In Silico Prediction of NOS2,NOS3 and Arginase 1 Genes Targeting by Micro RNAs Upregulated in Systemic Sclerosis

Abstract

Introduction:

Systemic sclerosis (SSc) is a chronic disorder, characterised by endothelial dysfunction and fibrosis of skin and internal organs. Endothelium dysfunction leads to a decrease in nitric oxide levels, consequent to reduced Nitric Oxide synthase 3 (NOS3) activity due to decreased NOS3 gene function. Besides endothelium, macrophages too play an important role in the pathogenesis of SSc; classically activated M1 macrophages (express NOS2) and alternatively activated M2 macrophages (express Arginase1) are differentially altered in favour of M2 macrophages. Micro-RNAs (miRNAs) regulate expression of various genes and may favour disease phenotype.

Aim:

Our aim was to identify differentially expressed micro-RNAs in SSc, which target NOS2, NOS3 and Arginase1 genes by in-silico approach.

Methods:

Data on miRNAs upregulation reported in various studies was collected and their sequence ID from miRBase was identified in FASTA format from NCBI. Binding strength of these miRNAs against NOS2, NOS3 and Arginase1 genes was evaluated by RNA22.

Results:

After scanning 39 publications reporting miRNA expression in SSc, a total of 13 miRNAs were found to be up-regulated for NOS2 (Gibbs free energy ≤18.0Kj/mol) and 15 miRNAs up-regulated for NOS3 (Gibbs free energy ≤18.0Kj/mol) whereas for Arginase1 only 2 miRNAs were up-regulated.

Conclusion:

There is differential upregulation of miRNAs in SSc. Micro RNAs targeting NOS2 and NOS3 genes are highly up-regulated in comparison to Arginase 1. Role of epigenetic regulation of genes by miRNAs may play a key role in pathogenesis of SSc.

Keywords

Arginase 1 endothelial dysfunction macrophages nitric oxide synthase 2 nitric oxide synthase 3 systemic sclerosis

Introduction

Systemic sclerosis (SSc) is a chronic autoimmune disease, which is characterised by fibrosis of the skin and internal organs as well as vasculopathy. Its pathogenesis starts in genetically predisposed individuals through encounters with environmental factors such as cold, stress, chemical exposure, certain viruses, silica dust, medications or drugs, resulting in endothelial injury.¹ Normally, Nitric Oxide synthase 3 (NOS3) expressed by healthy endothelial cells helps control vascular tone, leucocyte migration, and blood clotting and helps in repair and homeostasis.² In SSc patients, NOS3 expression is highly reduced, which results in endothelial cell dysfunction.³ The mechanism behind this discrepancy is still unknown. Macrophages are one of the major pathogenic cells involved in the pathogenesis of SSc.⁴ They mount an immune response against foreign antigens, phagocytose foreign bodies and help in immune clearance of cellular debris and plays role in tissue repair and remodelling.⁵ There are two types of macrophage subpopulations in circulation: classically activated or M1 macrophages and alternatively activated or M2 macrophages.⁶ M1 macrophages express inducible nitric oxide synthase (iNOS), a product of NOS2 gene, and secrete cytokines like interleukin-1β, IL-6, IL-12, and tumour necrosis factor-α (TNF-α) causing tissue injury while M2 macrophages express Arginase 1, product of Arginase 1 gene, and help in the resolution of inflammation by secreting excessive amounts of IL-10 and TGF-β1⁶ and regulates Th2 cell differentiation and excessive production of IL-4, IL-13, and TGF-β1. These are the key cytokines involved in the pathogenesis of SSc.^7–9 Various studies have reported M1/M2 macrophage alteration in fibrotic diseases.¹⁰ The population of M2 macrophages is highly up regulated in SSc.

Micro RNAs (miRNAs) are ~22 nucleotides sequence long RNAs, which are generated from pre-miRNAs. miRNAs interact with the 3′ UTR of target mRNAs to suppress their target gene expression.¹¹ Previous studies have reported that the expression of NOS2,¹² NOS3,¹³ and Arginase¹⁴ is regulated by human miRNAs. Therefore, we evaluated miRNAs up regulated in SSc that may target NOS2, NOS3 and Arginase 1 genes by in silico approach.

Methods

PubMed database (https://pubmed.ncbi.nlm.nih.gov/) was searched for articles providing information related to microRNA/epigenetics in SSc/scleroderma in humans. A total of 169 articles were retrieved, out of which 39 were selected that had information related to expression of miRNAs in tissues or blood.

a) Collection of micro-RNAs expression data:

From various published studies, we prepared details of miRNAs whose expression was altered (up-regulated or down-regulated) in SSc patients and prepared a library including miRNA ID, Seq. ID, miRBase ID and miRNA Sequence (Table 1). Figure 1 represents the flow diagram of the in silico approach.

Table 1.

Differential Expression of miRNAs in Systemic Sclerosis.

