Sage Journals: Discover world-class research

Abstract

Background

Human dental pulp stem cells (hDPSCs) possess mesenchymal stem cell properties, originating from migrating neural crest cells. hDPSCs have received extensive attention in the field of tissue engineering and regenerative medicine due to their accessibility and ability to differentiate in several cell phenotypes. In this study, we cultured hDPSCs with Y-27632 to observe their biological behaviors changes.

Methods

The hDPSCs were separately cultured with Y-27632 (0, 0.156, 0.312, 0.625, 1.25, 2.50, 5, 10, 20, 40 μm) for 24, 48, 72 h to select the suitable concentration and time using CCK-8. Then, the hDPSCs were cultured with 2.50 μm Y-27632 for 48 h to analyzed the biological behaviors changes by 5-Ethynyl-2′-deoxyuridine (EdU), plate cloning, transwell, scratch, and Annexin V FITC/PI assays, separately. Additionally, osteogenic calcium nodules and lipid droplets were analyzed using alizarin red staining and oil red O staining, respectively. qRT-PCR was used to analyze the expression of osteogenesis, adipogenesis, stemness maintenance, and inflammation related genes.

Results

The hDPSCs proliferation was significantly enhanced after cultured with 2.50 μm Y-27632 for 48 h, but there was no significant difference in migration and apoptosis. Observation of alkaline phosphatase (ALP) activity, osteogenic and adipogenic differentiation abilities of hDPSCs, Y-27632 treatment clearly decreased the ALP activity and osteogenic differentiation ability, increased the adipogenic differentiation ability. Furthermore, Y-27632 decreased the CD73, CD90, CD105, CD166, TLR4, and NF-κB p65 genes expression, but increased the IL-8 gene expression.

Conclusions

The biological behaviors of hDPSCs could be changed when they cultured with Y-27632.

Keywords

Human dental pulp stem cells Y-27632 treatment cell proliferation adipogenic differentiation osteogenic differentiation

Introduction

Human dental pulp stem cells (hDPSCs) possess mesenchymal stem cell properties, originating from migrating neural crest cells.¹ hDPSCs have received extensive attention in the field of tissue engineering and regenerative medicine due to their accessibility and ability to differentiate into adipogenic, chrondrogenic, and osteogenic cell.^1,2 In the context of regenerative therapies, hDPSCs provide a hope for repairing lost dental pulp and tooth tissue because of their abilities to differentiate into dentin cells and vascular.^3,4 However, the environment of receptor regions is generally uncertain, including inflammation and stress state, which could affect the differentiation of hDPSCs.

Y-27632 (R)-(+)-trans-4-(1-Aminoethyl)-N-(4-Pyridyl)cyclohexanecarboxamide), a highly selective Rho kinase inhibitor, could increase the dentin sialophosphoprote in expression and ALP activity, when long-term cultured with human odontoma-derived cell (hODC).⁵Wang et al. have reported that Y-27632 significantly promoted human periodontal ligament stem cells (hPDLSCs) proliferation, chemotaxis, wound healing, fat droplets formation, and pluripotency, while inhibited ALP activity and mineral deposition.⁶ Several studies have showed that Y-27632 regulates the cytoskeletal changes associated with cell adhesion and has been used to protect cultured cells during their passaging.^7–9 Additionally, Yang and colleagues found Y-27632 transfection in human exfoliated deciduous teeth (SHEDs) enhanced cell viability, colony formation, and neurosphere formation.¹⁰ These evidences suggest that Y-27632 is a potential reagent that is able to enhance the proliferation of different stem cells types.

In this study, we assessed the effects of Y-27632 on biological behaviors of hDPSCs, including the proliferation, apoptosis, migration, wound-healing ability, and differentiation capacities, at the same time, complemented with expression of stem cell self-renewal, osteogenic, and adipogenic marker genes.

