiT and solid media, were unsuccessful.

Fresh tissue, and fixed cytological and paraffin-embedded samples from 38 cases underwent DNA extraction, PCR amplification and sequencing. Mycobacterial DNA derived from fresh biopsy tissue from case 30 underwent draft genome sequencing during the course of the study. The methods and results of these investigations will be published in full separately (C o’Brien et al, manuscript in preparation).

Limited multilocus sequence analysis demonstrated that this organism was clonal, with 100% genetic homogeneity at all five loci examined (V3 region of 16S rRNA, ITS region, rpoB, hsp65, sodA). Known acquired mutations in the rpoB gene conferring rifampicin resistance in other mycobacterial species^39–41 were not found in any of the isolates in this study.

Discussion

This study greatly extends the body of knowledge concerning Candidatus ‘M tarwinense’ infections in cats. The original paper on this pathogen involved a small number of cases, with limited and often incomplete follow-up.¹⁷ The inclusion of many ‘new’ cases in this study cohort, as well as the original cases (with longer and generally more complete followup), gives a better picture of the disease associated with this organism.

Geographical distribution

While the original cases were from the Tarwin region of rural south-eastern Victoria, subsequent cases have had a wider geographical footprint; although on a national or global scale cases are still remarkably restricted (a 900 square kilometer area of coastal Victoria, with two isolated cases in coastal NSW). The number of infections that have been encountered per year has increased progressively since the first identification of this organism as a cause of feline leproid lesions (Janet Fyfe, unpublished observations), suggesting either that this is an emerging infectious disease, or that small animal clinicians and veterinary pathologists are more aware, and thus more adept, at identifying these cases and submitting appropriate material for definitive molecular diagnosis. The ability to use methanol-fixed Romanowsky-stained slides as a source of DNA²⁵ has greatly facilitated the cost-effective and timely diagnosis of this condition in practice, as there is no requirement to re-sedate or anaesthetise the patient to obtain additional material for molecular diagnostics.

The strong propensity for cases to be domiciled in Victoria is reminiscent of the situation in people and other animals with M ulcerans infection. However, a close examination of the location of feline Candidatus ‘M tarwinense’ cases and M ulcerans cases in people, dogs,⁴² horses,⁴³ alpacas⁴⁴ and possums⁴⁵ show them to occur in somewhat different specific regions within the broader area of southern Victoria, although there is a significant overlap of endemic range on the Mornington Peninsula.⁴⁶

Anatomical predilection

More than any other feline mycobacterial pathogen, this organism has a predilection to involve structures about the head, especially the ocular tissues (conjunctiva, cornea, eyelids, nictitating membrane), and nasal and periocular skin and subcutis (Table 3). This poses some unique problems therapeutically, as the cornea is a difficult area in which to obtain adequate concentrations of many antimicrobials, and hence surgical and topical therapy is needed in such patients to effect a cure.

Table 3

Summary data concerning age, gender, anatomical distribution of lesions and outcome for cats infected by Candidatus ‘M tarwinense’

Median age at diagnosis (years)	Male	High BI	Anatomical location of lesions						Subjective outcome – resolved
			Head	Forelimbs	Hindlimbs	Body	Tail/perineum	Generalised skin
7 (n = 39 cats)	44% (17/39)	95% (18/19)	83% (33/40)	30% (12/40)	10% (4/40)	3% (1/40)	3% (1/40)	5% (2/40)	68% (15/22)

BI = bacterial index

The preponderance of lesions located on the face suggests a cat scratch injury or a bite/ scratch from prey as a potentially important antecedent event.^47,48 Furthermore, the propensity for cats to dig with the forelimbs prior to defecation affords the opportunity for many saprophytes to be present on the claws, and cat scratches provide the break in integrity of the cutaneous epithelial barrier to permit saprophytes to establish infections in this location.⁴⁷ Alternatively, the habit of cats to groom the face with the front paws provides a potential route for the inoculation of organisms, especially into the periocular area.

