Sage Journals: Discover world-class research

Abstract

Myxobolus albi was diagnosed in the cartilage of captive lumpfish (Cyclopterus lumpus) from 2 public aquaria. Eleven fish were affected, with the most common clinical signs being exophthalmos and grossly visible 1- to 2-mm white to tan scleral nodules. Myxozoan cysts were identified in the cartilage of the skull, branchial arch, sclera, vertebrae, tongue, all fin insertions, and the pectoral girdle. Cysts resulted in expansile, deforming, space-occupying lesions, resulting in exophthalmos but often lacking significant tissue damage or inflammation. Once cysts ruptured, free spores elicited a mild to marked inflammatory response. Spores measured 7.5 to 9.0 µm × 3.0 to 6.0 µm and contained 2 pyriform polar capsules oriented at one pole as well as occasional 1-µm-diameter basophilic nuclei. Identification was based on spore morphology together with polymerase chain reaction and sequence comparison of 18S ribosomal DNA. Isolates had 99% similarity to M. albi.

Keywords

Cartilage lumpfish myxozoa

Introduction

Myxozoans are metazoan parasites that mainly infect poikilothermic animals. Over 700 species of myxozoans have been described in fishes.¹⁹ Myxobolus cerebralis, Henneguya ictaluri, and Tetracapsuloides bryosalmonae, the species associated with whirling disease of the salmon, proliferative gill disease of the catfish, and proliferative kidney disease of the salmon, respectively, have been responsible for high morbidity and mortality and great economic losses.^7,14,33 Myxozoans have a complex life cycle that often alternates between vertebrate and invertebrate hosts with sporogony in each (i.e., alternating bisporogony).^4,11

Lumpfish (Cyclopterus lumpus) are semipelagic fish found in the eastern and western North Atlantic. Their pelvic fins have been modified into a single ventral sucker, allowing them to adhere to coastal rock structures and floating objects, such as algae and debris. They are an important commercial fish collected and reared for their meat and roe.^5,8 Due to their unique body shape and behavior, lumpfish are also a popular exhibit fish in public aquaria. The current report describes the clinical signs and pathology of Myxobolus albi infection in the cartilage of captive lumpfish at the New England Aquarium in Boston, Massachusetts (NEAq) and the John G. Shedd Aquarium in Chicago, Illinois (JGSAq).

Materials and methods

Animals

Lumpfish were wild-caught by hand using SCUBA in Eastport, Maine, during October from 2005 through 2008 and were exhibited at the 2 aquaria. Cases 1–5 occurred at NEAq, while cases 6–11 originated from JGSAq. All animals completed routine quarantine protocols including immersion formalin at NEAq and immersion nitrofurazone, praziquantel, and oral fenbendazole at JGSAq as well as any other antimicrobial or antiparasitic medications required based on the results of skin scrapes and gill biopsies at the time of arrival. Animals were housed in multitaxa exhibits with various fishes and invertebrates at temperatures of 7–10°C. The fish were fed a mixture of live or frozen zooplankton and frozen fish or squid depending on the size of the lumpfish. Weights of affected animals ranged from 0.5 kg to 3.8 kg including both juveniles and adults. Cases 1, 2, and 11 were euthanized using an overdose of tricaine methanesulfonate^a at approximately 250 ppm.

Cytological and histological examination

A premortem fine-needle aspirate was conducted on case 2 in order to obtain cytological specimens from scleral nodules. Samples were expressed onto glass slides and stained with Romanowsky staining for microscopic examination. Tissues from enucleations and gross necropsies were fixed by immersion in 10% neutral buffered formalin and submitted to the Connecticut Veterinary Medical Diagnostic Laboratory, University of Connecticut (Storrs, CT; cases 1–5) and the Zoological Pathology Program, University of Illinois (Maywood, IL; cases 6–11) for histopathological evaluation. The tissues were fixed for a minimum of 48 hours, grossly evaluated, trimmed to fit plastic cassettes, processed routinely, embedded in paraffin, sectioned at 4 or 5 µm, and stained with hematoxylin and eosin and Ziehl–Neelsen acid-fast stains for light microscopic examination. The dimensions and shapes of myxozoan spores in histological sections of formalin-fixed tissues as well as the number, size, and location of polar capsules were compared to previously identified species.²⁵