Methods

Cells isolation and primary culture

Primary human dental pulp stem cells (hDPSCs) were isolated by as previous described¹¹ and cultured in α-MEM medium (12571063, GibcoTM) contained with 10% fetal bovine serum (FBS) at 37°C with 5% CO2. The medium was replaced every 3 days. When they reached 85%–90% confluence, the cells were used for experiments. The procedure for obtaining human dental pulp stem cells from extracted teeth without any personal identity information was approved by the Medical Ethical Committee of the Shengli Oilfield Central Hospital of Shandong province (No. Q/ZNN-ZY-YWB-LL202118). Early passage (passage2 or 3) dental pulp stem cells were used for all experiments.

Separation method refers to and improves the Virginia method as followings:

1. Rinsed and disinfected after the tooth was completely extracted, split the tooth under sterile conditions, and removed the pulp

2. Disinfection solution: 70% ethanol, 2× antibiotics PBS: 1% penicillin (100 U/mL) and streptomycin (100 mg/L) in PBS

3. Enzyme mixture: 2.5 mg/mL Dispase and 2.5 mg/mL type I collagenase in DMEM

4. Neutralization solution: 10% FBS in DMEM with 1% penicillin/streptomycin

5. Inoculation medium (The culture system was consisted of α-MEM, 10% FBS and 100 U/mL penicillin, 100 μg/mL streptomycin; The culture conditions were 100% relative humidity, 5% C02, 37°C)

6. Routine passage when cell growth was close to fusion, amplification culture, inverted microscopy to observe cell morphology.

7. Materials for tissue processing: Forceps, autoclaved scalpel holder, sterile blades, 50 mL falcon tube, 100 μm cell strainers, and 100 mm tissue culture dishes.

Cell Counting Kit-8(CCK-8 assay)

The cells suspension (100 μL, 5 × 10³ cell/well) was cultured for 24 h at 37°C with 5% CO₂. Then, 10 μL different concentrations (0, 0.156, 0.312, 0.625, 1.25, 2.50, 5, 10, 20, 40 μm) of Y-27632 (ab120129, Abcam) were added and cultured for 24, 48, 72 h, separately. The cells were added with 10 μL CCK-8 solution (Biomiky, BL001B 500T, China), and cultured for 4 h. The absorbance values of each well were measured at 450 nm using a microplate reader (Tecan, Infinite F50).

Cells groups

According to the results of CCK-8, the suitable culture condition of Y-27632 was concentration 2.50 μm, time 48 h. The cells were divided into control group, and Y-27632 group. In control group, the hDPSCs were cultured as normal for 48 h. In Y-27632 group, the hDPSCs were cultured with 2.50 μm Y-27632 for 48 h.

EdU (5-Ethynyl-2’-deoxyuridine) assay

After trypsin digestion, 100 μL cell suspensions (1 × 10³ cell/well) were cultured in 5% CO2 incubator at 37°C. The hDPSCs were incubated with preheated 20 μM equal volume of BeyoClick TM EdU solution (C0088s, Beyotime, China) for 2 h at 24 h and 96 h, separately. Then, the cultured medium was removed and the hDPSCs were fixed with 1 mL fixed solution for 15 min at room temperature. Removing the fixed solution, the cells were washed with 1 mL PBS three times, each time for 5 min. The hDPSCs were incubated at room temperature for 10–15 min. After washing, the cells were cultured with endogenous peroxidase blocking solution for 20 min at room temperature. Then, adding 50 Click reactions into each well, the hDPSCs were cultured for 30 min at room temperature. After washing, the cells were cultured with Streptavidin-HRP solution for 30 min at room temperature. After washing, the cells were cultured with 0.1 mL TMB solution for 20 min. The reaction was terminated by adding 25 μL H₂SO₄ (2m). The absorbance was measured at 450 nm.