S.N.	References	miRNA ID	Status in SSc	Seq. ID	miRBase ID	Sequence
1	15,16	miR-155	Up regulated	hsa-miR-155	>hsa-miR-155-5p MIMAT0000646	UUAAUGCUAAUCGUGAUAGGGGUU
				hsa-miR-155*	>hsa-miR-155-3p MIMAT0004658	CUCCUACAUAUUAGCAUUAACA
2	16,17	miR-18	Up regulated	hsa-miR-18a	>hsa-miR-18a-5p MIMAT0000072	UAAGGUGCAUCUAGUGCAGAUAG
				hsa-miR-18a*	>hsa-miR-18a-3p MIMAT0002891	ACUGCCCUAAGUGCUCCUUCUGG
3	16,18	miR-125a	Down regulated	hsa-miR-125a	>hsa-miR-125a-5p MIMAT0000443	UCCCUGAGACCCUUUAACCUGUGA
				hsa-miR-125a	>hsa-miR-125a-3p MIMAT0004602	ACAGGUGAGGUUCUUGGGAGCC
4	19,20	miR-196a	Down regulated	hsa-mir-196-2	>hsa-miR-196a-5p MIMAT0000226	UAGGUAGUUUCAUGUUGUUGGG
				hsa-mir-196-2	>hsa-miR-196a-3p MIMAT0004562	CGGCAACAAGAAACUGCCUGAG
				mir-196	>hsa-miR-196b-5p MIMAT0001080	UAGGUAGUUUCCUGUUGUUGGG
				mir-196	>hsa-miR-196b-3p MIMAT0009201	UCGACAGCACGACACUGCCUUC
5	21,22	miR-21	Up regulated	hsa-miR-21	>hsa-miR-21-5p MIMAT0000076	UAGCUUAUCAGACUGAUGUUGA
				hsa-miR-21*	>hsa-miR-21-3p MIMAT0004494	CAACACCAGUCGAUGGGCUGU
6	23	hsa-miR-3682	Up regulated	hsa-miR-3682	>hsa-miR-3682-5p MIMAT0019222	CUACUUCUACCUGUGUUAUCAU
				hsa-miR-3682	>hsa-miR-3682-3p MIMAT0018110	UGAUGAUACAGGUGGAGGUAG
7	23	hsa-miR-4271	Up regulated	hsa-miR-4271	>hsa-miR-4271 MIMAT0016901	GGGGGAAGAAAAGGUGGGG
8	23	hsa-miR-4481	Up regulated	hsa-miR-4481	>hsa-miR-4481 MIMAT0019015	GGAGUGGGCUGGUGGUU
9	23	hsa-miR-4498	Up regulated	hsa-mir-4498	>hsa-miR-4498 MIMAT0019033	UGGGCUGGCAGGGCAAGUGCUG
10	23	hsa-miR-4653	Up regulated	hsa-miR-4653	>hsa-miR-4653-5p MIMAT0019718	UCUCUGAGCAAGGCUUAACACC
				hsa-miR-4653	>hsa-miR-4653-3p MIMAT0019719	UGGAGUUAAGGGUUGCUUGGAGA
11	23	hsa-miR-4706	Up regulated	hsa-miR-4706	>hsa-miR-4706 MIMAT0019806	AGCGGGGAGGAAGUGGGCGCUGCUU
12	23	hsa-miR-4764	Up regulated	hsa-miR-4764	>hsa-miR-4764-5p MIMAT0019914	UGGAUGUGGAAGGAGUUAUCU
				hsa-miR-4764	>hsa-miR-4764-3p MIMAT0019915	UUAACUCCUUUCACACCCAUGG
13	23	hsa-miR-1207	Down regulated	hsa-miR-1207	>hsa-miR-1207-5p MIMAT0005871	UGGCAGGGAGGCUGGGAGGGG
				hsa-miR-1207	>hsa-miR-1207-3p MIMAT0005872	UCAGCUGGCCCUCAUUUC
14	21,23	hsa-miR-320	Down regulated	hsa-miR-320	>hsa-miR-320a-3p MIMAT0000510	AAAAGCUGGGUUGAGAGGGCGA
				hsa-miR-320a	>hsa-miR-320a-5p MIMAT0037311	GCCUUCUCUUCCCGGUUCUUCC
				hsa-miR-320b	>hsa-miR-320b MIMAT0005792	AAAAGCUGGGUUGAGAGGGCAA
				hsa-miR-320c	>hsa-miR-320c MIMAT0005793	AAAAGCUGGGUUGAGAGGGU
				hsa-miR-320d	>hsa-miR-320d MIMAT0006764	AAAAGCUGGGUUGAGAGGA
				hsa-miR-320e	>hsa-miR-320e MIMAT0015072	AAAGCUGGGUUGAGAAGG
15	23	hsa-miR-324	Down regulated	hsa-miR-324	>hsa-miR-324-5p MIMAT0000761	CGCAUCCCCUAGGGCAUUGGUG
16	23	hsa-miR-362	Down regulated	hsa-miR-362	>hsa-miR-362-5p MIMAT0000705	AAUCCUUGGAACCUAGGUGUGAGU
				hsa-miR-362	>hsa-miR-362-3p MIMAT0004683	AACACACCUAUUCAAGGAUUCA
17	23	hsa-miR-3656	Down regulated	hsa-miR-3656	>hsa-miR-3656 MIMAT0018076	GGCGGGUGCGGGGGUGG
18	23	hsa-miR-423	Down regulated	hsa-miR-423	>hsa-miR-423-5p MIMAT0004748	UGAGGGGCAGAGAGCGAGACUUU
				hsa-miR-423	>hsa-miR-423-3p MIMAT0001340	AGCUCGGUCUGAGGCCCCUCAGU