Molecular analysis

Myxozoan identification was performed by polymerase chain reaction (PCR) and sequence comparison of 18S ribosomal DNA (rDNA) of the species in question and other known myxozoans. Formalin-fixed, paraffin-embedded tissue blocks from case 2 were submitted to the Fish Pathology Laboratory, University of California (Davis, CA). Portions of the paraffin-containing myxozoan cysts in scleral cartilage were cut from blocks, and genomic DNA was extracted using a silica membrane–based genomic DNA extraction kit^b with deparaffinization according to the manufacturer’s instructions. Concentrations of genomic DNA samples were measured by a spectrophotometer,^c and approximately 100 ng of genomic DNA was used for degenerate PCR. Combinations of degenerate primers (Myxgen4f and ACT1r, Myxgen4f and Myxgen2r; Table 1) targeting short fragments of the myxozoan 18S rDNA (<250 bp) were used for the reactions, as degradation of DNA was suspected due to formalin fixation.^16,20 Polymerase chain reaction was conducted in 50-µl reaction volumes that included 200 µM of each dNTP, 1.5 mM of MgCl₂, 40 pmol of each primer, 1 U of Taq DNA polymerase,^d and 5 µl of 10× reaction buffer. The cycling conditions were as follows: initial denaturation step at 95°C for 5 min and then 40 cycles at 95°C for 30 sec, 50°C for 30 sec, and 72°C for 1 min, followed by a final extension step at 72°C for 5 min and then held at 4°C. The PCR products were separated on 2% agarose gels followed by ethidium bromide staining. The DNA bands were observed under ultraviolet transillumination, and amplicons of the expected size were excised and recovered using a gel extraction kit.^e Extracted DNA was ligated into a cloning plasmid vector^f for transformation of Escherichia coli DH5α competent cells.^g The plasmid carrying the PCR product was extracted using a plasmid DNA extraction kit^h according to the manufacturer’s instructions. The sequence of the inserted fragment was determined using M13 forward and reverse primers by fluorescently labeled dideoxynucleotide terminator sequencing using an automated DNA sequencerⁱ from 3 clones with the suspected M. albi genomic DNA fragment. Sequence similarity searches were performed using the Basic Local Alignment Search Tool for Nucleotide sequences (BLASTn) program available at the National Center for Biotechnology Information (NCBI) website (http://blast.ncbi.nlm.nih.gov/Blast.cgi).¹ Pairwise comparisons of the parasite obtained in the current study with closely related species were performed using BioEdit software.^j

Table 1.

Primers used for amplification of 18S ribosomal DNA from a myxozoan parasite of lumpfish (Cyclopterus lumpus).

Forward primer	Sequence 5′–3′	Reverse primer	Sequence 5′–3′	Target size (bp)
Myxgen4f	GTGCCTTGAATAAATCAGAG	ACT1r	AATTTCACCTCTCGCTGCCA	230
		Myxgen2r	CARATGCYTTCGCWYTTGTTA	270
538MyxFw	CAGCAGGCGCGCAACTTTCC	540MyxRv	CCTACGAATACCTTGTTACGAC	1,500

Another primer set targeting 1.5 kb of M. albi 18S rDNA (538MyxFw and 540MyxRv; Table 1) was designed based on the reference sequence (EU420055).³⁰ Genomic DNA was extracted from frozen material of myxozoan cysts within the ocular cartilage from cases 9 and 10 using the silica membrane–based genomic DNA extraction kit,^a as described previously, without deparaffinization. Polymerase chain reaction using this second primer set was performed using the same composition of PCR reagents but with a longer extension time: 95°C for 5 min and then 30 cycles at 95°C for 30 sec, 50°C for 30 sec, and 72°C for 2 min. The sequence of the amplified fragment (1.5 kb) was determined as described previously.