Plate cloning

After digestion with 0.25% trypsin (BL006A, Biomiky), the cell suspension (5000 cell/well) was inoculated in 6-well plate, three multiple wells in each group. The inoculated hDPSCs were cultured for 8 days at 37°C with 5% CO₂, and the medium was changed every 3 days. Before the termination of the experiment, the cell clones were photographed under the fluorescence microscope (MF53, Mshot). After washing with PBS, the cells were fixed with 4% paraformaldehyde (1 mL) for 45 min. After washing with PBS, the cells were stained with 1000 μL crystal violet staining solution (C0775, Sigma) for 15 min. The cells were photographed with camera after washing with ddH₂O and drying in the air.

Apoptosis was detected by flow cytometry

After digestion with 0.25% trypsin, the cell suspension (1000 cell/well) was collected into 5 mL centrifuge tube. After centrifugation at 1300 rmp for 5 min, the supernatant was discarded and the cell precipitates were washed with precooled D-Hanks (pH=7.2–7.4). The cells were suspended with 1×binding buffer, then centrifuged at 1300 rmp for 3 min. Suspending with 1×binding buffer (200 μL), the hDPSCs were cultured with 2 μL Annexin V-FITC and PI (22837, AAT Bioquest) for 45 min at room temperature without light. The results were measured using a flow cytometry (BD FACSCanto).

Transwell assay

The serum-free cell suspension (5 × 10⁴ cell/well) was inoculated in 24-well plate. Removing the medium from the upper chamber, hDPSCs suspension (100 μL) was added into the upper chamber. In the lower chamber, 30% FBS (600 μL) was added. The plates were cultured at 37°C for 48 h. After removing the non-transferred cells with a cotton swab, the transferred cells were stained with crystal violet staining solution (C0121, Beyotime, China) for 15 min. Washing and drying the chamber, the results were observed under a light microscope with 100 magnifications.

Scratch test

Two horizontal lines were drawn on the back of 12 wells. About 2 × 10⁵ cells were added to reach 90% convergence degree on the next day. On the second day, the cells were cultured with low concentration serum medium and scratched with a 10 μL gun head. The cells were observed after cultured for 8 h, 24 h at 37°C, respectively.

Alkaline phosphatase (ALP) activity of hDPSCs was detected by ELISA

The hDPSCs supernatant was collected after centrifuging 1300 rpm for 20 min. The cells suspension was diluted with PBS (pH = 7.2–7.4). According to the instructions of ALP ELISA kit (P0321S, Beyotime, China), the absorbance (OD) of each well was measured at 450 nm. The determination should be carried out within 15 min after adding the termination solution.

Alizarin red staining

The hDPSCs were digested with 0.25% Trypsin-0.04% EDTA, and seeded into 24 well plates with 0.1% gelatin. In each well, 1 mL complete medium (HUXDP-90011, OriCell) was added. When the degree of cell fusion reached 60%–70%, removed the complete medium, and added 2 mL complete medium for osteogenic differentiation (HUXDP-90021,OriCell). The complete medium for osteogenic differentiation was changed every 3 days. After 21 days, removed the medium and washed with PBS. In each well, 4% neutral formaldehyde was added for 30 min. After washing with PBS, 2% alizarin red S solution (C0138, Beyotime, China) was added for 3–5 min. After washing, the cells were observed under a light microscope.

Oil red O staining

The hDPSCs were digested with 0.25%Trypsin-0.04% EDTA, and seeded into 24 well plates with 0.1% gelatin. In each well, 2 mL complete medium was added. When the degree of cell fusion reached 100%, removed the complete medium, and added 1 mL adipogenic differentiation medium A (HUXDP-90031,OriCell). After 3 days, removing the medium A, and added the adipogenic differentiation medium B (HUXDP-90031,OriCell) for 24 h. Then, replaced medium B with medium A and cultured for 3 days. Alternately cultured with medium A and medium B for 14 days, the cells were cultured with medium B for 7 days. After washing with PBS, the cells were fixed with 4% neutral formaldehyde for 30 min, and stained with oil red O staining (C0158m, Beyotime, China) for 30 min. After washing, the results were observed under a light microscope.

