Ascorbate and alpha-tocopherol attenuate hepatorenal injury and modulate CYP2E1 and Nrf2 expression in rats exposed to herbalised alcoholic beverage

Abstract

Background

The rising consumption of herbal alcoholic beverages in Nigeria, driven by unverified health claims, poses growing public health risks and adds to the global disease burden.

Aim

To evaluate the effects of ascorbate and alpha-tocopherol supplementation on hepatorenal biochemical parameters, histopathology, and expression of oxidative stress-related genes (Nrf2 and CYP2E1) in rats exposed to a herbal-based alcoholic beverage.

Methods

Twenty-eight adult male Wistar rats were randomly assigned into four groups (n=7 per group) using a computer-generated randomisation, with all outcome assessments performed under blinded conditions. Group I consisted of the unexposed control rats. Group II rats received a daily oral dose of alcohol at 0.2 mL/kg/bw. Groups III and IV were also administered alcohol daily at 0.2 mL/kg/bw but were additionally treated with ascorbate (500 mg/kg) and alpha-tocopherol (300 mg/kg), respectively, for 28 days. Hepatorenal biochemical parameters, hepatic and renal Nrf2 and CYP2E1 expression, and histopathological changes were subsequently evaluated.

Results

Supplementation with ascorbate (500 mg/kg) or α-tocopherol (300 mg/kg) was associated with significantly lower (p < 0.05) ALP, ALT, AST, creatinine, and urea levels compared with alcohol-exposed untreated rats. Vitamin supplementation was associated with the modulation of alcohol-induced overexpression of CYP2E1 and Nrf2, and partially restored the altered biochemical parameters. Histopathological examination further revealed mitigated alcohol-induced architectural disruptions in the liver and kidney, suggestive of the protective effects of antioxidant supplementation.

Conclusion

Ascorbate and alpha-tocopherol supplementation were associated with attenuation of alcohol-induced hepatorenal biochemical alterations, partial normalisation of liver and kidney function parameters, and modulation of oxidative stress-related gene expression (CYP2E1, Nrf2), findings consistent with a potential adjunctive role of these vitamins in mitigating alcohol-related organ toxicity rather than indicating definitive therapeutic effects. Mechanistic conclusions are limited by the absence of direct oxidative stress marker measurements (lipid peroxidation, glutathione status, antioxidant enzyme activities), and interpretation is limited by the absence of pure ethanol and vitamin-only control groups and the lack of independent chemical verification of the test beverage.

Introduction

Alcohol-related liver disease accounts for a substantial percentage of alcohol-induced deaths worldwide. ¹ In many developing countries, the consumption of herbal-based alcoholic beverages has risen due to the unsubstantiated beliefs in their health-enhancing properties. In Nigeria, the majority of the population relies entirely on these beverages for medical purposes, pleasure, or leisure, without considering the potentially detrimental biological effects of their consumption.^2–4 Furthermore, the assertion that it is a restorative and sex energy booster continues to increase customer patronage.^5,6 According to estimates, excessive alcohol consumption accounts for 3 million deaths annually, with the majority of these deaths associated with liver disorders. ⁷ Corticosteroid prescriptions are the first line of therapy for alcoholic hepatitis.^8–10 Histologically, alcoholic hepatitis, chronic hepatitis with cirrhosis or hepatic fibrosis, and simple steatosis or fatty liver are the three stages of alcoholic liver disease (ALD).^11–13 The liver and kidneys are essential for the detoxification and filtration of toxins, and excessive alcohol consumption damages these organs by raising levels of toxic products like acetaldehyde, NADH, and free radicals, which are typically produced when cells metabolise alcohol and are detrimental to physiological health.^5,14,15 Alcohol dehydrogenase (ADH) is the major enzyme utilised by the body to metabolise alcohol, and it is predominantly expressed in the liver. However, the body also employs CYP2E1 for alcohol metabolism, present in both the liver and kidneys after an extended period of ethanol consumption. ¹⁶ Acetaldehyde’s mutagenic and carcinogenic properties, as well as its significant role in upper gastrointestinal carcinogenesis, have been established through human investigations as well as animal studies.^17,18 The change in the redox balance, which is a hallmark of oxidative stress, is one of the primary causes of alcohol-related hepatorenal injury.^13,19 Reactive oxygen species (ROS) are produced by various cellular processes, especially those related to energy metabolism. In biological systems, radicals are primarily classified into two groups: ROS and nitrogen-based radicals, such as the Reactive nitrogen species (RNS). ROS can be subdivided into two types: oxygen-centred radicals, which include the hydroxyl radical (•OH), superoxide anion (O2•), alkoxyl radical (RO•), and peroxyl radical (ROO•); and oxygen-centred non-radicals, which include singlet oxygen and hydrogen peroxide (H₂O₂). ²⁰ Antioxidants are compounds that prevent the oxidation of other molecules, thereby protecting cells from the destructive effects of ROS and RNS. Their mechanism of action can be through free radical scavenging, metal chelation, regeneration of other antioxidants, and modulation of antioxidant enzymes.^21–24 Vitamins, such as ascorbate and alpha-tocopherol, are powerful antioxidants that have garnered attention due to their ability to lower oxidative stress and inflammation in various clinical situations.^25–27 The main forms of vitamins C (ascorbate) and E (α-tocopherol) function as antioxidants protecting against lipid peroxidation and the resulting tissue damage by scavenging free radicals and bolstering the integrity of cellular membranes.^28,29 Studies have demonstrated that high doses of vitamin C, singly administered or in conjunction with medications, possess anti-cancer properties that involve immunological, redox, and epigenetic processes. ³⁰ Additional studies by George et al. ³¹ also demonstrate how vitamin C supplementation results in regenerative changes in the experimental rats’ testicular histology, as well as noticeable improvements in sperm parameters and antioxidant enzyme activities. In contrast, vitamin E is a fat-soluble antioxidant and a necessary vitamin that may help protect tissues from unchecked lipid peroxidation. It is also important for gene modulation and protein function. This antioxidant has been proven to have positive health benefits on lipid metabolism and detoxification processes, cardiovascular protection mechanisms, and immune cell modulation. Its chromanol ring allows the phenolic group to give electrons that neutralise lipid peroxyl radicals.^32–34

The transcriptional regulatory element, also known as the antioxidant response element (ARE), regulates the post-transcriptional expression of several genes as well as the synthesis of different antioxidant proteins. The Nuclear factor erythroid 2-related factor 2 (Nrf2) activates genes that contain the ARE. ³⁵ Chronic alcohol use remains a predisposing factor to developing a variety of tumours, and several processes, such as cytochrome P-4502E1—one of the 57 cytochrome P450 enzymes that account for more than 90% of chemical redox reactions, including those involving drugs, vitamins, steroids, chemical carcinogens, and industrial compounds, contribute to alcohol-mediated carcinogenesis. ³⁶ The primary sources of ROS in the hepatocytes during alcohol intoxication are the cytochrome P450, specifically the microsomal respiratory chain, and the CYP2E1-dependent system. ³⁷ Oxidative stress generated by excessive CYP2E1 activation in the kidneys changes phospholipids in cell membranes, which may subsequently stimulate immune cells like neutrophils, amplifying oxidative stress and generating a vicious cycle. ¹⁶ Although the unregulated consumption of local alcoholic beverages has been implicated in the propensity to various ailments, local inhabitants in Akure, Ondo state, Nigeria, regularly consume a variety of alcoholic beverages, including Orijin Bitters, which is a popular alcoholic beverage sold in the public areas surrounding Akure. This study evaluates the immunomodulatory effects of vitamin C and vitamin E supplementation on the expression of CYP2E1 and Nrf2, as well as the histological and biochemical status in Wistar rats sub-acutely exposed to a local alcoholic beverage.