Results

Clinical findings

Mild to severe unilateral or bilateral exophthalmos was noted in all cases (Fig. 1). Case 1 was observed acutely spinning and then lying on its side with increased respiratory rate and effort. The fish was euthanized due to a poor prognosis. Bilateral exophthalmos was noted at gross necropsy. White or tan 1- to 2-mm-diameter nodules affected approximately 70–90% of the sclera in all cases. Hyphema was noted in case 2 (Fig. 1). Microscopic examination of scleral fine-needle aspirate from case 2 revealed multiple aggregates of 10- to 13-µm basophilic, circular to ovoid spores with 2 similarly sized pyriform polar capsules at one end. Occasional spores contained a darkly basophilic nucleus (Fig. 2). Case 3 had emphysema in the anterior and posterior chambers and a cranioventrally subluxated lens at initial examination of the right eye. Cases 5, 6, and 11 were initially examined due to unrelated causes, and exophthalmos was incidentally noted at that time. Cases 8 and 10 presented with unilateral exophthalmos, each undergoing enucleation of the affected eye.

Figure 1.

Severe bilateral exophthalmos and hyphema of the left eye are observed in a lumpfish (Cyclopterus lumpus) infected with Myxobolus albi (case 2).

Figure 2.

Lumpfish (Cyclopterus lumpus). Multiple, round myxozoan spores are present in this cytology of a fine-needle aspirate from the sclera of case 2. A pair of ovoid to pyriform polar capsules is discernable in several of these spores. Romanowsky stain. Bar = 10 µm.

All of the cases either died or were euthanized at NEAq or JGSAq between August 2006 and January 2011 due to the severity of the myxozoan infection (cases 2–4) or unrelated causes including potential drug reaction (case 5), bacterial septicemia (cases 6, 11), disseminated mycotic infection (cases 7, 8, 11), jejunitis secondary to foreign material impaction (case 9), and acute, severe postovariectomy blood loss (case 10).

Pathological findings

Gross findings included multifocal to coalescing myxozoan cysts, each composed of sporogonic plasmodia up to 2 mm in diameter. Cysts were identified in the cartilage of the skull, branchial arch, sclera, vertebrae, tongue, all fin insertions, and the pectoral girdle (Fig. 3A–C). Cysts most commonly resulted in expansile, deforming, space-occupying lesions lacking significant tissue damage and inflammation (Fig. 4A–C). Cysts contained numerous 7.5- to 9-µm-long × 3.0- to 6.0-µm-wide ovoid spores, each with a 1- to 3-µm-thick refractile wall, 2 pyriform polar capsules oriented at 1 pole, and occasionally a 1-µm-diameter basophilic nucleus. However, in some areas, large and coalescing cysts were associated with cartilage degeneration and necrosis, disruption of cortices of adjacent bone, and extension into surrounding tissue. Outside of cysts, free spores elicited a mild to marked granulomatous inflammatory response of the surrounding cartilage. In case 8, aggregates of myxozoan spores separated the retina from retinal pigmented epithelium and extended throughout the choroid, vitreous, posterior, and anterior chambers and into the ciliary body and iris. Drainage angles were obscured by myxozoan spores, histiocytes, erythrocytes, fibrin, and necrotic cellular debris. Myxozoan spores with similar morphology to those identified in the sclera or histiocytes with phagocytized fragments of spores were also scattered throughout parenchyma, interstitium, tubules, and glomeruli of the kidneys of cases 3 and 9, sometimes associated with inflammation or necrosis.

Figure 3.

Lumpfish (Cyclopterus lumpus). Myxobolus albi cysts are dispersed throughout the sclera (A) and form multiple aggregates located in the cartilage of the branchial arch (B) and cranial calvarium (C).

Figure 4.

Lumpfish (Cyclopterus lumpus). A, multiple, expansile, and deforming, round myxozoan cysts (*) are located along the length of the scleral cartilage (sc), along the posterior segment of the globe (e.g., choroid rete [cr] and vitreous chamber [vc]). Hematoxylin and eosin (HE). Bar = 500 µm. B, examination of myxozoan cysts at higher magnification reveals that spores are aggregated toward the center of cysts, whereas earlier developmental stages (*) are located along the periphery of the cyst at its margin with the sc. Spores, as evidenced by the aggregate circled, are present in multiple different planes of the section but, where visible, have 2 pyriform polar capsules at 1 pole. HE. Bar = 25 µm.

Other significant pathological findings included acute, severe myocardial necrosis (case 1), marked diffuse atrial endothelial hypertrophy (cases 3, 10), granulomatous nephritis without identification of myxozoan spores (case 2), and multiorgan changes due to fungal or bacterial septicemia (cases 6–8, 11). These findings were considered evidence of intercurrent disease processes unrelated to the myxozoan infection.