19	23	hsa-miR-4284	Down regulated	hsa-miR-4284	>hsa-miR-4284 MIMAT0016915	GGGCUCACAUCACCCCAU
20	23	hsa-miR-4508	Down regulated	hsa-miR-4508	>hsa-miR-4508 MIMAT0019045	GCGGGGCUGGGCGCGCG
21	23	hsa-miR-4516	Down regulated	hsa-miR-4516	>hsa-miR-4516 MIMAT0019053	GGGAGAAGGGUCGGGGC
22	23	hsa-miR-500a	Down regulated	hsa-miR-500a	>hsa-miR-500a-5p MIMAT0004773	UAAUCCUUGCUACCUGGGUGAGA
				hsa-miR-500a*	>hsa-miR-500a-3p MIMAT0002871	AUGCACCUGGGCAAGGAUUCUG
23	23	hsa-miR-652	Down regulated	hsa-miR-652	>hsa-miR-652-5p MIMAT0022709	CAACCCUAGGAGAGGGUGCCAUUCA
				hsa-miR-652	>hsa-miR-652-3p MIMAT0003322	AAUGGCGCCACUAGGGUUGUG
24	24	miR-let-7a	Down regulated	hsa-let-7a	>hsa-let-7a-5p MIMAT0000062	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7a*	>hsa-let-7a-3p MIMAT0004481	CUAUACAAUCUACUGUCUUUC
25	17	miR-150	Down regulated	hsa-miR-150	>hsa-miR-150-5p MIMAT0000451	UCUCCCAACCCUUGUACCAGUG
				hsa-miR-150*	>hsa-miR-150-3p MIMAT0004610	CUGGUACAGGCCUGGGGGACAG
26	25	miR-30b	Down regulated	hsa-miR-30b	>hsa-miR-30b-5p MIMAT0000420	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30b*	>hsa-miR-30b-3p MIMAT0004589	CUGGGAGGUGGAUGUUUACUUC
27	26,27	miR-135b	Down regulated	hsa-miR-135b	>hsa-miR-135b-5p MIMAT0000758	UAUGGCUUUUCAUUCCUAUGUGA
				hsa-miR-135b*	>hsa-miR-135b-3p MIMAT0004698	AUGUAGGGCUAAAAGCCAUGGG
28	28	miR-16-5p	Down regulated	hsa-miR-16-5p	>hsa-miR-16-5p MIMAT0000069	UAGCAGCACGUAAAUAUUGGCG
29	29	miR-145	Down regulated	hsa-miR-145	>hsa-miR-145-5p MIMAT0000437	GUCCAGUUUUCCCAGGAAUCCCU
				hsa-miR-145*	>hsa-miR-145-3p MIMAT0004601	GGAUUCCUGGAAAUACUGUUCU
30	30	miR-92a	Up regulated	hsa-miR-92a	>hsa-miR-92a-3p MIMAT0000092	UAUUGCACUUGUCCCGGCCUGU
31	31	miR-202	Up regulated	hsa-miR-202*	>hsa-miR-202-5p MIMAT0002810	UUCCUAUGCAUAUACUUCUUUG
				hsa-miR-202	>hsa-miR-202-3p MIMAT0002811	AGAGGUAUAGGGCAUGGGAA
32	32,33	miR-4458	Up regulated	hsa-miR-4458	>hsa-miR-4458 MIMAT0018980	AGAGGUAGGUGUGGAAGAA
33	34	miR-27a	Up regulated	hsa-miR-27a*	>hsa-miR-27a-5p MIMAT0004501	AGGGCUUAGCUGCUUGUGAGCA
				hsa-miR-27a	>hsa-miR-27a-3p MIMAT0000084	UUCACAGUGGCUAAGUUCCGC
34	35	miR-33a-3p	Up regulated	hsa-miR-33a	>hsa-miR-33a-5p MIMAT0000091	GUGCAUUGUAGUUGCAUUGCA
				hsa-miR-33a*	>hsa-miR-33a-3p MIMAT0004506	CAAUGUUUCCACAGUGCAUCAC
35	16	miR-22	Down regulated	hsa-miR-22*	>hsa-miR-22-5p MIMAT0004495	AGUUCUUCAGUGGCAAGCUUUA
				hsa-miR-22	>hsa-miR-22-3p MIMAT0000077	AAGCUGCCAGUUGAAGAACUGU
36	27,36	miR-193b	Down regulated	hsa-miR-193b*	>hsa-miR-193b-5p MIMAT0004767	CGGGGUUUUGAGGGCGAGAUGA
				hsa-miR-193b	>hsa-miR-193b-3p MIMAT0002819	AACUGGCCCUCAAAGUCCCGCU
37	37	miR-3606	Down regulated	hsa-miR-3606	>hsa-miR-3606-5p MIMAT0017983	UUAGUGAAGGCUAUUUUAAUU
				hsa-miR-3606	>hsa-miR-3606-3p MIMAT0022965	AAAAUUUCUUUCACUACUUAG
38	38	miR-26a	Down regulated	hsa-miR-26a	>hsa-miR-26a-5p MIMAT0000082	UUCAAGUAAUCCAGGAUAGGCU
				hsa-miR-26a-2*	>hsa-miR-26a-2-3p MIMAT0004681	CCUAUUCUUGAUUACUUGUUUC
39	39	miR-151	Down regulated	hsa-miR-151	>hsa-miR-151a-5p MIMAT0004697	UCGAGGAGCUCACAGUCUAGU