Signalment

The age range of affected cats is wide and the ratio of affected males to females is not too disparate to the age/gender pyramid of healthy cats.⁴⁹ Likewise, the breakdown of domestic crossbreeds vs pedigree cats is in accord with their ratio in the overall Australian cat population.⁴⁹ (No equivalent data are available for cats domiciled in New Zealand.) There were too few cats subjected to retroviral testing to draw any firm conclusions, but it may be that 43% FIV positivity (3/7 cats) is higher in this group of affected cats when compared with the overall prevalence of FIV infection in Australian cats, which is in the order of 8%.⁵⁰ This might be an epiphenomenon, reflecting the tendency of cats with outdoor access and which fight to acquire FiV or Candidatus ‘M tarwinense’ through independent mechanisms.

Clinical course

The clinical course of Candidatus ‘M tarwinense’ infection in cats could perhaps be described as indolent, with lesions tending to progress inexorably in the absence of therapy. There appears to be little tendency for spread via the bloodstream or lymphatics, given there was no suggestion of internal organ involvement in any cat based on clinical criteria, nor in the one cat that underwent necropsy with microscopic examination of representative tissues.

Organism biology

This behaviour is consistent with an environmental saprophyte not adept to living at mammalian body temperature, with cats being an incidental ‘dead end’ host. Although the preferred temperature range for growth is not known, it is possible that this organism is not capable of replicating at the higher core temperature of the internal organs; as a result infection is limited to the skin and subcutis. If this is the case, the local application of heat might represent a useful adjunct to systemic antibacterial therapy, as it is in the management of Mycobacterium marinum and M ulcerans infections in human patients,^51,52 although this may be practically difficult in cats.

The inability of Candidatus ‘M tarwinense’ to grow using traditional mycobacteriological methods remains a mystery, although it is hoped that detailed examination of the draft genome will yield some clues to the metabolic requirements of this organism. Analysis of several gene targets has demonstrated that all the clinical isolates that have been so examined are remarkably clonal, with 100% homogeneity at the five different loci studied. If this homogeneity is carried over the entire genome, the variation in clinical severity from cat to cat is perhaps a reflection of inoculum load and/or variability in the innate and acquired immunological response of the feline host. This genetic homogeneity is reminiscent of another fastidious mycobacterium – the unnamed agent of the canine leproid granuloma syndrome, which appears to be clonal over its far more extensive geographical range (Janet Fyfe, unpublished observations).²⁷

Treatment and outcome

As is typical in an observational study, treatment regimens were not consistent and case numbers in any category were not large enough to draw robust conclusions as to the effectiveness of a particular treatment strategy, although some inferences can be made via general inspection of the data (see box above).

Despite these limitations, favourable outcomes were obtained for approximately 70% of patients, and it would be reasonable to state that the prognosis is good for most cats, especially when a timely diagnosis is made at a point when lesions are small both in size and number. Importantly, even where therapy was not successful and lesions persisted, most cats could live a near-normal life for a substantial period, as the pathogen had no apparent propensity to disseminate haematogenously or via the lymphatics. Spontaneous resolution was never observed; that said, two cases were noted to have resolution of disease despite obviously suboptimal medical treatment. It is conceivable, however, that the above-mentioned residual lesions contained nonviable organisms only.

Risk of contagion

To date, there has been no instance of spread from cat to cat, or from cat to human. In the authors’ view, the risk of contagion from cats is slight; perhaps no greater than from other environmental sources harboring this organism (eg, soil). As the lesions are generally not ulcerated, organisms are more likely to be inoculated from a cat’s claws, than from intact subcutaneous nodules. it is fascinating that, to date, infections have not been seen in dogs or native animals. Very likely this species-specific disease association may eventually provide an insight into the environmental niche of this mycobacterium.