Molecular analysis

An 18S rDNA fragment (153 bp) was successfully amplified by the Myxgen4f and ACT1r primer set from a NEAq lumpfish (case 2) with unknown myxozoan parasites using formalin-fixed, paraffin-embedded material. The longer fragment (1,496 bp; JF776164) covering almost the entire 18S rDNA sequence was amplified from frozen tissue from cases 9 and 10 submitted by JGSAq using the 538MyxFw and 540MyxRv primer set. Both amplified DNA sequences had 99% similarity to M. albi 18S rDNA at the nucleotide level (EU420055). Pairwise comparisons with other myxozoan parasites shown in Table 2 indicate that the sequence is distinct from other myxozoan species. A summary of clinical, pathological, and molecular findings is provided in Table 3.

Table 2.

Pairwise comparison of 18S ribosomal DNA sequence of lumpfish (Cyclopterus lumpus) myxozoan found in the current study and other myxozoan parasites.³⁰ *

			Sample no.
Sample no.	Species	Accession no.	1	2	3	4	5	6
1	Lumpfish myxozoan (current study)	JF776164
2	Myxobolus albi	EU420055	98.8
3	Myxobolus acanthogobii	AY541585	55.2	55.4
4	Henneguya salminicola	AF031411	56.8	56.8	60.3
5	Henneguya ictaluri	AF195510	58.6	58.4	64.4	68.3
6	Myxidium truttae	AJ582061	55.4	55.4	62.9	64.0	66.1
7	Myxobolus cerebralis	MCU96492	56.4	56.3	63.2	68.7	73.8	66.3

Numbers represent the percentage of similarity at the nucleotide level.

Table 3.

Clinical, pathological, and molecular findings for 11 lumpfish (Cyclopterus lumpus) infected with Myxobolus albi.*

Case no.	Source	Clinical findings	Diagnostic procedures	Mortality	Cause of death	Pathological findings	Molecular findings
1	NEAq	Increased respiratory effort; acute spinning; emaciation; bilateral exophthalmos; scleral nodules	None	Euthanasia	Acute severe myocardial necrosis of unknown origin	Myocardial necrosis; branchial chondroplasia; chondral myxozoanosis (sclera)	No testing conducted
2	NEAq	Bilateral exophthalmos; hyphema OS; scleral nodules	FNA of scleral nodule	Euthanasia	Poor prognosis due to severity of myxozoan infection	Chondral myxozoanosis (sclera, fin insertions, skull) with chondronecrosis and granulomatous chondritis; granulomatous nephritis	99% similarity with M. albi 18S rDNA (EU420055)
3	NEAq	Ocular emphysema; subluxated lens; exophthalmos OD; mydriasis; scleral nodules	None	Natural	Myxozoan infection with acute renal necrosis	Renal tubular necrosis with interstitial, intraluminal, and glomerular myxospores; chondral myxozoanosis (sclera, gill arches, skull); cataract; atrial endothelial hypertrophy	No testing conducted
4	NEAq	Exophthalmos; scleral nodules	None	Not recorded	Myxozoan infection	Chondral myxozoanosis (all fin insertions, gill arches, opercula, mandible, sclera)	No testing conducted
5	NEAq	Exophthalmos; scleral nodules; corneal edema; acute decline during formalin treatment	None	Natural	Potential formalin reaction	Chondral myxozoanosis	No testing conducted
6	JGSAq	Bilateral exophthalmos; scleral nodules; corneal edema; acute lethargy and positive buoyancy	None	Natural	Bacterial sepsis	Coelomic effusion; chondral myxozoanosis (sclera, gill arches, skull, vertebrae) with chondritis; granulomatous inflammation with intralesional bacteria	No testing conducted
7	JGSAq	Acute bilateral exophthalmos; scleral nodules	Retrobulbar and intraocular FNA	Natural	Fungal septicemia	Retrobulbar, subcutaneous, and skeletal muscle edema; chondral myxozoanosis (skull, gill arches, sclera) with chondronecrosis and chondritis; disseminated fungal infection with necrosis of multiple tissues	No testing conducted
8	JGSAq	Exophthalmos OS; corneal edema; scleral nodules; nonspecific abnormal appearance to anterior and posterior chambers	Ocular ultrasound; enucleation OS	Natural	Fungal septicemia	Chondral myxozoanosis (sclera, skeletal system); granulomatous and necrotizing panophthalmitis with myriad myxospores; disseminated fungal infection	No testing conducted
9	JGSAq	Bilateral exophthalmos; scleral nodules	None	Natural	Jejunal foreign body impaction	Transmural and ulcerative granulomatous jejunitis with stones; chondral myxozoanosis (skull, gill arches, vertebrae, fin insertions, sclera); mycotic dermatitis; histiocytes with phagocytized myxospores within renal parenchyma	99% similarity with M. albi 18S rDNA (EU420055)
10	JGSAq	Ulceration with possible perforation of cornea OD; scleral nodules; exophthalmos OS	Enucleation OD	Natural	Postsurgical blood loss	Chondral myxozoanosis (gill arches, tongue, operculum, mandible, vertebrae, fin insertions, sclera) with chondronecrosis and chondritis; panophthalmitis with myxospores in subretinal space and vitreous and posterior chambers OD; atrial endocardial hypertrophy	99% similarity with M. albi 18S rDNA (EU420055)
11	JGSAq	Exophthalmos; scleral nodules; multifocal refractory fungal dermatitis	None	Euthanasia	Bacterial septicemia and disseminated mycosis	Chondral myxozoanosis (skull, sclera); ulcerative fungal dermatitis and multiorgan fungal infection; bacterial epicarditis	No testing conducted