Quantitative RT-PCR (qRT-PCR) assay

The total RNA of cells was extracted using T TRIzol® Plus RNA purification kit (12183-555, Invitrogen) and determined by an UV spectrophotometry (Beckman). Reverse transcriptase was performed by SuperScript™ III First-Strand Synthesis SuperMix (11752-050, Invitrogen). The quantitative PCR was performed using Power SYBR® Green PCR Master Mix (4367659, Applied Biosystems). Using a multiple quantitative RT-PCR (CFX384, Bio-Rad, USA), the reaction conditions were follows: 95°C for 1 min, followed by 40 cycles of 95°C for 15 s, 63°C for 25 s. The melt curve analysis was performed at 55°C for 15 s, 95°C for 15 s. The relative expression level of each gene was calculated by the comparative △△Ct method. The PCR primers (Table 1) were designed using Primer Premier 6.0 software and Beacon designer 7.8 software, and they synthesized by Sangon Biochenology (Shanghai) Co.,Ltd. (https://www.sangon.com).

Table 1.

PCR Primers used for qRT-PCR.

Gene	Genbank Accession	Primer Sequences (5’to3′)	Size (bp)	Annealing (°C)
Human GAPDH	NM_002046.5	CCATGACAACTTTGGTATCGTGGAA	107	60
Human GAPDH	NM_002046.5	GGCCATCACGCCACAGTTTC	107	60
TLR4	NM_003266.4	AAAATCCCCGACAACCTCCC	264	60
TLR4	NM_003266.4	CACAGCCACCAGCTTCTGTA	264	60
RELA (NF-kB p65)	NM_001145138.2	CTTCCAAGAAGAGCAGCGTG	160	60
RELA (NF-kB p65)	NM_001145138.2	GATCTTGAGCTCGGCAGTGT	160	60
IGF1R (STRO-1)	NM_000875.5	ACGAGTGGAGAAATCTGCGG	101	60
IGF1R (STRO-1)	NM_000875.5	ATGTGGAGGTAGCCCTCGAT	101	60
ENG (CD105)	NM_001114753	GCATCCTTCGTGGAGCTACC GAGGAGTGGTCTGGATCGG	103	60
CXCL8(IL8)	NM_000584.4	CACTGCGCCAACACAGAAAT	121	60
		ATGAATTCTCAGCCCTCTTCAA
ALCAM(CD166)	NM_001243281	ACTTGACGTACCTCAGAATCTCACATCGTCGTACTGCACACTTT	116	60
THY1(CD90)	NM_001311160	CAGCAGTTCACCCATCCAGT	271	60
		GATGCCCTCACACTTGACCA
NT5E (CD73)	NM_001204813	GTATCCGGTCGCCCATTGATCCGACCTTCAACTGCTGGAT	308	60
AP2	NM_001442	ACTGGGCCAGGAATTTGACGCTCGTGGAAGTGACGCCTT	183	60
ALP	NM_003064.4	GCCTGGATCCTGTTGACACCCTGGCCATCCATCTCACAGA	116	60
PPARγ-2	NM_001330615.4	ACTTTGGGATCAGCTCCGTGGGAGATGCAGGCTCCACTTT	214	60
Runx2	NM_001015051.4	GCCTCTTCAGCACAGTGACACATTCCGGAGCTCAGCAGAA	498	60

Statistical analysis

The SPSS19.0 (IBM, USA) was used for statistical analysis. The samples used in each experiment were independent, and the same samples were not used in different tests. All data in the experimental results were repeated independently for 3 times and represented as mean ± standard deviation. Between two groups, the t test was used to compare the difference (p < .05).