Key Points

Candidatus ‘M tarwinense’, a fastidious member of the M simiae complex, causes high Bl ‘feline leprosy’, with a tendency for lesions to consist of intact nodules present on the head, especially in proximity to the eyes and periocular skin, with an indolent clinical course and a generally favourable response to therapeutic interventions.

The best management approach consists of complete surgical resection of easily accessible lesions, and debulking of lesions in difficult anatomical locations, in combination with antimicrobial therapy using two or more agents with known activity against slow-growing mycobacteria, possibly including topical therapy for lesions involving the cornea and/or conjunctiva.

Further genomic analysis may yield clues as to the environmental niche and culture requirement of this elusive organism. Prospective trials and/or drug susceptibility testing in specialised systems, such as the microplate Alamar blue assay, are needed to further inform treatment recommendations.

Footnotes

Acknowledgements

Thanks go to the staff of the Mycobacterium Reference Laboratory, VIDRL, especially Caroline Lavender, for technical assistance, and the many veterinarians and veterinary pathologists who contributed case material and other assistance to this study, especially Laura Brandt, Bronwyn Smits, Catherine Harvey, Rob Fairley, Richard McCoy and Sergio Sanchez Picado of Gribbles Pathology, and Adrienne French, Catherine Williamson, dawn Seddon, Geoff orbell and Cathy Harvey of New Zealand Veterinary Pathology.

Date accepted: 7 March 2017

Conflict of interest

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This work was supported in part by a grant from the Feline Health Research Fund. Carolyn o’Brien was supported by an Australian Government Research Training Program Scholarship. Richard Malik was supported by the Valentine Charlton Bequest administered by the Centre for Veterinary Education, The University of Sydney.

References

Brown

May

Williams

. A non-tuberculous granuloma in cats. N Z Vet J 1962; 10: 7–9.

Allan

Wickham

. Mycobacterial granulomas in a cat diagnosed as leprosy. Feline Pract 1976; 6: 34–36.

Lawrence

Wickham

. Cat leprosy: infection by a bacillus resembling Mycobacterium lepraemurium. Aust Vet J 1963; 39: 390–393.

Schiefer

Gee

Ward

Disease resembling feline leprosy in Western Canada. J Am Vet Med Assoc 1974; 165: 1085.

Wilkinson

. A non-tuberculous granuloma of the cat associated with an acid-fast bacillus. Vet Rec 1964; 76: 777–778.

Robinson

. Skin granuloma of cats associated with acid-fast bacilli. J Small Anim Pract 1975; 16: 563–567.

Frye

Carney

Loughman

Feline lepromatous leprosy. Vet Med Small Anim Clin 1974; 69: 1272.

Poelma

Leiker

. Cat leprosy in the Netherlands. Int J Lepr Other Mycobact Dis 1974; 42: 307–311.

Hughes

James

Taylor

. PCR studies of feline leprosy cases. J Feline Med Surg 2004; 6: 235–243.

10.

Laprie

Duboy

Malik

. Feline cutaneous mycobacteriosis: a review of clinical, pathological and molecular characterization of one case of Mycobacterium microti skin infection and nine cases of feline leprosy syndrome from France and New Caledonia. Vet Dermatol 2013; 24: e134.

11.

Lamagna

Paciello

Ragozzino

. Isolated lepromatous conjunctivo-corneal granuloma in a cat from Italy. Vet Ophthalmol 2009; 12: 97–101.

12.

Courtin

Huerre

Fyfe

. A case of feline leprosy caused by Mycobacterium lepraemurium originating from the island of Kythira (Greece): diagnosis and treatment. J Feline Med Surg 2007; 9: 238–241.

13.

Goto

Iwakiri

Tabaru

. Differential diagnosis of a case of feline leprosy. J Japan Vet Med Assoc 2002; 55: 437–441.

14.

Mori

Kohsaka

. Identification of cat leprosy bacillus grown in mice. Int J Lepr Other Mycobact Dis 1986; 54: 584.