NEAq = New England Aquarium (Boston, MA); OS = oculus sinister (left eye); FNA = fine-needle aspirate; OD = oculus dexter (right eye); JGSAq = John G. Shedd Aquarium (Chicago, IL); rDNA = ribosomal DNA.

Discussion

Myxobolus albi was recently described as a new myxozoan species in the gill arch of the common goby (Pomatoschistus microps) in Scotland.³⁰ Several myxozoan species are known to infect cartilage and have been associated with some of the most economically significant diseases of fish including proliferative gill disease of the channel catfish and whirling disease of salmonids.^14,33 Once mostly a disease of farmed fish, whirling disease has recently been found in wild stock, causing concerns of population decline.^14,27

While several species of myxozoans cause clinical illness,^22,25 the majority of infections cause chronic subclinical diseases with little to no clinical signs or host immune response.¹⁵ In the current cases, all lumpfish exhibited unilateral or bilateral exophthalmos. Despite extensive cartilaginous expansion and deformation, there was often little inflammation unless there was rupture of the plasmodia and release of spores into the surrounding tissue, allowing interaction of antigenic spores with host macrophages and lymphocytes and thus promoting the host inflammatory response. This release of spores and degeneration of ocular tissues and systemic cartilage are likely important to the natural life cycle of the myxozoan, allowing the release of spores into the environment. Case 1 exhibited increased respiratory effort and acute spinning behavior prior to euthanasia, the latter likely being a nonspecific sign of illness, as no central nervous system lesions were observed in infections by this myxozoan. Case 3 was 1 of only 3 cases in which myxozoan infection was considered significant in the death of a lumpfish. During gross necropsy, cysts were noted within the sclera and other cartilage as in all other cases. Renal tubular necrosis was associated with myxospores having similar morphology to those identified in cartilage, which were observed in glomeruli and renal tubules. Several reports have suggested that such a severe reaction may be due to infection of an inappropriate tissue or host.^23,25,26 However, the kidney was not tested by PCR to confirm the identity of these myxospores. Atrial endothelial hypertrophy was attributed to systemically circulating myxozoan antigen. Renal mineralization was also observed, but this could have been the result of a concurrent disease process.