				hsa-miR-151	>hsa-miR-151a-3p MIMAT0000757	CUAGACUGAAGCUCCUUGAGG
40	40	miR-5196	Up regulated	hsa-miR-5196	>hsa-miR-5196-5p MIMAT0021128	AGGGAAGGGGACGAGGGUUGGG
				hsa-miR-5196	>hsa-miR-5196-3p MIMAT0021129	UCAUCCUCGUCUCCCUCCCAG
41	41	miR-26b-5p	Down regulated	hsa-miR-26b	>hsa-miR-26b-5p MIMAT0000083	UUCAAGUAAUUCAGGAUAGGU
				hsa-miR-26b*	>hsa-miR-26b-3p MIMAT0004500	CCUGUUCUCCAUUACUUGGCU
42	42	miR-618	Up regulated	hsa-miR-618	>hsa-miR-618 MIMAT0003287	AAACUCUACUUGUCCUUCUGAGU
43	43,44	miR-126	Up regulated	hsa-miR-126*	>hsa-miR-126-5p MIMAT0000444	CAUUAUUACUUUUGGUACGCG
				hsa-miR-126	>hsa-miR-126-3p MIMAT0000445	UCGUACCGUGAGUAAUAAUGCG
44	43	miR-139-5p	Up regulated	hsa-miR-139	>hsa-miR-139-5p MIMAT0000250	UCUACAGUGCACGUGUCUCCAGU
				hsa-miR-139	>hsa-miR-139-3p MIMAT0004552	UGGAGACGCGGCCCUGUUGGAGU
45	45	miR-483-5p	Up regulated	hsa-miR-483	>hsa-miR-483-5p MIMAT0004761	AAGACGGGAGGAAAGAAGGGAG
				hsa-miR-483	>hsa-miR-483-3p MIMAT0002173	UCACUCCUCUCCUCCCGUCUU
46	46	miR-130b	Up regulated	miR-130b	>hsa-miR-130b-5p MIMAT0004680	ACUCUUUCCCUGUUGCACUAC
				miR-130b	>hsa-miR-130b-3p MIMAT0000691	CAGUGCAAUGAUGAAAGGGCAU
47	47,48	hsa-miR181b-5p	Up regulated	hsa-miR-181b	>hsa-miR-181b-5p MIMAT0000257	AACAUUCAUUGCUGUCGGUGGGU
48	48,49	hsa-miR-223	Up regulated	hsa-miR-223*	>hsa-miR-223-5p MIMAT0004570	CGUGUAUUUGACAAGCUGAGUU
				hsa-miR-223	>hsa-miR-223-3p MIMAT0000280	UGUCAGUUUGUCAAAUACCCCA
49	48	hsa-miR-210	Down regulated	hsa-miR-210	>hsa-miR-210-5p MIMAT0026475	AGCCCCUGCCCACCGCACACUG
				hsa-miR-210	>hsa-miR-210-3p MIMAT0000267	CUGUGCGUGUGACAGCGGCUGA
50	48	hsa-let-7i	Up regulated	hsa-let-7i	>hsa-let-7i-5p MIMAT0000415	UGAGGUAGUAGUUUGUGCUGUU
				hsa-let-7i*	>hsa-let-7i-3p MIMAT0004585	CUGCGCAAGCUACUGCCUUGCU
51	50	hsa-let-7d	Down regulated	hsa-let-7d	>hsa-let-7d-5p MIMAT0000065	AGAGGUAGUAGGUUGCAUAGUU
				hsa-let-7d*	>hsa-let-7d-3p MIMAT0004484	CUAUACGACCUGCUGCCUUUCU
52	18	hsa-miR-30	Down regulated	hsa-miR-30	>hsa-miR-30a-5p MIMAT0000087	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30a	>hsa-miR-30a-3p MIMAT0000088	CUUUCAGUCGGAUGUUUGCAGC
53	18	hsa-miR-133a	Down regulated	hsa-miR-133a	>hsa-miR-133a-5p MIMAT0026478	AGCUGGUAAAAUGGAACCAAAU
				hsa-miR-133a	>hsa-miR-133a-3p MIMAT0000427	UUUGGUCCCCUUCAACCAGCUG
54	29	miR-29b	Down regulated	hsa-miR-29b-2*	>hsa-miR-29b-2-5p MIMAT0004515	CUGGUUUCACAUGGUGGCUUAG
				hsa-miR-29b	>hsa-miR-29b-3p MIMAT0000100	UAGCACCAUUUGAAAUCAGUGUU
55	16,51,52	miR-29a	Down regulated	hsa-miR-29a	>hsa-miR-29a-3p MIMAT0000086	UAGCACCAUCUGAAAUCGGUUA
				hsa-miR-29a*	>hsa-miR-29a-5p MIMAT0004503	ACUGAUUUCUUUUGGUGUUCAG
56	52	miR-29c	Down regulated	hsa-miR-29c*	>hsa-miR-29c-5p MIMAT0004673	UGACCGAUUUCUCCUGGUGUUC
				hsa-miR-29c	>hsa-miR-29c-3p MIMAT0000681	UAGCACCAUUUGAAAUCGGUUA
57	23	hsa-miR-363	Down regulated	hsa-miR-363	>hsa-miR-363-5p MIMAT0003385	CGGGUGGAUCACGAUGCAAUUU
				hsa-miR-363	>hsa-miR-363-3p MIMAT0000707	AAUUGCACGGUAUCCAUCUGUA
58	53	hsa-miR-326	Down regulated	hsa-miR-326	>hsa-miR-326 MIMAT0000756	CCUCUGGGCCCUUCCUCCAG