Material and methods

Chemicals and drugs

A commercially available alcoholic beverage, Orijin Bitters with 30% v/v ethanol content, was purchased from a commercial store in Oba-Ile, Akure, Ondo State, Nigeria. The product, manufactured on May 2, 2024, with batch number L4123E3001, was used in this study. According to the manufacturer’s label, its listed ingredients include neutral spirit, sugar, citric acid, trisodium citrate, caramel, and extracts of naartjie, chamomile, thyme, cinnamon, and orange. All experimental animals received the herbal alcoholic beverage from the same production batch (batch number L4123E3001, manufactured May 2, 2024, expiration April 2026) to ensure consistency within this study. The manufacturer’s label lists ethanol content as 30% v/v and declares the following ingredients: neutral spirit, sugar, citric acid, trisodium citrate, caramel, and plant extracts (naartjie/citrus peel, chamomile, thyme, cinnamon, orange). However, independent chemical verification of this batch’s composition was not performed, preventing confirmation of the actual ethanol concentration (labelled as 30% v/v), specific phytochemical constituents and their concentrations, the absence of undeclared compounds or contaminants, and the total antioxidant capacity of the beverage matrix. Additionally, potential batch-to-batch variability in herbal extract composition, phytochemical profiles, and ethanol content is acknowledged as a limitation when extrapolating findings to other production batches of this product or to similar herbal alcoholic beverages. Future studies should include independent chemical characterisation (e.g., HPLC-MS analysis, GC-FID for ethanol quantification, spectrophotometric total phenolic/flavonoid content) to define the test substance composition comprehensively.

The vitamin E capsules produced in 7 Oser Avenue, Hauppauge, NY 117 USA, by Bactolac Pharmaceutical Inc., were purchased from Sunphil Pharmaceuticals Nigeria Ltd. Each soft gelatin capsule contains 1000 IU of vitamin E acetate by the United States Pharmacopoeia (USP) Reference Standard. Additionally, vitamin C tablets were procured from Sunphil Pharmaceuticals Nigeria Ltd., manufactured by Archy Pharmaceuticals Nigeria Ltd., and registered with the National Agency for Food and Drug Administration and Control (NAFDAC) under the number 04-5270. These tablets comply with the British Pharmacopoeia (BP) Reference Standard, which specifies 100 mg of ascorbic acid per tablet. Aspartate aminotransferase (AST), alkaline phosphatase (ALP), alanine aminotransferase (ALT), urea, and creatinine were estimated spectrophotometrically using reagents procured from Randox Diagnostic Laboratory in the United Kingdom. ³⁸

Ethical considerations

Twenty-eight rats were randomly assigned to four experimental groups (n = 7 per group using a computer-generated randomisation procedure via Research Randomiser (https://www.randomizer.org). Randomisation and allocation concealment were conducted by Ms Adebimpe Moronkeji, a Medical Laboratory Scientist not involved in outcome assessment, to ensure blinding. All experimental procedures and data analyses were conducted with the investigators blinded to group assignments. Both the animal handlers and outcome assessors were blinded to group allocation throughout the experiment to minimise bias. Firstly, animal handlers received treatment solutions in identical coded syringes and were blinded to group allocation throughout the study, furthermore, outcome assessors analysed coded samples (plasma samples coded with random ID numbers before biochemical analysis, tissue sections coded with random ID numbers for histopathology, RNA samples coded for PCR analysis) without knowledge of treatment group, and statistical analysis was performed under coded group labels (A, B, C, D) with group identity revealed only after all statistical analyses were finalised. Animals were housed in polycarbonate cages (18 x 13 x 18 cm) in groups of seven per cage with wood shavings bedding changed thrice weekly. The facility was maintained at 25 ± 2 °C, 50–60% humidity, and a 12-hour light/dark cycle. Standardised rat pellets sourced from the University of Medical Science, Ondo (UNIMED) animal holding facility and water were provided ad libitum. The welfare and health of the animals were monitored daily, assessing their general appearance, behaviour, body condition and water intake with body weight measured weekly (days 0,7,14,21 and 28) using a calibrated weighing scale (SP 401, OHAUS, Parsippany, USA). Predefined humane endpoints included > 20% body weight loss, severe lethargy or inability to ambulate, prolonged anorexia (>24hr), significant distress, or moribund state. No animals reached these endpoints, and no deaths were recorded throughout the study. Sample size determination was based on an a priori power analysis for a one-way ANOVA (four groups, α = 0.05, power = 0.80). Based on pilot data analysed using G*Power (version 3.1.9.7), the estimated effect size was Cohen’s f = 0.40. This effect size yielded a minimum required sample size of six animals per group. To ensure adequate power and account for potential attrition, seven rats were included in each group. ³⁹ Effect sizes and 95% confidence intervals were reported for primary outcomes to enhance interpretability in accordance with the ARRIVE guidelines.

Animal husbandry

A total of twenty-eight (28) Wistar rats purchased from the animal holding of Elizade University, Akure, Ondo State, Nigeria, were randomly subdivided into four groups for the experimental study and acclimatised for two weeks before commencement. Randomisation was employed to ensure unbiased group allocation, enhance statistical reliability, and minimise confounding variables, in line with established ethical and scientific standards. The animals were kept in polycarbonate cages (18 x 13 x 18 cm) in an adequately ventilated room with regulated environmental conditions (25 ± 2 °C), a standardised rat pellet sourced from UNIMED, and unlimited access to water. The study’s experimental protocol and animal treatment were in accordance with the ARRIVE guidelines to ensure ethical conduct and transparent reporting of animal research. The dosing of rats in each group was established by Bolawa et al. ³⁸ following a 14-day acclimatisation period.

Experimental study

The animals were divided into four groups, each consisting of seven rats (n=7). The rats in Group I were the unexposed control group, allowed free access to water and standardised rat pellets. Each of the rats in the test groups II, III and IV was exposed daily to herbalised alcoholic drinks (Orijin Bitters) at doses of 0.2 mL/kg/bw. ³⁸ While the rats in Group II were the alcohol-exposed untreated rats, Group III and Group IV were alcohol-exposed groups orally treated with vitamin C and vitamin E at 500 mg/kg/bw and 300 mg/kg/bw, respectively, for 28 days.

