Abstract
Bortezomib (BTZ) is a first-generation proteasome inhibitor with anti-tumor properties for multiple myeloma and mantle cell lymphoma. Increasing evidence has shown that BTZ exhibits toxic effects on diverse tumor cells, including non-small cell lung cancer (NSCLC) cells. However, the mechanism has not been fully evaluated. Here, we examined the regulatory effect of BTZ on cellular senescence, a potent tumor suppressive mechanism, in NSCLC cell lines. SA-β-gal staining assay showed that BTZ caused a significant increase in β-Gal positive A549 cells. BTZ also induced cell cycle arrest on G0/G1 phase in A549 cells. Furthermore, telomerase activity was markedly reduced in A549 cells treated with BTZ. BTZ reduced the expression levels of hTERT, and the key proteins binding to telomeric DNA, including POT1 and TIN2. It also induced the expressions of the cell cycle-associated tumor suppressors p53 and p21 in A549 cells. Moreover, hTERT overexpression abolished the effects of BTZ on A549 cells. These results show that BTZ induced cellular senescence by stimulating telomere shortening. Our results provide experimental data for the potential clinical application of BTZ in NSCLC treatment.
Keywords
Introduction
Non-small cell lung cancer (NSCLC) is the most common subtype of lung cancer, and a common cause of cancer-related death worldwide. 1 Although sophisticated therapies for NSCLC are required to improve clinical outcomes, significant challenges remain in patients with advanced-stage NSCLC, with an estimated 1.6 million deaths each year. 2 Better approaches to targeted therapy, immunotherapy, and new drugs are warranted.
Cellular senescence is characterized by the irreversible arrest of cell growth/proliferation. 3 It has been established that the p53/p21 and p16INK4a/pRB pathways, two major tumor suppressor pathways, are recognized to engage the senescence response. 4 Thus, cellular senescence is widely considered a formidable barrier and potent tumor-suppressive mechanism for malignant tumorigenesis.
Proteasomes are identified as large protein complexes with multicatalytic properties that are responsible for cleaving cellular proteins into small peptides. 5 It has been well-known that cancer cells can produce multiple proteins and thereby initiate the mechanisms of cell survival and proliferation, as well as block cell death. 6 This notion suggests that proteasome inhibitors may be applied to the cell death of cancer cells. Clinical experiments have been successively performed since the late 1990s to examine the potential of proteasome inhibitors in controlling malignancies. Regulatory approvals of proteasome inhibitors have been achieved for the treatment of multiple myeloma, as well as mantle cell lymphoma. 6 Bortezomib (BTZ) is a slowly reversible inhibitor for proteasomes through binding to the catalytic site of the 26S proteasome. 7 This agent is a first-generation proteasome inhibitor that has been discovered as a first-in-class anti-tumor drug to improve clinical outcomes.8,9
Increasing evidence has shown that BTZ exhibits toxic effects on diverse tumor cells, such as glioma, 10 lymphoma, 11 leukemia, gastric cancer, and NSCLC. 12 Current trials focus on the therapeutic potential of BTZ in NSCLC, providing evidence for the potential role of BTZ-based combinations with chemotherapy and radiation in treating NSCLC.13,14 In this study, we aimed to examine the regulatory effect of BTZ on cellular senescence in NSCLC cell lines.
Materials and methods
Cell culture, transduction, and treatment
The A549 human NSCLC cell lines (ATCC, Rockville, MD) were grown in RPMI 1640 culture media with 10% FBS and 1% antibiotics (50 units/mL penicillin and 50 μg/mL streptomycin). Cells were maintained at 37°C in a humidified incubator with 5% CO2. Bortezomib was purchased from Sigma-Aldrich (St. Louis, USA) and prepared in a Dimethyl sulfoxide (DMSO) solvent. For BTZ induction, cells were incubated with growth media supplied with 25, 50 nmol/L BTZ for 14 days. For constructing the hTERT-overexpressing cell line, A549 cells were infected with a lentiviral hTERT-encoded vector (LV-hTERT) or a control lentiviral vector (LV-control). After 48 h, the Western blot was performed to validate the transduction efficiency.
SA-β-gal staining
We performed an SA-β-gal staining assay using a Senescence β-Gal Staining kit (Beyotime, China) according to the manufactory’s protocol. Briefly, A549 cells (1 × 105 cells) on a 6-well plate were fixed with 2% formaldehyde for 15 minutes and then incubated in the β-Gal staining solution overnight at room temperature. The β-Gal positive cells with blue staining were monitored under an inverted microscope. The percentage of positively stained cells was normalized by total cell numbers.