Results

Suitable conditions of Y-27632 cultured with hDPSCs

The effects of different concentrations of Y-27632 (0, 0.156, 0.312, 0.625, 1.25, 2.50, 5, 10, 20, 40 μm) on the proliferation of hDPSCs were analyzed by CCK-8 (Figure 1). For the same culture time, the appreciation of hDPSCs increased with the increase concentration of Y-27632 within a certain range, and the appreciation of hDPSCs began to decline when the concentration of Y-27632 increased to a certain level. Additionally, the appreciation of hDPSCs was normal distribution under different concentrations of Y-27632 for 48 h. For the following experiments, we chose 2.50 μm Y-27632 to treat hDPSCs for 48 h.

Figure 1.

CCK-8 assay was used to analyze the proliferation of human dental pulp stem cells (hDPSCs) treated with different concentration of Y-27632 (0, 0.156, 0.312, 0.625, 1.25, 2.50, 5, 10, 20, 40 μm) for 24, 48, and 72 h (n = 3).

Effects of Y-27632 on the proliferation of hDPSCs

The proliferation of hDPSCs was analyzed by EdU (Figure 2(a)) and plate cloning (Figure 2(b)), and the results showed that the proliferation of hDPSCs was significantly increased after treatment with 2.50 μm Y-27632 for 48 h (p < .05).

Figure 2.

EdU (a) and plate cloning (b) experiments were used to analyze the proliferation ability of hDPSCs. Compared with control group (n = 3), *p < 0.05.

Effects of Y-27632 on the migration ability of hDPSCs

The migration ability of hDPSCs was analyzed using transwell (Figure 3(a)) and scratch (Figure 3(b)) experiments. Transwell results showed that there was no significant difference between control group and Y-27632 group (p = .419); Scratch results also showed that there was no significant difference between control group and Y-27632 group at 8 h (p = 0.25) and 24 h (p = 0.71).

Figure 3.

The migration ability of hDPSCs was analyzed using transwell (Figure 3(a)) and scratch (Figure 3(b)) experiments. In Figure 3(a), the pictures were observed under 100 magnifications; In figure 3(b), the images were observed under 40 magnifications (n = 3).

Effects of Y-27632 on the apoptosis of hDPSCs

The apoptosis of hDPSCs was analyzed using Annexin V FITC/PI kit (Figure 4), and the data showed that treatment with 2.50 μm Y-27632 for 48 h could reduce the apoptosis rate of hDPSCs, but there was no significant difference between the two groups (p = .182).

Figure 4.

Effects of Y-27632 on the apoptosis of hDPSCs were analyzed using Annexin V FITC/PI apoptosis kit (n = 3).

Effects of Y-27632 on ALP of hDPSCs

The effect of Y-27632 on ALP activity of hDPSCs was measured by the ALP ELISA kit (Figure 5). The results showed that 2.50μm Y-27632 treatment for 48 h could reduce ALP activity of hDPSCs (p = .00).

Figure 5.

The effect of Y-27632 on ALP activity of hDPSCs was measured by the ALP ELISA kit. Compared with control group (n = 3), **p < .01.

Effects of Y-27632 on osteogenic calcium nodules and lipid droplets of hDPSCs

Alizarin Red S staining was performed to identify extracellular calcium deposits of cells differentiated into osteoblasts (Figure 6(a)), and oil red O staining was performed to identify lipids in cells differentiated into adipocytes (Figure 6(b)). Compared with the control group, the number of mineralized nodules in Y-27632 group clearly decreased (p = 0.00), but the amount and size of lipid droplets in Y-27632 group were increased. The proportion of average area of lipid droplets in Y-27632 group was significantly larger than that in control group (p = .047).

Figure 6.

Effects of Y-27632 on genes expression of hDPSCs

The effects of Y-27632 on genes expression related to osteogenesis (Figure 7(a)), adipogenesis (Figure 7(b)), stemness maintenance (Figure 7(c)), and inflammation (Figure 7(d)) of hDPSCs were analyzed by qRT-PCR. The results showed that the Runx2 and ALP genes expression in the Y-27632 group were significantly lower than those in the control group (p = .00, Figure 7(a)). Compared with the control group, AP2 and PPARγ-2 genes in the Y-27632 group were significantly increased (p = 0.00, Figure 7(b)). Compared with the control group, CD73, CD90, CD105, and CD166 genes in the Y-27632 group were significantly decreased (p = .00, Figure 7(c)), while there was no significant difference between groups for STRO-1 gene (p = .573). After treatment of Y-27632, IL-8 gene was significantly increased (p = 0.00), while TLR4 and NF-κB genes were significantly decreased (p = .00, Figure 7(d)).