Dose preparation and administration

Vitamin E acetate (α-tocopherol acetate) was administered at a dose of 300 mg/kg body weight. The dose for administration was calculated based on the average body weights of rats used in the study (208g). According to USP standards, 1 IU of vitamin E activity equals 1.0 mg of dl-α-tocopherol acetate (synthetic form) or 0.67 mg of d-α-tocopherol (natural form). The target dose of 300 mg/kg body weight of α-tocopherol acetate corresponds to approximately 300 IU/kg when using the synthetic acetate form, or 448 IU/kg when calculated as the natural d-α-tocopherol equivalent. For the average rat body weight in this study (208 g = 0.208 kg), the required dose is 300 mg/kg × 0.208 kg = 62.4 mg α-tocopherol acetate per rat, equivalent to approximately 62.4 IU (synthetic) or 93 IU (if converted to natural form equivalent) per rat per day. The commercial vitamin E capsules contained 1000 IU per soft gelatin capsule (equivalent to approximately 1000 mg dl-α-tocopherol acetate). To prepare the dosing solution, capsules were opened and the oil extracted; 1.25 g (1250 mg) of vitamin E oil was dissolved in 10 mL pharmaceutical-grade corn oil to achieve a final concentration of 125 mg/mL. Each rat received 0.5 mL of this freshly prepared solution by oral gavage, delivering 62.5 mg of α-tocopherol acetate (which essentially matched the target dose of 62.4 mg). This dose was selected based on previous studies demonstrating efficacy in mitigating oxidative stress and hepatorenal injury in ethanol-induced toxicity models in rodents,^40,41 represents a pharmacological rather than physiological dose, and when converted to human equivalent dose using FDA body surface area normalization (Km ratio 6.2/37 for rat-to-human), corresponds to approximately 10 mg/kg in humans (600-700 mg for a 60-70 kg adult), which is within the range used in clinical antioxidant supplementation studies though substantially higher than typical dietary intake (15 mg/day recommended dietary allowance). For vitamin C dose preparation and administration, the vitamin was orally administered at a dose of 500 mg/kg. The doses administered per rat were calculated according to the average body weight (208g), and the required amount was determined as follows: 500 mg/kg×0.208 kg =104 mg per rat. To maintain the acceptable oral gavage volume of 0.5 mL, a dosing solution with a final concentration of 208 mg/mL was prepared. This was achieved by dissolving 2.08 g (2080 mg) of ascorbate in 10 mL of distilled water to obtain a homogenous solution suitable for oral administration with each rat receiving 0.5mL of freshly prepared ascorbate solution by oral gavage, corresponding to a dose of 104 mg per rat, equivalent to 500 mg/kg body weight. ⁴² The administration volume was standardised across all experimental groups to ensure dosing accuracy and minimise variability in gastrointestinal absorption.

Human equivalent dose (HED) calculation

Average rat weight for the study is 208 g (0.208 kg).

Dosage of the herbalised alcoholic beverage administered is 0.2 mL/kg of 30% v/v ethanol beverage.

Volume administered per rat:

0.2 × 0.208 = 0.0416 mL beverage

Pure ethanol volume:

30% of 0.0416 mL = 0.01248 mL ethanol

Mass of ethanol:

Mass (g) = ethanol volume × density

Mass = 0.01248 mL × 0.789 g/mL = 0.00984672 g = 9.84672 mg ethanol.

Ethanol dose in mg/kg for the rat.

Dose (mg/kg) = ethanol mass (mg) ÷ rat weight (kg)

Dose = 9.84672 mg ÷ 0.208 kg = 47.34 mg/kg.

Human equivalent dose (using Km ratio 6/37)

HED (mg/kg) = Animal dose (mg/kg) × (K_m animal / K_m human)

= 47.34 × (6/37)

= 7.68 mg/kg

For a 60 kg human:

7.68 × 60 = 460.8 mg (0.461 g) ethanol

= 0.584 mL pure ethanol

= ∼1.95 mL of 30% v/v beverage

Weight determination

A sensitive digital weighing balance (SP 401, OHAUS, Parsippany, USA) was used to measure the rats’ weight weekly and after the 28-day treatment.

Sample collection

Weekly body weight measurements were recorded throughout the experimental period (days 0, 7, 14, 21 and 28). At the end of the 28-day treatment, animals were humanely euthanised with ketamine (75 mg/kg) and xylazine (10 mg/kg) administered intraperitoneally^43,44 followed by cervical dislocation. ⁴⁵ A 2-mL syringe was used to obtain blood via cardiac puncture in the rats’ left ventricle, which was then transferred to lithium heparinised anticoagulant bottles and centrifuged to obtain plasma for biochemical analysis. The plasma was collected into a well-labelled plain bottle and preserved at -20°C until analysis. ⁴⁶ The excised organs were fixed in 10% NBF for histopathological evaluation, while the samples for mRNA expression of Nrf2 and CYP2E1 were transferred into TRIzol and preserved at -70°C until required for analysis. ⁴⁷

Biochemical studies

Urea and creatinine estimation

Enzymatic colourimetric assays were used to measure urea levels following the techniques outlined by Orororo et al. ⁴⁸ while creatinine levels were estimated as described by Nwogueze et al. ⁴⁹

Liver enzymes estimation

The liver enzymes ALP, AST, and ALT were evaluated following the instructions provided in the diagnostic kits procured from Randox Laboratory Limited, United Kingdom. The activity of ALT was assessed by evaluating the concentration of pyruvate hydrazine generated with 2,4-dinitrophenylhydrazine at 546 nm, while AST was identified using the colourimetric measurement of hydrazine created with 2,4-dinitrophenylhydrazine. ⁵⁰ The ALP activity was estimated by the phenolphthalein monophosphate method at 405 nm.

Histopathological studies

The liver and kidneys were processed and stained using the Haematoxylin and Eosin (H & E) staining method. The organs were qualitatively assessed histologically using the Leica DM750 microscope for structural alteration, and photomicrographs were taken using a Leica Flexacam i5 photomicrograph device. ⁴⁷ Histopathological evaluation was performed on liver and kidney sections collected from all seven rats in each experimental group (n = 7 per group; total = 28 animals). Tissues were coded with randomly assigned identification numbers, and all slides were independently examined by Professor Ekundina Victor, a qualified anatomical histologist with documented expertise in experimental pathology, from the department of Medical Laboratory Science, College of Health Sciences, Afe Babalola University, Ekiti, Nigeria. The evaluator was fully blinded to the treatment group allocation. Histological alterations were described qualitatively, as no standardised numerical scoring system was applied-an acknowledged methodological limitation. Representative photomicrographs from three randomly selected animals per group are presented in Figures 7 and 8, while complete histological sets from all animals are available in supplemental Figure 4 (A-H).

Gene expression study

Total RNA isolation

The Quick-RNA MiniPrep™ Kit (Zymo Research) was used to isolate the Total RNA extracted from rat tissues, with DNA contamination eliminated through treatment with DNase I (NEB, Cat: M0303S). The A&E Spectrophotometer (A&E Lab. UK) was used to quantify the RNA at 260 nm and validate its purity at 260 and 280 nm.

cDNA conversion

Using a cDNA synthesis kit based on ProtoScript II first-strand technology (New England BioLabs), 1 μg of DNA-free RNA was converted into cDNA through a reverse transcriptase reaction following a three-step procedure: 5 minutes at 65 °C, 1 hour at 42 °C, and 5 minutes at 80 °C. ⁵¹

PCR amplification and agarose gel electrophoresis

The OneTaqR2X Master Mix (NEB) polymerase chain reaction (PCR) was utilised to amplify the target gene using the primers designed by Inqaba Biotec, Hatfield, South Africa. In this semi-quantitative analysis, a PCR reaction was performed in a total volume of 25 μl of reaction mixture consisting of the Ready Mix Taq PCR master mix, forward and reverse primers, and cDNA. Amplification was carried out for 30 cycles, including an initial denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 60 seconds. A final extension step was performed using an Eppendorf Mastercycler Hamburg at 72°C for 10 minutes. The amplicons were resolved on a 1.0% agarose gel. The relative gene expression levels were normalised to the GAPDH gene, and band intensity was quantified using the ImageJ software. ⁵¹ The primer sequences employed in this study are listed in Table 1. Semi-quantitative PCR using agarose gel electrophoresis and ImageJ densitometry was employed due to equipment constraints. While this supportive method provides relative quantification suitable for detecting substantial fold-changes when linearity is confirmed, it has inherent limitations compared with quantitative real-time PCR (qRT-PCR), which offers greater precision, wider dynamic range, and lower variability.

Table 1.

Primer sequence.