15.

Leiker

Poelma

. On the etiology of cat leprosy. Int J Lepr Other Mycobact Dis 1974; 42: 312–315.

16.

Hughes

Ball

Beck

. Determination of the etiology of presumptive feline leprosy by 16S rRNA gene analysis. J Clin Microbiol 1997; 35: 2464–2471.

17.

Fyfe

McCowan

O’Brien

. Molecular characterization of a novel fastidious mycobacterium causing lepromatous lesions of the skin, subcutis, cornea, and conjunctiva of cats living in Victoria, Australia. J Clin Microbiol 2008; 46: 618–626.

18.

Barrs

Martin

James

. Feline leprosy due to infection with novel mycobacterial species. Aust Vet Pract 1999; 29: 159–164.

19.

Malik

Hughes

James

. Feline leprosy: two different clinical syndromes. J Feline Med Surg 2002; 4: 43–59.

20.

Davies

Sibley

Myers

. Histological and genotypical characterization of feline cutaneous mycobacteriosis: a retrospective study of formalin-fixed paraffin-embedded tissues. Vet Dermatol 2006; 17: 155–162.

21.

Appleyard

Clark

. Histologic and genotypic characterization of a novel Mycobacterium species found in three cats. J Clin Microbiol 2002; 40: 2425–2430.

22.

Malik

Gabor

Martin

. Subcutaneous granuloma caused by Mycobacterium avium complex infection in a cat. Aust Vet J 1998; 76: 604–607.

23.

Elsner

Wayne

O’Brien

. Localised Mycobacterium ulcerans infection in a cat in Australia. J Feline Med Surg 2008; 10: 407–412.

24.

Gunn-Moore

McFarland

Brewer

. Mycobacterial disease in cats in Great Britain: I. Culture results, geographical distribution and clinical presentation of 339 cases. J Feline Med Surg 2011; 13: 934–944.

25.

Reppas

Fyfe

Foster

. Detection and identification of mycobacteria in fixed stained smears and formalin-fixed paraffin-embedded tissues using PCR. J Small Anim Pract 2013; 54: 638–646.

26.

Ridley

. Bacterial indices. In: Cochrane

Davey

TF.

Leprosy in theory and practice. 2nd ed. Bristol: John Wright and Sons, 1964, pp 620–622.

27.

Malik

Smits

Reppas

. Ulcerated and nonulcerated nontuberculous cutaneous mycobacterial granulomas in cats and dogs. Vet Dermatol 2013; 24: 146–153.

28.

Parkash

. Classification of leprosy into multibacillary and paucibacillary groups: an analysis. FEMS Immunol Med Microbiol 2009; 55: 1–5.

29.

O’Brien

Handasyde

Hibble

. Clinical, microbiological and pathological findings of Mycobacterium ulcerans infection in three Australian possum species. PLoS Negl Trop Dis 2014; 8: e2666.

30.

Frothingham

Wilson

. Sequence-based differentiation of strains in the Mycobacterium avium complex. J Bacteriol 1993; 175: 2818–2825.

31.

Roth

Reischl

Streubel

. Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases. J Clin Microbiol 2000; 38: 1094–1104.

32.

Rogall

Wolters

Flohr

. Towards a phylogeny and definition of species at the molecular level within the genus Mycobacterium. Int J Syst Evol Microbiol 1990; 40: 323–330.

33.

Jackson

Sievers

Ross

. Isolation of a fastidious Mycobacterium species from two AIDS patients. J Clin Microbiol 1992; 30: 2934–2937.

34.

Ringuet

Akoua-Koffi

Honore

. hsp65 sequencing for identification of rapidly growing mycobacteria. J Clin Microbiol 1999; 37: 852–857.

35.

Devulder

De Montclos

Flandrois

. A multigene approach to phylogenetic analysis using the genus Mycobacterium as a model. Int J Syst Evol Microbiol 2005; 55: 293–302.