Figure 1.

Flow Diagrammatic Representation of Identification of miRNAs up Regulated in Systemic Sclerosis, Extraction of Sequences, and Analysis of their Interaction with NOS2, NOS3 and Arginase1.

b) Extraction of miRNA sequences:

We extracted the miRNA sequences by using their sequence ID’s from miRBase (http://mirbase.org/blog/). Then arranged these miRNA sequences were in FASTA format. In FASTA format the line before the nucleotide sequence is called FASTA definition line and must begin with (‘>’) followed by a unique sequence ID. The sequence ID only contains letters, digits, hyphens (-), underscores (_), colons (:) and number sigh (#).

c) Extraction of target gene sequences:

Our target genes were NOS2, NOS3, and ARG1. We extracted their complete nucleotide sequences from NCBI database (National Center for Biotechnology Information) in FASTA format (https://www.ncbi.nlm.nih.gov/). To provide accuracy to study we extracted three sequences for each.

NOS2: (Accession No: NM_000625.4, BC144126.1 and BC130283.1)

NOS3: (Accession No: NM_000603.5, AF032908.1 and AF400594.1)

Arginase I (NM_000045.4, NM_001244438.2 and NM_001369020.1)

d) Interpretation of result by using RNA22:

We evaluated the binding strength of miRNAs against nitric oxide synthases (NOS2, NOS3) Arginase (ARG1) by using an RNA22 webserver.⁵⁴ In RNA 22, input miRNA sequence (not more than 50) in FASTA format was followed by input single target sequence (NOS2, NOS3 and Arginase1) in FASTA format. Both the sequences aligned together and gave results in hetroduplex form.

Use of Gibbs Free Energy in Target Prediction

There are various criteria for target prediction of miRNA: strong, Watson Crick base-pairing of the miRNA to a complementary site in the mRNA, conservation of the miRNA binding site, favourable minimum free energy (MFE), also known as Gibbs free energy, for the local miRNA-mRNA interaction, and/or structural accessibility of the surrounding mRNA sequence. Gibbs free energy or MFE is used to measure the stability of miRNA-mRNA interaction.⁵⁵ Gibbs free energy less than –15 to –18 Kcal/mol indicates stable base pairing. Lower the Gibbs free energy more likely is the stable interaction between miRNA and mRNA.⁵⁶ We then identified the target sequences of various miRNAs, upregulated in SSc, having Gibbs free energy ≤ –18 Kcal/mol.

Results

First, we prepared the library of miRNAs whose expressions were altered in SSc patients (Table 1). We extracted the miRNAs sequence from miRbase and analysed the strength of targeting of NOS2 (Supplementary Table 1), NOS3 (Supplementary Table 2) and Arginase1 (Supplementary Table 3) by RNA22 webserver. A total of 15 miRNAs that strongly target NOS3, 13 miRNAs that target NOS2 and only two miRNAs that target Arginase-1 were identified. We interpreted the result according to Gibbs free energy (δG) of miRNA with target sequence which must be ≤18.0Kj/mole for the upregulated miRNA.

SSc miRNA Mediated Disrupted Endothelium Repair and Homeostasis

Fifteen unique miRNAs were upregulated in SSc that has potential to target NOS3 gene very strongly and may lead to impaired endothelial repair and homeostasis (Supplementary Table 2). Representative miRNA interaction with it is shown in Figure 2. This might be a cause of endothelial dysfunction. NOS3 dysfunction leads to excessive endothelium injury.

Figure 2.

Interaction of miRNA up Regulated in Systemic Sclerosis Patients with NOS2, NOS3, and Arginase1 mRNA, Representative Image.

SSc miRNA Regulate M1 Versus M2 Macrophage Differentiation

SSc begins with endothelial injury and M1/M2 macrophage dysregulation. In the initial phase, the endothelium gets disrupted and factors involved in repair are altered, resulting in enhanced damage to the endothelium and disruption of repair. M1 macrophages express NOS2 while M2 macrophages express Arginase1. In the present study, we observed that 13 microRNAs were strongly targeting NOS2, while only two miRNAs were targeting Arginase1. It suggested that miRNAs upregulated in SSc target NOS2 predominantly (Supplementary Table 2), as compared to Arginase1 (Supplementary Table 3), which may have resulted in reduced functionality of M1 macrophage and had no/minimal effect on the M2 macrophage population (Figure 3), resulting in M2 macrophage functional dominance. M2 macrophages express arginase1 and use arginine as a substrate. Arginase hydrolyses arginine to urea and ornithine, which acts as a precursor for polyamines and proline, which enhances collagen production and fibrosis.⁵⁷

Figure 3.

L-Arginine Metabolism in Endothelial Cell and Macrophages in Healthy Control and Systemic Sclerosis Patients.

Discussion

In our in-silico study, we observed that NOS2 and NOS3 mRNAs are strongly targeted by miRNAs upregulated in SSc patients. Previous studies have shown that SSc pathogenesis starts with endothelial dysfunction in genetically predisposed individuals after exposure to environmental factors; cold, stress, chemical exposure, and exposure to certain viruses, resulting in activation and aggregation of platelets to form thrombi. The imbalance between vasodilators and vasoconstrictors leads to ischemic reperfusion injury.¹ Endothelial NOS (NOS3) is produced by endothelial cells and acts in an autocrine manner to stimulate the growth of endothelial cells and migration of endothelial cell progenitors leading to angiogenesis. NO diffuses into vessel walls, causing arterial vessels to relax and increase blood flow. NO also acts in a paracrine manner to prevent thrombosis by inhibiting platelet adhesion and aggregation. NO produced by NOS3 binds to the prosthetic heme on soluble guanylate cyclase (sGC) to stimulate cyclic GMP synthesis, activating cGMP-dependent protein kinase (cGKI) and cGMP-gated channels to regulate downstream targets that increase endothelial cell proliferation, migration, survival, and permeability.⁵⁷ Therefore, targeting NOS3 by miRNA may lead to endothelial dysfunction in SSc patients.