Figure 7.

The effects of Y-27632 on genes expression related to osteogenesis (Figure 7(a)), adipogenesis (Figure 7(b)), stemness maintenance (Figure 7(c)) and inflammation (Figure 7(d)) of hDPSCs were analyzed by Quantitative RT-PCR (qRT-PCR). Compared with control group (n = 3), **p < .01.

Discussion

Dental caries and periodontal disease, such as periodontitis, fractures, genetic defects, or aging, can lead to tooth damage and loss, thereby reducing the quality of life.¹² In current dental clinical practice, the therapeutic methods are major replacing missing teeth using osseointegrated dental implants,¹³ or removing the infected hard tissue part and replacement with composite resins.¹⁴ When the bacterial infection reaches the pulp, root canal therapy is the first choice.¹⁵ In recent years, regenerative dentistry has become a hot topic in the research of prosthodontics, such as, injection of stem cells and/or growth factors.^16–18 Various studies have demonstrated that the potential of hDPSCs for dental pulp regeneration.^19,20 However, there is still little information for the effects of Y-27632 on the hDPSCs properties and differentiation.

Many studies have showed that supplementary Y-27632 could promote the proliferation and suppress the apoptosis of pluripotent stem cells, including human embryonic stem cells²¹ and hPDLSCs.⁶ In this study, we selected 2.5 μm Y-27632 co-cultured with hDPSCs for 48 h. The results showed that Y-27632 significantly enhanced the proliferation of hDPSCs, while did not significantly effect on the migration, wound-healing ability, and apoptosis. This inconsistency may be due to different cell type. Wang et al.⁶ showed that Y-27632 significantly enhanced the migration and wound-healing ability of hPDLSCs, but not significantly inhibited the apoptosis of hPDLSCs, which suggested some common characters between hDPSCs and hPDLSCs.

ALP activity plays an important role in the mineralization process, which is usually used as a marker for osteogenic differentiation.²² Runx2 is the main gene controlling the differentiation of osteoblasts and plays a key role in the differentiation of mesenchymal stem cells (MSCs) into osteoblasts.²³ Adipocyte protein 2 (AP2) and peroxisome proliferator activated receptor γ-2 (PPARγ-2) are mainly located in adipocytes, participating in the transportation of fatty acids in cells and promoting the metabolism of fat in the body.²⁴ In our study, Y-27632 co-culture notably inhibited ALP activity, decreased the Runx2 and ALP genes expression, indicating that Y-27632 decreased the ability of hDPSCs to produce mineralized nodules. In turn, Y-27632 increased the ability of hDPSCs to produce fat droplets through promoting the AP2 and PPARγ-2 genes expression. The results of alizarin red staining and oil red O staining also indicated that Y-27632 enhanced the potential of adipogenic differentiation, and suppressed the potential of osteogenic differentiation.

MSCs-associated markers, namely CD73, CD90, CD105, and CD166,²⁵ were clearly decreased when hDPSCs co-cultured with Y-27632. But the STRO-1 gene express was not affected by Y-27632, which is also an essential MSCs-associated marker.²⁶ These data suggested that the cell type specific regulation of hDPSCs during Y-27632 treatment. Additionally, we measured the genes expression of interleukin (IL)-8, TLR4 and Nuclear Factor-κB (NF-κB) p65 in cells. The IL-8 expression significantly increased, but TLR4 and NF-κB p65 expression clearly decreased when hDPSCs co-cultured with Y-27632. IL-8 has been shown to promote homing of bone marrow-derived cells to injured sites, and enhances the angiogenic potential of human bone marrow mesenchymal stem cells by increasing vascular endothelial growth factor.²⁷ TLR4/NF-κB p65 signaling is an important inflammatory response pathway. The activation of TLR4 promotes the phosphorylation of NF-κB, thereby promoting inflammatory effects.²⁸ These data provided an enlightenment that the regulatory mechanism of Y-27632 may be related with IL-8, TLR4/NF-κB p65 signaling.