Gene	Forward primer sequence (5′–3′)	Reverse primer sequence (5′–3′)	Accession number	Approx. Tm (°C)	Annealing temperature (°C)	Primer size	Product size
CYP2E1	TGTTTCTGTGACTTTGGCCG	GCACCACAGCATCCATGTAG	NM_031543.2	60-62	55-60	20	200
Nrf2	AGAAGGAACAGGAGAAGGCC	CCACTGGTGTCTGTCTGGAT	NM_001399173.1	58-60	53-58	20	106
GAPDH	TGCACCACCAACTGCTTAGC	GGCATGGACTGTGGTCATGAG	NM_017008.4	60-62	60-62	20	143

Statistical analysis

Data were analysed using the GraphPad Prism version 10.4.2, and all values are expressed as mean ± standard deviation (SD). Group comparisons were performed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test for multiple pairwise comparisons, with adjustments applied to control for Type I error across multiple endpoints. For the body weight comparisons, weekly group mean weights (weeks 1, 2, 3, and 4; n = 4 time points per group) were analysed by one-way ANOVA, whereas all biochemical and gene expression analyses were performed on individual animal-level data (n = 7 per group). Statistical significance was defined a priori as α = 0.05 (two-tailed). Significant differences between experimental groups are denoted on the respective figures using appropriate symbols. Effect size for pairwise comparison and actual P-values for all parameters are provided in the supplemental Table 2. In accordance with the ARRIVE reporting guidelines, 95% confidence intervals for the primary outcomes are provided in the Supplemental Table S2.

Results

Biochemical findings

As shown in Figure 1(a–e), alkaline phosphatase (ALP) activity was significantly elevated in alcohol-exposed untreated rats (group II) compared with the unexposed control group (group I) (p < 0.0001). Treatment with vitamin C and vitamin E markedly reduced ALP levels (p < 0.0001) relative to group II (Figure 1(a)). Plasma ALT activity was also significantly increased in group II compared with the control group I (p < 0.0001). Supplementation with vitamin C (p < 0.0001) or vitamin E (p < 0.0001) significantly reduced ALT activity; furthermore, a significantly reduced ALT level was observed in the Vitamin E treatment when compared to Vitamin C (p < 0.001) (Figure 1(b)). AST levels were observed to be significantly increased in the alcohol exposed untreated rats when compared to the unexposed control group (p<0.01). The supplementation with either vitamin C or Vitamin E significantly reduced AST levels (p < 0.0001) when compared to the alcohol exposed untreated rats, with no significant reduction observed in the AST levels in rats treated with either supplement (p>0.05) (Figure 1(c)). Similarly, plasma creatinine levels were significantly increased in group II relative to group I (p < 0.0001). Both vitamin C and vitamin E treatments significantly reduced creatinine levels (p < 0.0001) compared to group II (Figure 1(d)). A highly significant elevation in plasma urea levels was observed in the alcohol-exposed untreated rats (group II) compared with the control (group I) (p < 0.0001). Treatment with vitamin C and vitamin E markedly reduced urea concentrations (p < 0.0001), with no significant differences between the two vitamin-treated groups (p > 0.05) (Figure 1(e)).

Figure 1.

Hepatorenal biochemical parameters in alcohol-exposed rats following antioxidant interventions.

mRNA expression studies

The CYP2E1and Nrf2 expression levels in the liver and kidneys of rats across the different groups are displayed in Figures 2–5.

Figure 2.

The effect of treatment paradigms on renal CYP2E1 mRNA expression in experimental animals.

Figure 3.

The effect of treatment paradigms on hepatic CYP2E1 mRNA expression in experimental animals.

Figure 4.

The effect of treatment paradigms on renal Nrf-2 mRNA expression in experimental animals.

Figure 5.

The effect of treatment paradigms on hepatic Nrf-2 mRNA expression in experimental animals.

Effect of vitamin C and vitamin E supplementation on renal CYP2E1 expression

As shown in Figure 2, alcohol exposure resulted in a marked upregulation of CYP2E1 expression in the kidneys of group II rats compared to the control group I (p < 0.0001). Supplementation with vitamin C and E resulted in CYP2E1 expression levels that were significantly elevated compared to the unexposed control (p < 0.0001) and significantly reduced compared to the alcohol exposed untreated rats (p < 0.0001). The difference between the vitamin C and vitamin E treated groups was also statistically significant (p < 0.0001) (Figure 2).

Effect of vitamin C and vitamin E supplementation on hepatic CYP2E1 expression

As shown in Figure 3, alcohol exposure led to a significant upregulation of CYP2E1 expression in the liver of untreated group II rats compared with the control group (p < 0.001). Supplementation with vitamin C and E resulted in CYP2E1 expression levels that were significantly elevated compared to the unexposed control (p<0.0001) and significantly reduced compared to the alcohol exposed untreated rats (p<0.0001). Supplementation with vitamin C significantly reduced hepatic CYP2E1 expression (p < 0.0001), and vitamin E showed a numerically greater reduction. The difference in CYP2E1 suppression between the two antioxidant treatments was statistically significant (p<0.0001), indicating comparable modulatory effects.

Effect of vitamin C and vitamin E supplementation on renal NRF2 expression

As shown in Figure 4, Nrf2 expression levels were significantly elevated in the kidneys of alcohol-exposed untreated group II rats compared with the unexposed control group I (p < 0.0001). Supplementation with vitamin C and E resulted in Nrf2 expression levels that were significantly elevated compared to the unexposed control (p<0.0001) and significantly reduced compared to the alcohol exposed untreated rats (p<0.0001). Significant difference was observed between the vitamin C and vitamin E-treated groups (p < 0.0001).

Effect of vitamin C and vitamin E supplementation on hepatic NRF2 expression

Nrf2 levels were significantly upregulated in group II compared to the control (p < 0.0001, Figure 5). The supplementation with vitamin C and E resulted in Nrf2 expression levels that were significantly elevated compared to the unexposed control (p<0.0001) and significantly reduced compared to the alcohol exposed untreated rats (p<0.0001). Significant difference was observed between the vitamin C and vitamin E treated groups (p < 0.0001). This pattern indicates that ethanol-induced oxidative stress elevates Nrf2 expression, consistent with a reduction in Nrf2 following vitamin C and E supplementation, likely reflecting attenuation of the underlying redox imbalance rather than a direct modulatory effect. These semi-quantitative gene expression findings should be interpreted as supportive evidence consistent with, but not confirmatory of, oxidative stress modulation.

Physical changes

The weight distribution across the weeks in the various groups is shown in Figure 6. Compared with the unexposed control rats (Group I), the alcohol-exposed untreated rats (Group II) showed a significant reduction in body weight (p < 0.001). However, treatment with vitamin C (500 mg/kg bw) or vitamin E (300 mg/kg bw) significantly improved weight gain compared to the untreated alcohol-exposed group II rats (p < 0.05). Supplementation with either vitamin C or vitamin E (Groups III and IV) improved weight gain, with no significant difference from the control by Week 4 (p> 0.05).

Figure 6.

The mean weight of experimental animals across the treatment period.

Histopathological findings

Liver histopathology

The liver of the control rats (group I) was devoid of pathological lesions, as the portal tracts and sinusoidal spaces were devoid of inflammation and congestion, with hepatocytes appearing normal (Figure 7(a)). However, the alcohol-exposed untreated rats (group II) had periportal inflammation with dilated and congested sinusoids (Figure 7(b)). The liver of the vitamin C-treated rats (group III) showed an improved histoarchitecture compared to the alcohol-exposed untreated rats, as sinusoids were mildly congested with no evident periportal inflammation (Figure 7(c)). The vitamin E-treated rats (group IV) had congested venules with mild periportal inflammation, Kupffer cell activation, and sinusoidal congestion (Figure 7(d)).

Figure 7.

Representative photomicrograph of liver sections from experimental rats stained with Haematoxylin and Eosin (H&E, x100).