Additionally, low expression of NOS3 leads to the activation of endothelial cells and overexpression of cell adhesion molecules like intercellular adhesion molecule-1 (ICAM1) and Vasopressin-activated Ca(2+)-mobilising (VACM-1) which leads to excessive recruitment of immune cells¹ and excessive platelet activation and thrombosis as well as reduced angiogenesis.³ Activated platelets are a rich source of serotonin (5 hydroxy tryptamine, 5HT) which through 5HT2 receptors mediate widespread fibrosis.

Similarly, in our in-silico study, we found that NOS2 mRNA is strongly targeted by miRNA upregulated in SSc patients, but only two of the miRNAs targeted Arginase 1 and that too with very little Gibbs free energy. This alteration may also play an important role in SSc pathogenesis. Macrophages in SSc are the major source of fibrosis-inducing cytokines, such as transforming growth factor β1 (TGF-β1).⁵⁸ Macrophages, the M1 phenotype, produce nitrogen intermediates and inflammatory cytokines such as interleukin-1β (IL-1β), tumour necrosis factor-α (TNF-α) and IL-6 to promote active inflammation.⁵⁹ In contrast, M2 macrophages have high expression of haemoglobin scavenger receptor (CD163), class A scavenger receptor (CD204), and mannose receptor (CD206).⁶⁰ They are associated with a high degree of vascularisation and influence wound repair.⁶¹ Ishikawa et al. also demonstrated that the ratio of infiltrating macrophages, CD68+ cells, to T cells were high, suggesting an important role of cutaneous macrophages in SSc.⁶² In SSc patients, M2 Macrophages and Th2 cells are present predominantly and these cells secrete cytokines such as IL4, TGF-β1, and IL13 which are the major players of fibrosis.⁶³ During TGF-β1 canonical signalling, SMAD-2/3 gets phosphorylated and interacts with SMAD-4 and gets translocated inside the nucleus and binds to promoter sequences of various pro-fibrotic genes resulting in excessive expression of pro-fibrotic genes.⁶⁴ Our study has translational potential, whereby targeting miRNAs that target NOS2 and NOS3 genes by chemically modified antisense oligonucleotides⁶⁵ may help in restoring the balance between M1 and M2 macrophages and thus reduced endothelial dysfunction and fibrosis. Our study has certain limitations as well; first, we analysed miRNAs targeting three genes only and second, we did not validate the expression of either various miRNAs or the three genes that were the target of miRNAs in samples drawn from the patients with SSc.

To conclude, we observed that there are many miRNAs that are upregulated and strongly target NOS2 and NOS3 but scarcely Arginase-1 genes. This could explain endothelial dysfunction and excessive fibrosis in SSc. Validation of these miRNAs in endothelial dysfunction as well as differential alteration in macrophage populations is required.

Supplemental Material

The supplemental material for this article is available online.

Supplemental Material

The supplemental material for this article is available online.

Supplemental Material

The supplemental material for this article is available online.

Footnotes

Acknowledgements

Authors acknowledge voluntary contribution of Akshat Agarwal and Harshita Pandey towards data acquisition, English language editing, and bibliography annotations in preparation of this manuscript.

Authors Contribution

The conception and design of the study – NS, MKR VA; acquisition of data, analysis, and interpretation of data – NS, VA. Drafting the article – NS, MKR; Revising it critically for important intellectual content – MKR, VA, VA. Final approval of the version to be submitted – NS, MKR, VA, VA. Agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved – NS, MKR, VA, VA.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship and/or publication of this article.

Funding

The authors received no financial support for the research, authorship and/or publication of this article.

References

Katsumoto

, Whitfield

, Connolly

. The pathogenesis of systemic sclerosis. Annu Rev Pathol. 2011;6:509–537.

Heiss

, Rodriguez-Mateos

, Kelm

. Central role of eNOS in the maintenance of endothelial homeostasis. Antioxid Redox Signal. 2015;22(14):1230–1242.

Romero

, Zhang

, Cooke

, . Differential expression of nitric oxide by dermal microvascular endothelial cells from patients with scleroderma. Vasc Med (London, England). 2000;5(3):147–158.

Toledo

, Pioli

. Macrophages in systemic sclerosis: novel insights and therapeutic implications. Curr Rheumatol Rep. 2019;21(7):31.

Zhang

, Yang

, Ericsson

. Function of macrophages in disease: current understanding on molecular mechanisms. Front Immunol. 2021;12:620510.

Mills

, Kincaid

, Alt

, . M-1/M-2 macrophages and the Th1/Th2 paradigm. J Immunol (Baltimore, Md: 1950). 2000;164(12):6166–6173.

Higashi-Kuwata

, Jinnin

, Makino

, . Characterization of monocyte/macrophage subsets in the skin and peripheral blood derived from patients with systemic sclerosis. Arthritis Res Ther. 2010;12(4):R128.

Higashi-Kuwata

, Makino

, Inoue

, . Alternatively activated macrophages (M2 macrophages) in the skin of patient with localized scleroderma. Exp Dermatol. 2009;18(8):727–729.

Nakayama

, Jinnin

, Makino

, . Serum levels of soluble CD163 in patients with systemic sclerosis. Rheumatol Int. 2012;32(2):403–407.

10.

Atri

, Guerfali

, Laouini

. Role of human macrophage polarization in inflammation during infectious diseases. Int J Mol Sci. 2018;19(6):1801.

11.

Guo

, Shao

, Zheng

, . miRNA-939 regulates human inducible nitric oxide synthase posttranscriptional gene expression in human hepatocytes. Proc Natl Acad Sci U S A. 2012;109(15):5826–5831.

12.

, Kim

. Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol. 2014;15(8):509–524.

13.

Qin

J-Z

, Wang

S-J

, Xia

. microRNAs regulate nitric oxide release from endothelial cells by targeting NOS3. J Thromb Thrombolysis. 2018;46(3):275–282.