Conclusions

In conclusion, we demonstrated that Y-27632 could enhance the proliferation of hDPSCs, but have no significant effects on the migration, wound-healing ability, and apoptosis. At the same time, Y-27632 could enhance the potential of adipogenic differentiation, and suppress the potential of osteogenic differentiation.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by Shandong Province Medicine and Health Science and Technology Development Project (Grant No. 2018WS163, 2019WS045).

ORCID iD

Min Zong

References

Nuti

Corallo

Chan

BMF

, et al. Multipotent Differentiation of Human Dental Pulp Stem Cells: a Literature Review. Stem Cell Reviews Reports 2016; 12(5): 511–523.

Botelho

Cavacas

Machado

, et al. Dental stem cells: recent progresses in tissue engineering and regenerative medicine. Ann Medicine 2017; 49(8): 644–651.

Gronthos

Mankani

Brahim

, et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci 2000; 97(25): 13625–13630.

Meng

Zhou

, et al. A Sandwich Structure of Human Dental Pulp Stem Cell Sheet, Treated Dentin Matrix, and Matrigel for Tooth Root Regeneration. Stem Cells Development 2020; 29(8): 521–532.

Uzawa

Kasamatsu

Saito

, et al. Long-term culture of human odontoma-derived cells with a Rho kinase inhibitor. Exp Cell Research 2016; 347(1): 232–240.

Wang

Kang

, et al. Rho-kinase inhibitor Y-27632 facilitates the proliferation, migration and pluripotency of human periodontal ligament stem cells. J Cellular Molecular Medicine 2017; 21(11): 3100–3112.

Zhao

Fan

Ernst

, et al. Y-27632 preconditioning enhances transplantation of human-induced pluripotent stem cell-derived cardiomyocytes in myocardial infarction mice. Cardiovasc Research 2019; 115(2): 343–356.

Watanabe

Ueno

Kamiya

, et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnology 2007; 25(6): 681–686.

Kim

Min

Kim

, et al. A Rho Kinase (ROCK) Inhibitor, Y-27632, Inhibits the Dissociation-Induced Cell Death of Salivary Gland Stem Cells. Molecules (Basel, Switzerland) 2021; 26(9).

10.

Yang

Xin

Zhang

, et al. Synergistic effects of Rho kinase inhibitor Y‐27632 and Noggin overexpression on the proliferation and neuron‐like cell differentiation of stem cells derived from human exfoliated deciduous teeth. IUBMB Life 2020; 72(4): 665–676.

11.

Tirino

Paino

De Rosa

, et al. Identification, isolation, characterization, and banking of human dental pulp stem cells. Somatic Stem Cells 2012; 879: 443–463. DOI: 10.1007/978-1-61779-815-3_26.

12.

Monterubbianesi

Bencun

Pagella

, et al. A comparative in vitro study of the osteogenic and adipogenic potential of human dental pulp stem cells, gingival fibroblasts and foreskin fibroblasts. Scientific Reports 2019; 9(1): 1761.

13.

Mitsiadis

Harada

. Regenerated teeth: the future of tooth replacement. An update. Regenerative Medicine 2015; 10(1): 5–8.

14.

Ferracane

. Resin composite-State of the art. Dental Mater 2011; 27(1): 29–38.

15.

Tomson

Simon

. Contemporary Cleaning and Shaping of the Root Canal System. Prim Dental Journal 2016; 5(2): 46–53.

16.