Kidney histopathology

The kidneys of the unexposed control (group I) rats had normal-appearing glomeruli and renal tubules with non-congested or inflamed interstitium (Figure 8(a)). The alcohol-exposed, untreated rats (group II) had a congested interstitium with mononuclear infiltration by inflammatory cells. Mesangial hyperplasia of the glomerulus was also evident (Figure 8(b)). The vitamin C-treated rats (group III) had reduced inflammation, with the glomerulus showing improved histoarchitecture compared to the alcohol-exposed untreated rats (Figure 8(c)). The vitamin E-treated rats (group IV) had congested and inflamed interstitium coupled with mesangial hyperplasia (Figure 8(d)).

Figure 8.

Representative photomicrograph of kidney sections from experimental rats stained with Haematoxylin and Eosin (H&E, x100).

Discussion

Ethanol exposure is widely known to induce oxidative stress through increased ROS generation, lipid peroxidation, and depletion of antioxidant enzymes. ⁵² Plant-derived extracts rich in polyphenols, such as cinnamon, chamomile, thyme, and citrus peel, have consistently demonstrated antioxidant rather than pro-oxidant effects in alcohol-exposed models. As reported in literature, Cinnamon oil (Oleum cinnamomi) pre-treatment in ethanol-administered rats significantly reduced gastric lesion indices, decreased MDA, and restored catalase and superoxide dismutase (SOD) activity. ⁵³ Similarly, chamomile decoction decreased ROS production in neutrophils and mitigated erythrocyte oxidative damage in alcohol-exposed rodents. ⁵⁴ Furthermore, citrus peel flavonoids, such as hesperidin and naringenin, upregulate Nrf2 signalling, enhance endogenous antioxidant enzymes, and have been reported to alleviate alcohol-induced hepatic oxidative injury.^55,56 These findings are not in tandem with the results obtained in our alcohol-exposed, untreated groups. However, morphological changes have been reported to be seen at high doses or with prolonged exposure to some of these extracts. Reports by Rojas-Armas et al. ⁵⁷ found that 28-day oral administration of thyme essential oil at doses up to 500 mg/kg/day in rats caused lung tissue damage, such as inflammation and interstitial thickening. Higher doses (20 mg/kg) of thymol combined with carvacrol decreased sperm concentration and motility compared to the control group. ⁵⁸ Chamomile is generally safe but may cause mild hepatotoxicity, nephrotoxicity, and allergic reactions at extremely high concentrations (>1000 mg/kg) or long durations. ⁵⁹ Abraham et al. ⁶⁰ showed that chronic Cassia cinnamon use in rats led to elevated liver enzymes and histopathological signs of hepatic injury (hepatocellular necrosis, especially centrilobular, kupffer cell hyperplasia). Yun et al. ⁶¹ also reported that in both male and female rats, administration of 2000 mg/kg of Cinnamomum cassia extract led to increases in liver and kidney weights, as well as elevated total cholesterol levels. These studies suggest their protective effects are dose-dependent, with potential adverse effects at higher concentrations or in combination with other compounds.

The 0.2 ml/kg of Orijin Bitters used in this study was selected to model low-level exposure typical of human consumption patterns, equivalent to approximately 0.5 g ethanol/day in a 60 kg adult after body surface scaling using the FDA body surface area conversion. ⁶² This level avoids acute intoxication yet is sufficient to elicit oxidative and histopathological responses documented in previous studies,^2,38,63 thereby providing translational relevance for habitual scenarios. In this study, the observed attenuation of hepatorenal biomarkers in vitamin-supplemented rats is consistent with the established antioxidant properties of vitamins C and E, which are known to scavenge ROS and support endogenous antioxidant defences. ⁵³ However, direct measurement of oxidative stress markers (lipid peroxidation, glutathione status, antioxidant enzyme activities) was not performed in the current study, and the contribution of bioactive herbal phytochemicals present in the test beverage cannot be excluded. No additional phytochemical extracts were used; thus, the observed protective effect can be reasonably attributed to these vitamins. The selected doses of 500 mg/kg vitamin C and 300mg/kg vitamin E were based on prior studies demonstrating their efficacy in mitigating oxidative stress in ethanol-induced organ toxicity models in rats, i.e. 250-500 mg/kg for vitamin C; 100-400 mg/kg for vitamin E.^64–70 When converted to human equivalent doses, it corresponds to pharmacological, but non-toxic, levels used in clinical antioxidant therapy. Thus, providing translational relevance while ensuring safety within the experimental design. Physiologically, the liver and kidneys are vital organs that are crucial for metabolism and maintaining bodily homeostasis. Despite each organ having a distinct role, cooperatively, they compensate for some biological regulation.^14,25