14.

Yoo

, Kim

, Lee

A-R

, . Alteration of microRNA 340-5p and arginase-1 expression in peripheral blood cells during acute ischemic stroke. Mol Neurobiol. 2019;56(5):3211–3221.

15.

Zhang

, Wu

, Zhao

, Lu

. Meta-analysis of differentially expressed microRNAs in systemic sclerosis. Int J Rheum Dis. 2020;23(10):1297–1304.

16.

Oak

, Murray

, Herath

, . A micro RNA processing defect in rapidly progressing idiopathic pulmonary fibrosis. PloS one. 2011;6(6):e21253.

17.

Honda

, Jinnin

, Kira-Etoh

, . miR-150 down-regulation contributes to the constitutive type I collagen overexpression in scleroderma dermal fibroblasts via the induction of integrin β3. Am J Pathol. 2013;182(1):206–216.

18.

, Yang

, Fan

, . MicroRNA array analysis of microRNAs related to systemic scleroderma. Rheumatol Int. 2012;32(2):307–313.

19.

Honda

, Jinnin

, Kajihara

, . TGF-β-mediated downregulation of microRNA-196a contributes to the constitutive upregulated type I collagen expression in scleroderma dermal fibroblasts. J Immunol (Baltimore, Md: 1950). 2012;188(7):3323–3331.

20.

Makino

, Jinnin

, Etoh

, . Down-regulation of microRNA-196a in the sera and involved skin of localized scleroderma patients. Eur J Dermatol. 2014;24(4):470–476.

21.

Jafarinejad-Farsangi

, Gharibdoost

, Farazmand

, . MicroRNA-21 and microRNA-29a modulate the expression of collagen in dermal fibroblasts of patients with systemic sclerosis. Autoimmunity. 2019;52(3):108–116.

22.

Zhu

, Luo

, Li

, . MicroRNA-21 in scleroderma fibrosis and its function in TGF-β-regulated fibrosis-related genes expression. J Clin Immunol. 2013;33(6):1100–1109.

23.

, Huang

, Hu

, . MicroRNA-320a: an important regulator in the fibrotic process in interstitial lung disease of systemic sclerosis. Arthritis Res Ther. 2021;23(1):21.

24.

Makino

, Jinnin

, Hirano

, . The downregulation of microRNA let-7a contributes to the excessive expression of type I collagen in systemic and localized scleroderma. J Immunol (Baltimore, Md: 1950). 2013;190(8):3905–3915.

25.

Tanaka

, Suto

, Ikeda

, . Alteration of circulating miRNAs in SSc: miR-30b regulates the expression of PDGF receptor β. Rheumatology (Oxford, England). 2013;52(11):1963–1972.

26.

O’Reilly

, Ciechomska

, Fullard

, . IL-13 mediates collagen deposition via STAT6 and microRNA-135b: a role for epigenetics. Sci Rep. 2016;6:25066.

27.

Fioretto

, Rosa

, Romano

, . The contribution of epigenetics to the pathogenesis and gender dimorphism of systemic sclerosis: a comprehensive overview. Ther Adv Musculoskelet Dis. 2020;12:1759720x20918456.

28.

Yao

, Xing

, Wang

, . MiR-16-5p suppresses myofibroblast activation in systemic sclerosis by inhibiting NOTCH signaling. Aging. 2020;13(2):2640–2654.

29.

Zhu

, Li

, Qu

, . MicroRNA expression abnormalities in limited cutaneous scleroderma and diffuse cutaneous scleroderma. J Clin Immunol. 2012;32(3):514–522.

30.

Sing

, Jinnin

, Yamane

, . microRNA-92a expression in the sera and dermal fibroblasts increases in patients with scleroderma. Rheumatology (Oxford, England). 2012;51(9):1550–1556.

31.

Zhou

, Zhu

, Luo

, . MicroRNA-202-3p regulates scleroderma fibrosis by targeting matrix metalloproteinase 1. Biomed Pharmacother. 2017;87:412–418.

32.

Szabo

, Muntean

, Crisan

, . Novel concepts in systemic sclerosis pathogenesis: role for miRNAs. Biomedicines. 2021;9(10):1471

33.

Nakayama

, Jinnin

, Tomizawa

, . Dysregulated interleukin-23 signalling contributes to the increased collagen production in scleroderma fibroblasts via balancing microRNA expression. Rheumatology (Oxford, England). 2017;56(1):145–155.

34.

Henderson

, Wilkinson

, Przyborski

, . microRNA27a-3p mediates reduction of the Wnt antagonist sFRP-1 in systemic sclerosis. Epigenetics. 2021;16(7):808–817.

35.

Henderson

, Pryzborski

, Stratton

, O’Reilly

. Wnt antagonist DKK-1 levels in systemic sclerosis are lower in skin but not in blood and are regulated by microRNA33a-3p. Exp Dermatol. 2021;30(1):162–168.

36.

, Zhao

, Ma

, . Deregulation of miR-193b affects the growth of colon cancer cells via transforming growth factor-β and regulation of the SMAD3 pathway. Oncol Lett. 2017;13(4):2557–2562.

37.

Shi

, Liu

, Li

, . MiR-3606-3p inhibits systemic sclerosis through targeting TGF-β type II receptor. Cell Cycle (Georgetown, Tex). 2018;17(16):1967–1978.

38.

Ciechomska

, Wojtas

, Swacha

, . Global miRNA and mRNA expression profiles identify miRNA-26a-2-3p-dependent repression of IFN signature in systemic sclerosis human monocytes. Eur J Immunol. 2020;50(7):1057–1066.