Detection of telomerase activity
We performed a Telomere repeat amplification protocol (TRAP) assay to detect telomerase activity. 15 Total protein of A549 cells was extracted and diluted with TRAP buffer. After adding 50 μl reaction mixture, qPCR was carried out using a Bio-Rad CFX96/C1000 (BioRad, USA).
Measurement of cell cycle
Cells with different treatments were digested with trypsin and then fixed with 70% ethanol at 4°C. After overnight incubation, cells were resuspended with 4 µl ribonuclease (RNase) A (2.5 mg/ml) for 30 min at 37°C, followed by 15 µl propidium iodide (PI; 50 μg/ml) staining solution for 30 min in the dark. The cell cycle distribution of A549 cells was analyzed using an FC500 Beckman flow cytometer.
Real-time PCR (RT-PCR)
A549 cells were subjected to total RNA extraction using RNAiso Plus reagent (Takara), followed by reverse transcription using Revert Aid reverse transcriptase (Thermo Scientific). PCR amplification was carried out using an SYBR Premix Ex Taq II (Takara) with the gene (POT1 and TIN2)-specific primers on an ABI Veriti PCR system (ABI, USA). The cycling profile program for all genes of interest: 95°C for 5 min, followed by 40 cycles (95°C for 10 s, 72°C for 30 s, and 55°C for 10 s). The primers sequences are: TIN2 (F: GTCAGAGGCTCCTGTGGATT; R: CAGTGCTTTCTCCAGCTGAC); POT1 (F: CAGAAAAGTGTGGATATG; R: AAGTAAAAGAAGTGTGGG); β-actin (F: CCTCATGCCATCCTGCGTCTG; R: TTGCTCGAAGTCTAGGGCAACATAG). The relative expression level of genes of interest was calculated using the ΔΔCt method with β-actin as the housekeeping control gene.
Western blot analysis
To detect the expression levels of specific proteins, western blot was performed as previously described 16 . The cell protein lysates of A549 cells were subjected to western blot analysis with protein-specific antibodies against hTERT, p53, p21, POT1, and TIN2, as well as secondary anti-rabbit antibodies (Abcam, Cambridge, MA). An ECL system (Pierce, Rockford, IL) was used to visualize protein bands.
Statistical analysis
Statistical significance among treatment groups and the control group was analyzed by one-way analysis of variance (ANOVA) followed by post-hoc Tukey’s HSD test using Prism GraphPad software version 8.0. Values of p ≤ 0.05, and 0.01 were presented with a “†“, “††” and considered to be significant.
Results
BTZ causes reduction of telomerase activity in A549 cells
To measure the effect of BTZ on telomerase activity, we treated A549 cells with two doses of BTZ (25 or 50 nmol/L) for 14 days. After the treatment, the activity of telomerase in A549 cells was reduced to 22.56 ± 2.75 and 16.75 ± 2.24 IU/L (Figure 1), respectively as compared to the control group (32.1 ± 3.92 IU/L). These data indicated that BTZ treatment resulted in the reduction of telomerase activity in this type of cells. The activity of telomerase in response to BTZ treatment. Cells were treated with BTZ at concentrations of 25 and 50 nmol/L for 14 days. (A). Molecular structure of BTZ; (B). The activity of telomerase at 48 hours (†, ††, p < 0.05, 0.01 VS. vehicle group).
BTZ induces cellular senescence in A549 cells
We then tested for cellular senescence using the SA-β-gal staining assay. As shown in Figure 2, the results show that β-Gal positive cells were increased to 2.8 ± 0.33 (25 nmol/L) and 3.7 ± 0.43 (50 nmol/L), by the two doses of BTZ respectively. These data confirm that BTZ induced cellular senescence. BTZ induces cellular senescence in A549 lung cancer cells. Cells were treated with BTZ (25, 50 nmol/L) for 14 days. The SA-β-gal staining was performed (†, ††, p < 0.05, 0.01 VS. vehicle group).
BTZ induces the cell cycle arrest on G0/G1 phase in A549 cells
To examine the effect of BTZ on the cell cycle, we measured the cell cycle profile using flow cytometry. As compared to control cells, BTZ treatment (25 and 50 nmol/L) induced G0/G1 phase arrest and delayed entry into the S phase in A549 cells (Figure 3). BTZ induces the Cell cycle arrest on G0/G1 phase. Cells were treated with BTZ (25, 50 nmol/L) for 48 hours. The cell numbers on G0/G1 phase, S phase, and G2/M were analyzed (†, ††, p < 0.05, 0.01 VS. vehicle group).