The rising uncontrolled consumption of alcoholic beverages in Nigeria, often driven by perceived medicinal benefits, poses serious health risks. Excessive intake generates ROS, leading to toxicity and contributing to conditions such as liver disease, kidney failure, brain damage, and various cancers, which were earlier neglected by its consumers.^4,71–73 As reported in literature, chronic ethanol exposure induces excessive generation of ROS primarily through the hepatic microsomal enzyme CYP2E1, leading to oxidative stress, lipid peroxidation, and depletion of endogenous antioxidants.^74,75 These redox imbalances suppress the Nrf2 signalling pathway, impairing the transcription of cytoprotective and detoxifying enzymes such as heme oxygenase-1 (HO-1) and glutathione peroxidase (GPx).^76,77 To counteract these effects, vitamin E (300 mg/kg b.w.) and vitamin C (500 mg/kg b.w.) were selected based on doses shown in rodent models to modulate ethanol-induced oxidative injury through upregulation of the Nrf2 pathway and downregulation of CYP2E1 expression in hepatic and renal tissues. Vitamin E, a lipid-soluble antioxidant, stabilises cellular membranes and inhibits CYP2E1-mediated lipid peroxidation, whereas vitamin C, a water-soluble antioxidant, not only scavenges ROS but also regenerates oxidised α-tocopherol, maintaining its activity within the antioxidant network. Collectively, these doses have been demonstrated to restore redox balance, normalise antioxidant enzyme expression, and attenuate histopathological damage following chronic ethanol exposure. An important interpretive consideration is that the protective effects observed in this study cannot be definitively attributed solely to vitamins C and E. The herbal alcoholic beverage (Orijin Bitters) contains multiple plant-derived compounds, including extracts of citrus peel (naartjie/orange), chamomile, thyme, and cinnamon, many of which possess well-documented antioxidant, anti-inflammatory, and hepatoprotective properties.^53,54 Studies have reported that citrus peel flavonoids (hesperidin, naringenin) upregulate Nrf2 signalling and enhance endogenous antioxidant enzymes,^55,56 chamomile components reduce ROS production and oxidative damage, ⁵⁴ thyme essential oil exhibits antioxidant activity, ⁵⁷ and cinnamon compounds modulate oxidative stress pathways. ⁵³ The present study design does not include: (1) a pure ethanol control group to isolate alcohol-specific effects from herbal component effects, (2) independent chemical characterisation of the beverage’s phytochemical composition and concentrations, (3) measurement of phytochemical absorption or tissue accumulation, or (4) control groups receiving vitamins without alcohol exposure to assess baseline vitamin effects. Consequently, the observed attenuation of hepatorenal biomarkers and modulation of CYP2E1/Nrf2 expression could have resulted from the direct antioxidant effects of supplemented vitamins or synergistic interactions between vitamins and herbal phytochemicals present in the beverage, combined modulation of CYP2E1 activity by both vitamins and herbal compounds, effects of vitamins on phytochemical metabolism or bioavailability, or complex interactions within the multi-component matrix that cannot be deconvoluted without additional experimental controls. This fundamental design limitation limits mechanistic interpretation and prevents definitive attribution of protective effects solely to vitamin supplementation, rather than to potential contributions from herbal beverage components or vitamin-phytochemical interactions. Future studies should employ pure ethanol controls and comprehensive phytochemical characterisation to isolate vitamin-specific protective mechanisms. Furthermore, studies have demonstrated that ethanol’s metabolic pathways can produce intermediate toxic metabolites, including free radicals and acetaldehyde, which impair the antioxidant defence system by depleting S-adenosylmethionine and mitochondrial glutathione. This results in increased lipid peroxidation, which can adversely impact the hepatorenal system.^19,78 ALT and AST are the most often utilised enzymes to evaluate hepatocellular injury, with an increase in ALP levels indicating liver disease. ⁷⁹ Exposure to the herbalised alcoholic beverage led to elevated creatinine and urea levels across all groups, further reiterating its deleterious effects on the renal system. ⁸⁰ The administration of vitamin C and vitamin E partially restored the altered biochemical parameters in this study. Reports have documented that vitamin E reduces transaminase activities and, in combination with other antifibrotic agents, can demonstrate synergistic therapeutic effects in ameliorating non-alcoholic steatohepatitis (NASH). ²⁰ Consistent with Vasei et al. ⁸¹ , this study shows that vitamin E is associated with the amelioration of alcohol-induced hepatorenal toxicity, as evidenced by improvements in hepatorenal parameters and modulation of oxidative stress–related genes. Findings also suggest that vitamin C and vitamin E supplementation may be associated with partial attenuation of alcohol-related hepatorenal biochemical alterations. However, definitive mechanistic conclusions require direct oxidative stress measurements and experimental designs that isolate vitamin-specific effects from potential contributions of herbal beverage components. Earlier studies by Al-Garea et al. ⁸² reported elevated AST, ALT, and ALP levels in alcohol abusers with treatments with vitamin C, leading to a reduction in these markers. Consistent with the findings in this study, a significant reduction in AST, ALT, and ALP levels was observed in alcohol-exposed rats supplemented with ascorbate at 500 mg/kg/bw. Furthermore, studies by Udi et al. ⁸³ also reported the ameliorating role of vitamin C in paracetamol-induced hepatotoxicity. Findings by Sandoval et al. ³⁷ indicated that vitamin E has a hepatoprotective impact in rat models that includes reduced TNF-α production, decreased nuclear factor-kappa B activation, membrane stability, and suppressed hepatic stellate cell activation. The mRNA expression studies further provide insight into further understanding the pathway of damage and repair to the liver and kidney cells, utilising the CYP2E1 and Nrf2 expression study. In this study, the administration of the herbalised alcoholic beverage at the administered dosage upregulated CYP2E1 expression levels in the studied organs. Studies have shown that daily ethanol administration at a low dose of approximately 40 g over four weeks significantly induces CYP2E1 expression. Consistent with these findings, the present study demonstrated a comparable induction even at a substantially lower dose (<2 g), indicating that minimal ethanol exposure can still upregulate CYP2E1 activity. ⁸⁴ This ethanol level is considerably below the average consumption reported in the United States, Europe, and African countries, indicating that even minimal ethanol exposure can upregulate CYP2E1 and promote oxidative stress in hepatorenal tissues. Alcohol metabolism involves ADH, catalase, and the cytochrome P450 (MEOS) pathway, where CYP2E1 plays a key role by generating ROS during oxidative metabolism, thereby linking alcohol metabolism to oxidative stress. Numerous oxidative metabolic activities requiring NADPH are catalysed by CYP2E1, and free radical species are produced when oxygen is not completely reduced.^85–87 The CYP2E1 levels were significantly upregulated in alcohol-exposed untreated rats, corresponding with impaired liver function and histopathological alterations in hepatic and renal tissues, consistent with mechanisms involving oxidative stress as earlier reported in literature.^75,76 The findings from this study validated these claims as both the liver and kidneys showed upregulation in the CYP2E1 levels in all alcohol-exposed rats relative to the unexposed control. The semi-quantitative mRNA expression findings in this study indicate supportive evidence consistent with, but not confirmatory of oxidative stress modulation.

Cytochrome P450 enzymes (CYP), key components of the microsomal ethanol-oxidising system (MEOS), are major sources of hepatic ROS and are implicated in the development of alcoholic liver disease. Elevated CYP2E1 expression in the liver and kidneys significantly explains some of the negative consequences of this oxidative pathway.^36,88 Although it is found in nearly every tissue, CYP2E1 is predominantly in the liver. However, since the kidney expresses only a tenth of the body’s cytochrome P450, it is pertinent to note that the kidney, like the liver, metabolises circulating ethanol with the local generation of damaging ROS that can bind to DNA to form highly carcinogenic etheno-DNA-adducts, which is a crucial factor in triggering ethanol-mediated carcinogenesis.^36,89 Although mRNA expression analysis demonstrated a significant downregulation of CYP2E1 in the liver and kidneys following vitamin C and vitamin E supplementation, expression levels did not fully revert to baseline values observed in the unexposed control group. This incomplete reversal may reflect a dose-dependent modulatory effect of the administered antioxidants on CYP2E1 transcriptional regulation. A previous report by Carrasco et al. ⁹⁰ demonstrated enhanced ethanol clearance after two weeks of vitamin C pretreatment (2–5 g daily), highlighting its role in ethanol oxidation. However, despite its antioxidant benefits, vitamin C levels in habitual drinkers may require up to three months to normalise after alcohol reduction or cessation. ⁹¹

Several studies have indicated Nrf-2 as a vital cellular defender, playing a key role in regulating lipid peroxidation and protecting cells from its damaging effects.^92–94 More significantly, oxidative stress alters pathways that regulate regular biological processes in addition to causing irreversible changes in lipids, proteins, and DNA contents, which results in liver damage. Keap1 mediates the first pathway of Nrf2 activation, while glycogen synthase kinase 3β (GSK3β) mediates the second. Both processes are thought of as two valves that regulate Nrf2’s nuclear availability. ⁹³ Due to its crucial involvement in the pathophysiology of several kidney disorders, oxidative stress has also been linked to renal distress.^95,96 In this study, Nrf2 expression was upregulated in the liver and kidneys following alcohol exposure, reflecting a compensatory cellular response to oxidative stress. Treatment with either vitamin C or vitamin E further enhanced Nrf2 expression relative to the control. This finding suggests that while ethanol-induced oxidative stress activates Nrf2 as an adaptive defence mechanism, antioxidant supplementation can augment this pathway, thereby restoring redox balance and enhancing cellular resilience. The differential response between the two antioxidants observed in this study underscores the dose- and compound-specific regulation of Nrf2 in mitigating alcohol-induced hepatorenal injury. Furthermore, several studies have shown that activation of the Nrf2 signalling pathway mitigates hepatorenal damage, underscoring its protective role. Previous research reported that the livers of Nrf2-activated mice exhibit increased expression of antioxidant defence genes. Consistent with these findings, the present study observed elevated Nrf2 levels in vitamin-treated rats, aligning with the report of Wu et al., ⁹⁷ who demonstrated that Nrf2 activation prevents alcohol-induced oxidative stress by upregulating genes involved in antioxidant defence. These semi-quantitative gene expression findings provide supportive, but not definitive, evidence of oxidative stress modulation. From a clinical perspective, Nrf2 represents a critical therapeutic target due to its pharmacological modifiability. Its transcriptional activity is primarily regulated by the E3 ubiquitin ligase adaptor Kelch-like ECH-associated protein 1 (KEAP1), which controls Nrf2 protein stabilisation activity. ⁹⁸ Moreover, Nrf2 has emerged as one of the first molecular targets broadly adopted in both traditional and systems medicine for drug development and therapeutic repurposing, given its central role in multiple mechanistically linked disease processes. It is suggestive that the immunomodulatory effects of vitamin C and vitamin E observed in this study may, in part, operate through Nrf2 activation, which enhances the expression of antioxidant enzyme genes such as HO-1, SOD, and GPx, which are essential enzymes for ROS neutralisation and the reduction of oxidative stress, thereby mitigating inflammation.^14,99 This study also demonstrated that vitamin C and E supplementation upregulated Nrf2 expression, consistent with the reports of Lee et al., ¹⁰⁰ Ju et al., ¹⁰¹ and Hammad et al., ¹⁰² who highlighted the pivotal role of Nrf2 in mitigating oxidative and nitrosative stress. As reported in literature, Nrf2 exerts intricate, multicellular regulatory effects in hepatic inflammation, fibrosis, hepatocarcinogenesis, and tissue regeneration by activating target genes that suppress proinflammatory pathways, enhance endogenous antioxidant responses, and modulate inflammatory cell recruitment.^14,103,104 Wu et al., ¹⁰⁵ reported that vitamin C modulates the Nrf2/Keap1 signalling pathway, thereby suppressing hepatic GRP78 expression and mitigating endoplasmic reticulum stress and apoptosis induced by hypoxia. It also reduces oxidative damage, inflammation, and apoptosis associated with acute hypoxic conditions. This study’s improvement of alcohol-induced hepatorenal toxicity is consistent with research by Oyesola et al., ¹⁰⁶ which showed that vitamin C lowered chronic low-grade inflammation. Overall, findings suggest that vitamin supplementation is associated with altered expression of oxidative stress-related genes (CYP2E1 and Nrf2) and reduced hepatorenal biochemical abnormalities in alcohol-exposed rats. While these findings are consistent with antioxidant-mediated protective mechanisms, direct causative pathways remain to be fully elucidated through studies incorporating direct oxidative stress measurements and appropriate experimental controls.