39.

Liu

, Cheng

, Zhan

, . The roles of noncoding RNAs in systemic sclerosis. Front Immunol. 2022;13:856036.

40.

Ciechomska

, Zarecki

, Merdas

, . The role of microRNA-5196 in the pathogenesis of systemic sclerosis. Eur J Clin Invest. 2017;47(8):555–564.

41.

Sun

, Xie

, Wu

, . Identification and Interaction analysis of key genes and microRNAs in systemic sclerosis by bioinformatics approaches. Curr Med Sci. 2019;39(4):645–652.

42.

Rossato

, Affandi

, Thordardottir

, . Association of MicroRNA-618 Expression with altered frequency and activation of plasmacytoid dendritic cells in patients with systemic sclerosis. Arthritis Rheumatol. 2017;69(9):1891–1902.

43.

Chouri

, Wang

, Hillen

, . Implication of miR-126 and miR-139-5p in plasmacytoid dendritic cell dysregulation in systemic sclerosis. J Clin Med. 2021;10(3):491.

44.

Wang

, Sun

, Kahaleh

. Epigenetic down-regulation of microRNA-126 in scleroderma endothelial cells is associated with impaired responses to VEGF and defective angiogenesis. J Cell Mol Med. 2021;25(14):7078–7088.

45.

Chouri

, Servaas

, Bekker

CPJ

, . Serum microRNA screening and functional studies reveal miR-483-5p as a potential driver of fibrosis in systemic sclerosis. J Autoimmun. 2018;89:162–170.

46.

Luo

, Zhu

, Zhou

, . MicroRNA-130b regulates scleroderma fibrosis by targeting peroxisome proliferator-activated receptor γ. Mod Rheumatol. 2015;25(4):595–602.

47.

Wuttge

, Carlsen

, Teku

, . Specific autoantibody profiles and disease subgroups correlate with circulating micro-RNA in systemic sclerosis. Rheumatology (Oxford, England). 2015;54(11):2100–2107.

48.

Wolska-Gawron

, Bartosińska

, Rusek

, . Circulating miRNA-181b-5p, miRNA-223-3p, miRNA-210-3p, let 7i-5p, miRNA-21-5p and miRNA-29a-3p in patients with localized scleroderma as potential biomarkers. Sci Rep. 2020;10(1):20218.

49.

Steen

, Iversen

, Carlsen

, . The circulating cell-free microRNA profile in systemic sclerosis is distinct from both healthy controls and systemic lupus erythematosus. J Rheumatol. 2015;42(2):214–221.

50.

Pandit

, Corcoran

, Yousef

, . Inhibition and role of let-7d in idiopathic pulmonary fibrosis. Am J Respir Crit Care Med. 2010;182(2):220–229.

51.

Harmanci

, Erkan

, Kocak

, Akdogan

. Role of the microRNA-29 family in fibrotic skin diseases. Biomed Rep. 2017;6(6):599–604.

52.

Maurer

, Stanczyk

, Jüngel

, . MicroRNA-29, a key regulator of collagen expression in systemic sclerosis. Arthritis Rheum. 2010;62(6):1733–1743.

53.

Das

, Kumar

, Negi

, . MicroRNA-326 regulates profibrotic functions of transforming growth factor-β in pulmonary fibrosis. Am J Respir Cell Mol Biol. 2014;50(5):882–892.

54.

Miranda

, Huynh

, Tay

, . A pattern-based method for the identification of MicroRNA bindingsites and their corresponding heteroduplexes. Cell. 2006;126(6):1203–1217.

55.

Yue

, Liu

, Huang

. Survey of computational algorithms for microRNA target prediction. Curr Genomics. 2009;10(7):478–492.

56.

Hammell

, Long

, Zhang

, ., mirWIP: microRNA target prediction based on microRNAcontaining ribonucleoprotein–enriched transcripts. Nat Methods. 2008;5(9):813–819.

57.

Endo

, Oyadomari

, Terasaki

, . Induction of arginase I and II in bleomycin-induced fibrosis of mouse lung. Am J Physiol Lung Cell Mol Physiol. 2003;285(2):L313–L321.

58.

Duval

, Le Boeuf

, Huot

, Gratton

. Src-mediated phosphorylation of Hsp90 in response to vascular endothelial growth factor (VEGF) is required for VEGF receptor-2 signaling to endothelial NO synthase. Mol Biol Cell. 2007;18(11):4659–4668.

59.

Andrews

, Friou

, Berman

, . Changes in circulating monocytes in patients with progressive systemic sclerosis. J Rheumatol. 1987;14(5):930–935.

60.

Gordon

. Alternative activation of macrophages. Nat Rev Immunol. 2003;3(1):23–35.

61.

Kodelja

, Müller

, Tenorio

, . Differences in angiogenic potential of classically vs alternatively activated macrophages. Immunobiology. 1997;197(5):478–493.

62.

Ishikawa

, Ishikawa

. Macrophage infiltration in the skin of patients with systemic sclerosis. J Rheumatol. 1992;19(8):1202–1206.

63.

Manetti

. Deciphering the alternatively activated (M2) phenotype of macrophages in scleroderma. Exp Dermatol. 2015;24(8):576–578.

64.

Leask

. Scar wars: is TGFbeta the phantom menace in scleroderma? Arthritis Res Ther. 2006;8(4):213.

65.

, Rana

. Therapeutic targeting of microRNAs: current status and future challenges. Nat Rev Drug Discov. 2014;13(8):622–638.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.06 MB

0.04 MB

0.02 MB