36.

Kim

Lee

Lyu

. Identification of mycobacterial species by comparative sequence analysis of the RNA polymerase gene (rpoB). J Clin Microbiol 1999; 37: 1714–1720.

37.

Torii

Reppas

Krockenberger

. Autochthonous feline leprosy caused by Mycobacterium sp. strain Tarwin affecting a cat from the Central Coast of New South Wales.. Aust Vet J 2016; 94: 285–289.

38.

Little

. August’s consultations in feline internal medicine. Volume 7. Elsevier, 2016.

39.

Williams

Spring

Collins

. Contribution of rpoB mutations to development of rifamycin cross-resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 1998; 42: 1853–1857.

40.

Sapkota

Ranjit

Neupane

. Development and evaluation of a novel multiple-primer PCR amplification refractory mutation system for the rapid detection of mutations conferring rifampicin resistance in codon 425 of the rpoB gene of Mycobacterium leprae. J Med Microbiol 2008; 57: 179–184.

41.

Zhang

Namisato

Matsuoka

. A mutation at codon 516 in the rpoB gene of Mycobacterium leprae confers resistance to rifampin. Int J Lepr Other Mycobact Dis 2004; 72: 468–472.

42.

O’Brien

McMillan

Harris

. Localised Mycobacterium ulcerans infection in four dogs. Aust Vet J 2011; 89: 506–510.

43.

van Zyl

Daniel

Wayne

. Mycobacterium ulcerans infections in two horses in south-eastern Australia. Aust Vet J 2010; 88: 101–106.

44.

O’Brien

Kuseff

McMillan

. Mycobacterium ulcerans infection in two alpacas. Aust Vet J 2013; 91: 296–300.

45.

Fyfe

Lavender

Handasyde

. A major role for mammals in the ecology of Mycobacterium ulcerans. PLoS Negl Trop Dis 2010; 4: e791.

46.

Roltgen

Pluschke

. Mycobacterium ulcerans disease (Buruli ulcer): potential reservoirs and vectors. Curr Clin Microbiol Rep 2015; 2: 35–43.

47.

Malik

Norris

White

. ‘Wound cat’. J Feline Med Surg 2006; 8: 135–140.

48.

Malik

Vogelnest

O’Brien

. Infections and some other conditions affecting the skin and subcutis of the naso-ocular region of cats – clinical experience 1987–2003. J Feline Med Surg 2004; 6: 383–390.

49.

Toribio

J-AL

Norris

White

. Demographics and husbandry of pet cats living in Sydney, Australia: results of cross-sectional survey of pet ownership. J Feline Med Surg 2009; 11: 449–461.

50.

Norris

Bell

Hales

. Prevalence of feline immunodeficiency virus infection in domesticated and feral cats in eastern Australia. J Feline Med Surg 2007; 9: 300–308.

51.

Meyers

Shelly

Connor

. Heat treatment of Mycobacterium ulcerans infections without surgical excision. Am J Trop Med Hyg 1974; 23: 924–929.

52.

Rallis

Koumantaki-Mathioudaki

. Treatment of Mycobacterium marinum cutaneous infections. Expert Opin Pharmacol 2007; 8: 2965–2978.

53.

Van Ingen

Tortoli

Selvarangan

. Mycobacterium sherrisii sp. nov., a slow-growing non-chromogenic species. Int J Syst Evol Microbiol 2011; 61: 1293–1298.

54.

Lian

L-l

Wan

. Antimicrobial susceptibility of standard strains of nontuberculous mycobacteria by microplate Alamar Blue assay. PloS One 2013; 8: e84065.

55.

Ingen

Totten

Heifets

. Drug susceptibility testing and pharmacokinetics question current treatment regimens in Mycobacterium simiae complex disease. Int J Antimicrob Agents 2012; 39: 173–176.