BTZ reduces the expression of hTERT in A549 cells
Next, we measured the expression of Telomerase reverse transcriptase (TERT) using Real-time PCR and Western blot analysis. The results showed that both hTERT mRNA (Figure 4(a)) and protein levels (Figure 4(b)) were significantly reduced after two doses BTZ, with the higher dose eliciting a more profound reduction. BTZ reduced the expression of hTERT in A549 lung cancer cells. Cells were treated with BTZ (BTZ) (25, 50 nmol/L) for 6 hours. (A). mRNA of hTERT; (B). Protein of hTERT as measured by western blot analysis (†, ††, p < 0.05, 0.01 VS. vehicle group).
BTZ reduces the levels of key proteins binding to telomeric DNA in A549 cells
Then, we examined the regulatory effect of BTZ on key regulators of telomere length (POT1 and TIN2) binding to telomeric DNA. As presented in Figure 5(a) and compared to the control group, the mRNA levels of POT1 and TIN2 in BTZ (25 and 50 nmol/L)-treated A549 cells were reduced to 0.71 ± 0.09/0.49 ± 0.055 and 0.57 ± 0.06/0.4 ± 0.045, respectively. Similarly, the BTZ-treated group had decreased POT1 and TIN2 protein expression levels (Figure 5(b)). BTZ reduces the levels of key proteins binding to telomeric DNA in A549 lung cancer cells. (A) The mRNA levels of POT1 and TIN2; (B) The protein levels of POT1 and TIN2 (†, ††, p<0.05, 0.01 VS. vehicle group).
BTZ increases p53 and p21 expression in A549 cells
We also evaluated the effect of BTZ on cell cycle regulators. Figure 6(a) demonstrates that the expression of p53 after treatment with BTZ (25 and 50 nmol/L) was respectively increased 2.2 ± 0.25 and 2.8 ± 0.03 fold, relative to 1 ± 0.12 in the control group. Figure 6(b) shows a similar change trend in p21 expression after BTZ (25 and 50 nmol/L) treatment. BTZ increases p53 and p21 expression. The protein levels of p53 and p21 (†, ††, p < .05, 0.01 VS. vehicle group).
The effects of BTZ were abolished in hTERT-overexpressing A549 cells
Finally, we induced TERT overexpression in A549 cells and evaluated the expressions of telomere length regulators. The cells were infected with a lentiviral hTERT-encoded vector (LV-hTERT) for 48 h. Western blot showed that hTERT was successfully over-expressed in LV-hTERT-infected A549 cells with a 4.3 ± 0.52-fold change (Figure 7(a)). The BTZ (50 nmol/L)-induced increase in β-Gal positive cells was prevented by LV-hTERT (Figure 7(b)). The BTZ (50 nmol/L)-induced decrease in the activity of telomerase (18.7 ± 2.12 IU/L) was reversed after infection with LV-hTERT (26.75 ± 2.9 IU/L) (Figure 7(c)). likewise, the decreased mRNA levels of POT1 and TIN2 in BTZ (50 nmol/L)-induced cells were blocked by LV-hTERT (Figure 7(d)). The effects of BTZ were abolished when overexpressing hTERT. Cells were infected with lentiviral hTERT-encoded vectors for 48 hours and then treated with BTZ (50nmol/L). (A) Successful over-expressed hTERT was detected using Western blots; (B) SA-β-gal staining in cells; (C) the activity of telomerase; (D) The mRNA levels of POT1 and TIN2 (†, ††, p<0.05, 0.01 VS. vehicle group).
Discussion
In addition to multiple myeloma and mantle cell lymphoma, BTZ exhibited anti-tumor activity in various types of malignant cells. BTZ inhibits the growth of glioma cells and enhances their sensitivity to temozolomide (TMZ). 17 BTZ sensitizes thyroid (TC) cancer to BRAF inhibitor via mitochondrial dysregulation and apoptosis induction in vitro and in vivo. 18 BTZ enhances the radio sensitivity of oral cancer cells through an autophagy-associated mechanism. 19 Particularly, there are rationale and preclinical data supporting BTZ as a novel therapeutic agent in NSCLC treatment. 13 In combination with other antitumor agents, such as carboplatin, gemcitabine, histone deactylase inhibitors, and taxanes, BTZ can offer additive/synergistic effects in various NSCLC cell lines. 20 However, the mechanism has not been fully evaluated.