The method of transmission of M. albi in lumpfish is not fully understood. It is widely demonstrated that an invertebrate host is usually needed to complete the myxozoan life cycle.^4,11,34 However, direct fish-to-fish transmission has been shown in some circumstances.^9,24,31 Lumpfish were wild-caught by NEAq staff and subjected to quarantine prior to mixing with previously collected animals or being transported to other institutions. It seems most plausible that animals arrived infected, although transmission directly between fish and acquisition of infection via an unrecognized invertebrate host within the exhibit systems are hypothetical alternatives. It is notable that 2 adult lumpfish born at NEAq have no grossly visible scleral nodules at the time of publication and that all cases to date have been diagnosed in lumpfish weighing over 400 g, despite the presence of smaller specimens in the collection. It is possible that animals under 400 g are too small to have grossly visible scleral cysts or that there is a latent subclinical period, with clinical signs developing after a certain age or body size or after a period of acute or chronic stress.²⁹

To date, there are no consistently effective medical treatments for myxozoan infections in fish. Several methods of disinfection including ultraviolet exposure, chlorine bleach, and hydrogen peroxide have been previously used to kill environmental infective stages.^18,32 The coccidiostat salinomycin with or without amprolium has successfully reduced the severity of branchial and renal myxozoan infection in sharpsnout sea bream (Diplodus puntazzo) and tapir fish (or elephantnose fish, Gnathonemus petersii).^3,10,21 Fumagillin also has some efficacy against myxozoa but has a high incidence of toxic side effects.^3,17,21 Multiple individualized treatments including, but not limited to, systemic acetazolamide, intraocular gentamicin, and systemic and topical broad-spectrum antibiotics were unsuccessfully attempted in the current cases to correct the exophthalmos but were not specifically aimed at eliminating the myxozoan infection. Further investigations into therapeutic agents for the treatment of myxozoan infections are warranted. Clinical and pharmacokinetic trials using salinomycin or other coccidiostats would be beneficial in determining the effectiveness of these drugs on myxospores in specific tissues and organs (e.g., therapeutic drug levels in the cartilage and scleral ossicle).

The pairwise comparisons of the amplified 18S rDNA sequences from infected lumpfish at JGSAq revealed significantly high similarity at the nucleotide level to that of M. albi (99%) and lower similarity to those of other representative myxozoans (<60%) as shown in Table 2, suggesting that the myxozoan found in the cartilage of these lumpfish is most likely one of the isolates in the species M. albi. Prior to molecular testing, the parasites were presumptively identified as Myxobolus aeglefini Auerbach, 1906 based on myxospore morphology and previous reports of M. aeglefini in the cartilage and bone of the head of lumpfish and in the cornea of the blue whiting (Micromesistius poutassou).²⁵ Spores from M. aeglefini and M. albi share several morphological features including similar size, shape, and location and number of polar capsules.^25,28,30 Multiple recent studies of other myxozoan species have reported that re-evaluations of isolates based on 18S rDNA sequence comparisons often confirm the presumptive identification of isolates but occasionally determine that myxozoans previously identified as different species are the same.^19,28,35 Currently, DNA sequences from M. aeglefini are not available; therefore, it is possible that previously described parasites in the cartilage of lumpfish²⁵ were misidentified as M. aeglefini based on myxospore morphology and were actually the yet unknown M. albi or that the 2 species are actually the same.

The current study and other reports regarding the use of molecular techniques to further describe myxozoan species or their phylogenetic relationships suggest the need for a comprehensive database linking genetic information and morphological features of the organisms.^2,6,12,13 Historically, myxozoans have been grouped based on spore morphology, host, or site fidelity and geographic location. In the present study, the presence of M. albi was demonstrated in a different host, distant geographic location, and different environment (marine vs. estuarine) from that in which it was originally described, a link made possible by comparison of 18S rDNA.

Footnotes

Acknowledgements

The authors acknowledge Stephen Atkinson at Oregon State University for providing the primer sequences, Dr. Ronald P. Hedrick for guiding the molecular procedures, Pilar J. Nelson for , and Alexandra Young for assistance with graphics and digital artistry. The authors also appreciate the husbandry and veterinary staff of the New England Aquarium and John G. Shedd Aquarium for their care of the affected animals and assistance with necessary medical treatments.

a.

Finquel®, Argent Chemical Laboratories, Redmond, WA.

b.

QIAamp® DNA Mini Kit, Qiagen Inc., Valencia, CA.

c.

BioPhotometer plus, Eppendorf North America, Hauppauge, NY.

d.

Platinum Taq DNA Polymerase, Invitrogen Corp., Carlsbad, CA.

e.

QIAEX II® Gel Extraction Kit, Qiagen Inc., Valencia, CA.

f.

pGEM®-T Easy Vector System, Promega BioSciences, San Luis Obispo, CA.

g.