Morsczeck

Reichert

. Dental stem cells in tooth regeneration and repair in the future. Expert Opinion Biological Therapy 2018; 18(2): 187–196.

17.

Zhang

Chen

Song

, et al. Making a tooth: growth factors, transcription factors, and stem cells. Cel Research 2005; 15(5): 301–316.

18.

Hosoya

Shalehin

Takebe

, et al. Sonic Hedgehog Signaling and Tooth Development. Int Journal Molecular Sciences 2020; 21(5).

19.

Khayat

Monteiro

Smith

, et al. GelMA-Encapsulated hDPSCs and HUVECs for Dental Pulp Regeneration. J Dental Research 2017; 96(2): 192–199.

20.

Xuan

Guo

, et al. Deciduous autologous tooth stem cells regenerate dental pulp after implantation into injured teeth. Sci Translational Medicine 2018; 10(455).

21.

Gao

Nath

Jiao

, et al. Post-Passage rock inhibition induces cytoskeletal aberrations and apoptosis in Human embryonic stem cells. Stem Cell Research 2019; 41: 101641.

22.

Birmingham

Niebur

, et al. Osteogenic differentiation of mesenchymal stem cells is regulated by osteocyte and osteoblast cells in a simplified bone niche. Eur Cell Mater 2012; 23: 13–27.

23.

Almalki

Agrawal

. Key transcription factors in the differentiation of mesenchymal stem cells. Differ Research Biological Diversity 2016; 92(1–2): 41–51.

24.

Duarte Campos

Blaeser

Korsten

, et al. The stiffness and structure of three-dimensional printed hydrogels direct the differentiation of mesenchymal stromal cells toward adipogenic and osteogenic lineages. Tissue Engineering. A 2015; 21(3–4): 740–756.

25.

Hynes

Menicanin

Mrozik

, et al. Generation of functional mesenchymal stem cells from different induced pluripotent stem cell lines. Stem Cells Development 2014; 23(10): 1084–1096.

26.

Ranga Rao

Subbarayan

. Passage‐dependent expression of STRO‐1 in human gingival mesenchymal stem cells. J Cellular Biochemistry 2019; 120(3): 2810–2815.

27.

Hou

Ryu

Jun

, et al. IL-8 enhances the angiogenic potential of human bone marrow mesenchymal stem cells by increasing vascular endothelial growth factor. Cel Biology International 2014; 38(9): 1050–1059.

28.

Huang

Fei

G-Q

, Liu

W-J

, et al. Adipose-derived mesenchymal stem cells protect against CMS-induced depression-like behaviors in mice via regulating the Nrf2/HO-1 and TLR4/NF-κB signaling pathways. Acta Pharmacologica Sinica 2020; 41(5): 612–619.

Effects of Y-27632 on the osteogenic and adipogenic potential of human dental pulp stem cells in vitro

Abstract

Background

Methods

Results

Conclusions

Keywords

Introduction

Methods

Cells isolation and primary culture

Cell Counting Kit-8(CCK-8 assay)

Cells groups

EdU (5-Ethynyl-2’-deoxyuridine) assay

Plate cloning

Apoptosis was detected by flow cytometry

Transwell assay

Scratch test

Alkaline phosphatase (ALP) activity of hDPSCs was detected by ELISA

Alizarin red staining

Oil red O staining

Quantitative RT-PCR (qRT-PCR) assay

Statistical analysis

Results

Suitable conditions of Y-27632 cultured with hDPSCs

Effects of Y-27632 on the proliferation of hDPSCs

Effects of Y-27632 on the migration ability of hDPSCs

Effects of Y-27632 on the apoptosis of hDPSCs

Effects of Y-27632 on ALP of hDPSCs

Effects of Y-27632 on osteogenic calcium nodules and lipid droplets of hDPSCs

Effects of Y-27632 on genes expression of hDPSCs

Discussion

Conclusions

Footnotes

Declaration of conflicting interests

Funding

ORCID iD

References