Senescence is a mechanism of cellular defense to prevent the cells from unnecessary damage and anti-senescent therapy may help to recover tissue function by eliminating accumulated senescent cells. 21 While senescence also presents pathological features in pathological contexts, such as in cancer, pro-senescent therapy may contribute to limiting proliferation. 21 Telomeres are repetitive DNA repeat sequences that locate at the end of chromosomes with DNA protective properties against degradation and illegitimate recombination. 22 Telomere reduction leads to cell cycle arrest and DNA damage. Based on theoretical and experimental data, the validity of telomere shortening is considered a marker of cellular senescence and aging. 23
It has been documented that BTZ induces cellular senescence in different cell types, including cancer cells. Morelli et al. 10 reported that BTZ potentiates the senescence-associated cell death and necrosis in axitinib-induced glioma cell lines. BTZ mediates telomerase downregulation and disrupts telomere homeostasis, thereby contributing to the cell apoptosis of malignant cells, including leukemic and gastric cancer cells. 12 BTZ causes a time-dependent increase in cellular senescence of normal human skin fibroblasts, which can be significantly enhanced in hypoxic conditions. 24 Ciclopirox (CPX) and BTZ were found to activate NF-κB signaling synergistically and induce cellular senescence in glioblastoma multiforme (GBM) cells. 25 To our knowledge, this is the first study on the molecular mechanism of BTZ on telomere length. Our findings suggest that BTZ directly suppresses telomerase enzyme hTERT and the regulators (POT1 and TIN2).
In addition, the anti-tumor activity of BTZ is not dependent on the regulation of cellular senescence. For instance, BTZ exhibits efficient induction of apoptosis in human breast cancer cells with no effect on senescence. 26 Therefore, we investigated the regulatory effect of BTZ on cellular senescence in NSCLC cell lines. The SA-β-gal staining assay showed that BTZ caused a significant increase in β-Gal positive A549 cells and also induced the G0/G1 phase cell cycle arrest in A549 cells. These findings suggested that BTZ induced cellular senescence in A549 cells. Furthermore, in response to BTZ treatment (25 or 50 nmol/L), the telomerase activity was markedly reduced in A549 cells indicating the regulatory effect of BTZ on telomeres in NSCLC cells.
As a functional catalytic protein subunit of telomerase, hTERT expression and regulation are directly involved in tumor formation.
27
It has been previously shown that increased hTERT expression indicates an aggressive phenotype with poor prognosis in several types of cancer, including lung cancer.
28
Our results show that BTZ reduced the expression level of hTERT in A549 cells, and the key proteins binding to telomeric DNA, including POT1 and TIN2 were reduced after BTZ induction. We also found that BTZ induced the expression of the cell cycle-associated tumor suppressors p53 and p21 in A549 cells. Moreover, hTERT overexpression abolished the effects of BTZ in A549 cells. The proposed mechanism of BTZ on cellular senescence in A549 lung cancer cells is shown in Figure 8. The proposed mechanism of the BTZ on cellular senescence in A549 lung cancer cells.
Herein, we uncovered the underlying mechanism of BTZ in NSCLC cells, showing that BTZ induced cellular senescence by stimulating telomere shortening. Our results provide experimental data for the potential clinical application of BTZ in NSCLC treatment.
Supplemental Material
Supplemental Material - Bortezomib induces cellular senescence in A549 lung cancer cells by stimulating telomere shortening
Supplemental Material for Bortezomib induces cellular senescence in A549 lung cancer cells by stimulating telomere shortening by Lei Wang, Hang Yin, Shiren Huang, Sini Huang, Congcong Huang, Zhao Zhang, amd Hui Liu in Human & Experimental Toxicology
Footnotes
Author Contribution
Lei wang and Hui Liu contributed to the experimental design and data analysis; Lei wang, Hang yin, Shiren Huang, Sini Huang, Congcong Huang, and Zhao Zhang contributed to the investigation; Hui Liu prepared the manuscript. All authors have read and approved the manuscript.
Declaration of Conflicting Interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the “Hainan Hospital of PLA General Hospital”.
Ethical Approval
I confirm that all the research meets ethical guidelines and adheres to the legal requirements of the study country.
Informed Consent
All the authors agreed to publish this article.
Data Availability
The data and materials of this study are available upon reasonable request from the corresponding authors.
Supplemental Material
Supplemental material for this article is available online.
References
Supplementary Material
Please find the following supplemental material available below.
For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.
For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.