Escherichia coli DH5α Competent cells, Invitrogen Corp., Carlsbad, CA.

h.

QIAprep® Spin Miniprep Kit, Qiagen Inc., Valencia, CA.

i.

ABI PRISM® 3730 DNA Analyzer, Applied Biosystems, Carlsbad, CA.

j.

Available at: .

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

The author(s) declared that they received no financial support for their research and/or authorship of this article.

References

Altschul

Gish

Miller

.: 1990, Basic local alignment search tool. J Mol Biol 215:403–410.

Andree

Székely

Molnár

.: 1999, Relationships among members of the genus Myxobolus (Myxozoa: Bilvalvidae) based on small subunit ribosomal DNA sequences. J Parasitol 85:68–74.

Athanassopoulou

Karagouni

Dotsika

.: 2004, Efficacy and toxicity of orally administrated anti-coccidial drugs for innovative treatments of Myxobolus sp. infection in Puntazzo puntazzo. Dis Aquat Organ 62:217–226.

Bartholomew

Whipple

Stevens

Fryer

: 1997, The life cycle of Ceratomyxa shasta, a myxosporean parasite of salmonids, requires a freshwater polychaete as an alternate host. J Parasitol 83:859–868.

Benfey

Methven

: 1986, Pilot-scale rearing of larval and juvenile lumpfish (Cyclopterus lumpus L.), with some notes on early development. Aquaculture 56:301–306.

Camus

Griffin

: 2010, Molecular characterization and histopathology of Myxobolus koi infecting the gills of a koi, Cyprinus carpio, with an amended morphological description of the agent. J Parasitol 96:116–124.

Canning

Tops

Curry

.: 2002, Ecology, development and pathogenicity of Buddenbrockia plumatellae Schröder, 1910 (Myxozoa, Malacosporea) (syn. Tetracapsula bryozoides) and establishment of Tetracapsuloides n. gen. for Tetracapsula bryosalmonae. J Eukaryot Microbiol 49:280–295.

Collins

MAJ

: 1976, The lumpfish (Cyclopterus lumpus L.) in Newfoundland waters. Canadian Field-Naturalist 90:64–67.

Diamant

: 1997, Fish-to-fish transmission of a marine myxosporean. Dis Aquat Organ 30:99–105.

10.

Dohle

Schmahl

Raether

.: 2002, Effects of orally administered chemotherapeutics (quinine, salinomycin) against Henneguya sp. Thelohán, 1892 (Myxozoa: Myxobolidae), a gill parasite in the tapir fish Gnathonemus petersii Günther, 1862 (Teleostei). Parasitol Res 88:861–867.

11.

el-Matbouli

Hoffmann

: 1989, Experimental transmission of two Myxobolus spp. developing bisporogeny via tubificid worms. Parasitol Res 75:461–464.

12.

Fiala

: 2006, The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis. Int J Parasitol 36:1521–1534.

13.

Fiala

Bartošová

: 2010, History of myxozoan character evolution on the basis of rDNA and EF-2 data. BMC Evol Biol 10:228.

14.

Gilbert

Granath

Jr : 2003, Whirling disease of salmonid fish: life cycle, biology and disease. J Parasitol 89:658–667.

15.

Griffin

Davis

: 1978, Myxosoma cerebralis: detection of circulating antibodies in infected rainbow trout (Salmo gairdneri). J Fish Res Board Can 35:1186–1190.

16.

Hallett

Diamant

: 2001, Ultrastructure and small-subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillago analis (Sillaginidae) from the coast of Queensland, Australia. Dis Aquat Organ 46:197–212.

17.

Hedrick

Groff

Foley

McDowell

: 1988, Oral administration of fumagillin DCH protects Chinook salmon Oncorhynchus tshawytscha from experimentally-induced proliferative kidney disease. Dis Aquat Organ 4:165–168.

18.

Hedrick

McDowell

Marty

.: 2000, Ultraviolet irradiation inactivates the waterborne infective stages of Myxobolus cerebralis: a treatment for hatchery water supplies. Dis Aquat Organ 42:53–59.

19.