Histopathological evaluation in this study revealed that administration of the herbalised alcoholic beverage induced hepatic congestion, sinusoidal dilatation, and periportal inflammation. However, treatment with vitamin C attenuated these alcohol-induced lesions when compared to the alcohol-exposed untreated rats. Vitamin C has shown protective properties against harmful chemicals and offers hepatocytes cytoprotective and antioxidant activities.^27,82 Oxidative stress has been identified as a common pathogenic mechanism that contributes to the development and progression of liver injury. ¹⁰⁷ In the liver, parenchymal cells are the main cells that sustain damage from oxidative stress. ROS production by parenchymal cells’ mitochondria, microsomes, and peroxisomes can control PPARα, which is primarily linked to the expression of the liver fatty acid oxidation gene. Furthermore, oxidative stress triggers Kupffer cells to produce various cytokines, including TNF-α, which enhances inflammation and apoptosis. As a result, hepatic stellate cells, Kupffer cells, and endothelial cells may be more susceptible to oxidative stress-associated molecules.^23,107 Consequently, treatment with vitamin E at 300 mg/kg bw was less effective, as the kidneys of treated rats exhibited interstitial congestion and inflammation. Adeyemi and Akinwande, ¹⁰⁸ reported that repeated exposure to alcoholic bitters compromises renal cellular integrity. Similarly, other studies have shown that even moderate alcohol consumption can cause glomerular hypertrophy, mononuclear cell infiltration, and glomerular congestion, which are features indicative of mild nephritis that cause damage leading to kidney injury. ¹⁰⁹ The generation of free radicals and the resulting disruption of redox balance, which promoted cytopathic alterations in the examined organs, highlight the deleterious effects of alcohol observed in this study. Early suppression of lipid peroxidation and free radical formation may therefore mitigate organ toxicity. As observed in this study, vitamin C and vitamin E supplementation attenuated alcohol induced hepatorenal toxicity.^2,6,110 Research has also shown that alcohol disrupts the body’s nutritional status and exacerbates oxidative stress. ¹¹¹ Chronic kidney disease is characterised by persistent low-grade inflammation and oxidative stress, driven by uremic toxin accumulation, cellular degeneration, and impaired metabolic function. These alterations disrupt interorgan redox homeostasis and detoxification processes.^3,112,113 In this study, untreated rats exposed to herbalised alcoholic beverage exhibited pronounced renal histopathological alterations, including interstitial congestion, mononuclear inflammatory cell infiltration, and mesangial hyperplasia. These findings corroborate previous reports by Dawodu et al., ¹¹⁴ Kondeti Ramudu et al., ¹¹⁵ and Dic-Ijiewere and Osadolor, ¹¹⁰ who similarly documented the nephrotoxic effects of alcohol. Treatment with vitamin C ameliorated these lesions, as evidenced by reduced inflammation and improved glomerular architecture relative to untreated alcohol-exposed animals. Notably, interstitial congestion was absent following vitamin C supplementation at 500 mg/kg bw for four weeks. This observation aligns with the findings of Lim et al. ⁹¹ who reported the protective role of vitamin C. Furthermore, studies by Kongkham et al. ¹¹⁶ demonstrated that vitamin E affords renal protection against contrast-induced nephropathy in rats with pre-existing kidney injury. Conclusively, the findings from this in vivo study collectively highlight the significant hepato- and renoprotective potential of vitamins C and E in mitigating alcohol-induced toxicity in a murine model. Their administration attenuated oxidative damage and biochemical derangement, suggestive of their potential adjunctive role in counteracting alcohol-related hepatic and renal dysfunction.

Strengths and limitations

This study’s strengths include its integrative approach combining molecular (gene expression), biochemical (hepatorenal function markers), and histopathological assessments; adherence to ARRIVE guidelines with documented randomisation, blinding, and welfare monitoring; use of standardised animal models and validated measurement techniques; and provision of human equivalent dose calculations to support translational interpretation. However, several significant limitations must be acknowledged:

Oxidative stress assessment

The most significant limitation is that direct oxidative stress markers were not measured. The study infers oxidative stress from gene expression changes (CYP2E1, Nrf2) without biochemical validation through measurement of lipid peroxidation products (malondialdehyde, 4-hydroxynonenal), glutathione status (GSH/GSSG ratio), antioxidant enzyme activities (superoxide dismutase, catalase, glutathione peroxidase), protein oxidation markers (protein carbonyls), or DNA oxidation markers (8-hydroxy-2′-deoxyguanosine). This represents a fundamental methodological gap that restricts mechanistic interpretation and prevents direct confirmation that the observed gene expression changes reflect actual oxidative stress status or that vitamin supplementation reduces oxidative damage at the molecular level.

PCR methodology

Semi-quantitative PCR using agarose gel electrophoresis and ImageJ densitometry was employed instead of quantitative real-time PCR (qRT-PCR). While linearity was confirmed across dilution series and single specific products were verified, this approach provides lower precision, a narrower dynamic range, and greater inter-assay variability compared to qRT-PCR with validated reference genes and efficiency-corrected quantification. Fold-change values should be interpreted as estimates of relative expression differences rather than exact quantitative measurements. In addition, the absence of retained original raw gel image files from the performing laboratory represents a further methodological limitation, restricting independent verification of band integrity and densitometric analysis.