Hogge

Campbell

Johnson

: 2008, Redescription and molecular characterization of Myxobolus kisutchi Yasutake & Wood, 1957. J Fish Dis 31:707–712.

20.

Jirků

Bolek

Whipps

.: 2006, A new species of Myxidium (Myxosporea: Myxidiidae), from the Western chorus frog, Pseudacris triseriata triseriata, and Blanchard’s cricket frog, Acris crepitans blanchardi (Hylidae), from eastern Nebraska: morphology, phylogeny, and critical comments on amphibian Myxidium taxonomy. J Parasitol 92:611–619.

21.

Karagouni

Athanassopoulou

Lytra

.: 2005, Antiparasitic and immunomodulatory effect of innovative treatments against Myxolobus sp. infection in Diplodus puntazzo. Vet Parasitol 134:215–228.

22.

Kent

Andree

Bartholomew

.: 2001, Recent advances in our knowledge of the Myxozoa. J Eukaryot Microbiol 48:395–413.

23.

Kent

Khattra

Hedrick

Devlin

: 2000, Tetracapsula renicola n. sp. (Myxozoa: Saccosporidae); the PKX myxozoan: the cause of proliferative kidney disease of salmonid fishes. J Parasitol 86:103–111.

24.

Lom

Dyková

: 1988, Sporogenesis and spore structure in Kudoa lunata (Myxosporea, Multivalvulida). Parasitol Res 74:521–530.

25.

Lom

Dyková

: 1992, Protozoan parasites of fishes. In: Developments in aquaculture and fisheries science, vol. 26, pp. 159–236. Elsevier, New York, NY.

26.

Lom

Dyková

: 2006, Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitol (Praha) 53:1–36.

27.

Murcia

Kerans

MacConnell

Koel

: 2006, Myxobolus cerebralis infection patterns in Yellowstone cutthroat trout after natural exposure. Dis Aquat Organ 71:191–199.

28.

Nielsen

Køie

Székely

Buchmann

: 2002, Comparative analysis of 18S rRNA genes from Myxobolus aeglefini Auerbach, 1906 isolated from cod (Gadus morhua), plaice (Pleuronectes platessa) and dab (Limanda limanda), using PCR-RFLP. Bull Eur Assoc Fish Pathol 22:201–205.

29.

Nolan

Roberts

Zimmerman

Smith

: 2010, Pathology in practice: severe, chronic, focal, granulomatous, nodular and ulcerative stomatitis with myxosporidia (Myxobolus sp.). J Am Vet Med Assoc 236:631–633.

30.

Picon-Camacho

Holzer

Freeman

.: 2009, Myxobolus albi n. sp. (Myxozoa) from the gills of the common goby Pomatoschistus microps Krφyer (Teleostei: Gobiidae). J Eukaryot Microbiol 56:421–427.

31.

Swearer

Robertson

: 1999, Life history, pathology, and description of Kudoa ovivora n. sp. (Myxozoa, Myxosporea): an ovarian parasite of Caribbean labroid fishes. J Parasitol 85:337–353.

32.

Wagner

Smith

Arndt

Roberts

: 2003, Physical and chemical effects on viability of the Myxobolus cerebralis triactinomyxon. Dis Aquat Organ 53:133–142.

33.

Wise

Griffin

Terhune

.: 2008, Induction and evaluation of proliferative gill disease in channel catfish fingerlings. J Aquat Anim Health 20:236–244.

34.

Wolf

Markiw

Hiltunen

: 1986, Salmonid whirling disease: Tubifex tubifex (Müller) identified as the essential oligochaete in the protozoan life cycle. J Fish Dis 9:83–85.

35.

Yokoyama

Freeman

Yoshinaga

Ogawa

: 2004, Myxobolus buri, the myxosporean parasite causing scoliosis of yellowtail, is synonymous with Myxobolus acanthogobii infecting the brain of the yellowfin goby. Fish Sci 70:1036–1042.

Myxobolus albi infection in cartilage of captive lumpfish ( Cyclopterus lumpus )

Abstract

Keywords

Introduction

Materials and methods

Animals

Cytological and histological examination

Molecular analysis

Results

Clinical findings

Pathological findings

Molecular analysis

Discussion

Footnotes

Acknowledgements

a.

b.

c.

d.

e.

f.

g.

h.

i.

j.

References