Product characterisation and confounding

The herbal alcoholic beverage was not independently characterised by chemical analysis (e.g., HPLC-MS), preventing verification of the manufacturer’s stated ethanol content (30% v/v), quantification of specific phytochemical constituents and their concentrations, detection of potential contaminants or undeclared compounds, and assessment of batch-to-batch variability in composition. Critically, the beverage contains herbal extracts (citrus peel, chamomile, thyme, and cinnamon) with documented antioxidant, anti-inflammatory, and hepatoprotective properties. The absence of a pure ethanol control group and vitamin-only control groups (no alcohol exposure) confounds attribution of protective effects specifically to vitamins C and E versus contributions from herbal phytochemicals or synergistic vitamin-phytochemical interactions. This fundamental design limitation prevents isolation of vitamin-specific mechanisms.

Experimental design limitations

The study exclusively utilised male rats, thereby inhibiting the evaluation of potential sex differences in alcohol metabolism, oxidative stress responses, or vitamin protective effects. Single dose levels were tested for both alcohol exposure (0.2 mL/kg) and vitamin supplementation (ascorbate 500 mg/kg, α-tocopherol 300 mg/kg), preventing evaluation of dose-response relationships or identification of optimal protective doses. No co-administration group receiving combined vitamins C+E was included to assess potential synergistic or additive effects. The relatively short exposure duration (28 days) models subacute rather than chronic alcohol exposure and may not capture long-term cumulative effects or adaptive responses.

Histopathological assessment

Histological evaluation was performed qualitatively without standardised scoring systems (e.g., Kleiner scoring for steatohepatitis, Banff criteria for renal pathology), limiting quantitative assessment of lesion severity, statistical comparison of histological parameters across groups, and reproducibility validation through inter-rater reliability testing. While blinding was implemented to reduce bias, the absence of systematic scoring restricts the strength of histological conclusions.

Statistical considerations

Sample size (n=7 per group) was determined by power analysis assuming a medium-to-large effect size (Cohen’s f ≈ 0.40). More minor but biologically meaningful effects may not be detectable with this sample size. Multiple statistical comparisons were performed (4 groups × 5 biochemical parameters × 4 gene expression measurements = numerous comparisons), and while Tukey HSD adjustment was applied, the increased type I error risk should be acknowledged. Effect sizes and 95% confidence intervals are provided to aid interpretation beyond p-values alone.

Mechanistic interpretation

This study demonstrates statistical associations between vitamin supplementation and improved hepatorenal parameters but cannot establish causation or elucidate mechanistic pathways without direct measurement of oxidative stress markers to confirm redox modulation, measurement of vitamin tissue concentrations and bioavailability, assessment of CYP2E1 enzyme activity (not just mRNA expression), measurement of Nrf2 target gene products (e.g., HO-1, NQO1 proteins), temporal analysis of biomarker changes throughout the exposure period, and mechanistic interventions (e.g., CYP2E1 inhibitors, Nrf2 activators/inhibitors) to establish causal pathways.

Translational limitations

Rat alcohol metabolism differs substantially from human metabolism in terms of ADH/ALDH isoenzyme expression patterns, CYP2E1 inducibility, and first-pass metabolism. The doses used represent pharmacological rather than physiological supplementation levels when scaled to human equivalents. Controlled laboratory conditions with standardised diets, ad libitum feeding, and the absence of other exposures do not reflect real-world human alcohol consumption patterns, nutritional status variability, or co-exposures (e.g., smoking, medications, or other substances). The herbal alcoholic beverage studied is region-specific (Nigeria), and findings may not generalise to other alcoholic drinks, pure ethanol, or different herbal formulations. These limitations collectively restrict mechanistic interpretation and warrant cautious extrapolation of findings. The study provides preliminary evidence for associations between vitamin supplementation and attenuated alcohol-related hepatorenal injury, but definitive mechanistic conclusions and clinical translation require additional investigation addressing the identified gaps.

Conclusion

This study demonstrates that supplementation with vitamin C (500 mg/kg) or vitamin E (300 mg/kg) in rats exposed to a herbal-based alcoholic beverage (30% v/v ethanol with plant extracts) is associated with: (1) significant attenuation of alcohol-induced elevations in hepatorenal biochemical markers (ALP, ALT, AST, creatinine, urea) compared to untreated alcohol-exposed controls, (2) reduced histopathological alterations in liver and kidney tissues including decreased hepatic congestion, sinusoidal dilation, periportal inflammation, and renal interstitial inflammation, and (3) modulation of oxidative stress-related gene expression with attenuation of alcohol-induced upregulation of CYP2E1 (a key enzyme in alcohol metabolism and ROS generation) and partial normalization of Nrf2 (a master regulator of antioxidant response) expression levels in both hepatic and renal tissues.

These findings are consistent with the established biological properties of vitamins C and E as antioxidants that neutralise ROS, support endogenous antioxidant defence systems, and protect against oxidative tissue damage. The observed modulation of CYP2E1 and Nrf2 expression suggests that vitamin supplementation may influence oxidative stress-related signalling pathways activated during alcohol exposure. However, several critical limitations restrict mechanistic interpretation and clinical extrapolation. Most importantly, oxidative stress was inferred from gene expression changes without direct measurement of oxidative stress markers (lipid peroxidation, glutathione status, antioxidant enzyme activities), preventing biochemical confirmation of redox modulation. Additionally, the herbal alcoholic beverage contains bioactive phytochemicals with documented antioxidant properties (citrus, chamomile, thyme, and cinnamon extracts), and the absence of pure ethanol controls or independent phytochemical characterisation prevents definitive attribution of protective effects solely to vitamin supplementation versus contributions from herbal components or vitamin-phytochemical interactions. The use of semi-quantitative rather than quantitative PCR, qualitative histological assessment without standardised scoring, and the absence of vitamin-only control groups further limit the strength of mechanistic conclusions. Within these constraints, the data provide preliminary evidence supporting the biological plausibility of vitamins C and E as potential adjunctive interventions to attenuate alcohol-related hepatorenal biochemical alterations and modulate oxidative stress-related gene expression. These findings warrant continued investigation with more rigorous methodology including: direct measurement of oxidative stress markers (MDA, GSH/GSSG, SOD, CAT, GPx activities) to confirm redox mechanisms, use of pure ethanol controls to isolate vitamin-specific effects from herbal beverage components, comprehensive phytochemical characterization of the test beverage, quantitative real-time PCR for precise gene expression quantification, standardized histopathological scoring systems, vitamin-only control groups to assess baseline effects, dose-response studies to identify optimal protective doses, assessment of vitamin tissue bioavailability and pharmacokinetics, measurement of CYP2E1 enzyme activity and Nrf2 target proteins to confirm functional consequences of gene expression changes, extended exposure durations to model chronic alcohol consumption, and inclusion of both sexes to assess generalizability.

In summary, this study provides hypothesis-generating preliminary evidence that vitamin C and E supplementation are associated with attenuated indicators of hepatorenal injury in alcohol-exposed rats, potentially mediated by modulation of oxidative stress-related gene expression. However, the identified methodological limitations prevent definitive mechanistic conclusions, and robust validation through studies incorporating direct oxidative stress measurements and appropriate experimental controls is necessary before clinical translation or therapeutic recommendations can be considered.

Supplemental material

Supplemental material - Ascorbate and alpha-tocopherol attenuate hepatorenal injury and modulate CYP2E1 and Nrf2 expression in rats exposed to herbalised alcoholic beverage

Supplemental material for Ascorbate and alpha-tocopherol attenuate hepatorenal injury and modulate CYP2E1 and Nrf2 expression in rats exposed to herbalised alcoholic beverage by Temidayo Daniel Adeniyi, Akinpelu Moronkeji, Godwin Olawoyin Adunmo, Adetokunbo Adedotun Okunnuga, Olayinka Joshua Ajala, Abiodun Oyeleke, Puritan Chinonso Umeboro and Oluwatimilehin Kemisola Thomas in Human & Experimental Toxicology