Antenatal dexamethasone retarded fetal long bones growth and development by down-regulating of insulin-like growth factor 1 signaling in fetal rats

Abstract

Objective

Dexamethasone (DEX), a synthetic glucocorticoid, has been widely used as a medication for premature delivery. However, the side effects of antenatal DEX treatment on fetal bone development, as well as the underlying mechanisms still remain to be elucidated. Here, we aimed to explore the effects and the related mechanisms of antenatal DEX exposure during late pregnancy on fetal bone growth and development.

Methods

Pregnant Sprague–Dawley rats were randomly divided into DEX group and vehicle group from gestational day 14 (GD14). Pregnant rats in DEX group were intraperitoneally injected once with DEX (200 µg/kg body weight) on GD14, 16, 18, and 20. The vehicle group rats were administered the same amount of normal saline at the same time. Pregnant rats were anesthetized at GD21 to harvest fetal femurs for analysis.

Results

Antenatal DEX treatment delayed fetal skeletal growth via inhibiting extracellular matrix (ECM) synthesis and downregulating insulin-like growth factor 1 (IGF1) signaling. Several components of IGF1 signaling pathway, including IGF1 receptor, insulin receptor substrate, as well as serine–threonine protein kinase, were down-regulated in fetal growth plate chondrocytes following DEX treatment.

Conclusion

This study indicated that antenatal DEX treatment-retarded fetal skeletal growth was associated with the down-regulation of IGF1 signaling in growth plate chondrocytes, providing important information about the impact of antenatal DEX application four courses on premature infant.

Keywords

antenatal DEX exposure late pregnancy fetal bone growth IGF1 signaling

Introduction

Systemic glucocorticoids (GCs) are an essential therapy for a range of conditions, but associated with clinically significant toxic effects.^1,2 Long-term GCs therapy can increase bone damage, and the major complications mainly include osteoporosis and cartilaginous bone growth impairment.^2–3 In humans, longitudinal bone growth is rapid during fetal life and early childhood, and GCs have been widely used as a medication for numerous disorders during this period. GCs are considered to be important regulators of osteogenic cell differentiation during bone growth.^3,4 Therefore, both fetus and child exposed or taking GCs often suffer from the harmful side effects on bone development.^5–7 Treatment of childhood asthma, pediatric cancers, or autoimmune diseases with GCs can lead to growth retardation and potentially premature osteoporosis.^6,7 Clinically, synthetic GCs is used antenatally to accelerate premature infant lung maturation. Dexamethasone (DEX), a synthetic GCs, can cross the placenta readily; therefore, it has been widely used for premature delivery. Clinical data suggest that fetal DEX exposure has detrimental effects on neonatal blood pressure, childhood cognition and long-term behavior, the effects of which can be long-lasting or even permanent.^8,9 Clinically short-term administration of DEX can impact fetal bone growth and that effect can vary depending on frequently DEX administered (e.g., single or repeated dose).⁵ However, the side effects of antenatal DEX treatment on fetal bone development, as well as the related mechanisms still remain to be elucidated. Therefore, the aim of this study is to reveal the effects and underlining mechanisms of antenatal DEX treatment-induced fetal bone growth retardation, which would provide helpful information for the early prevention of bone growth retardation in utero growth retardation.

In mammalian, endochondral ossification is one of the skeleton develop processes.^10,11 Longitudinal bone growth occurs at the growth plate as a result of endochondral ossification.¹¹ Growth plate chondrocytes play a central role in the process of endochondral ossification, contributing to longitudinal growth through the extracellular matrix (ECM) components secretion.^10,11 Expression and secretion of cartilage ECM (including Aggrecan, Col2A1, and Col1A1) in growth plate chondrocytes are responsible for bone growth.^10,11 Insulin-like growth factor 1 (IGF1) is an important long bone growth factor, and controls bone growth through stimulating the ECM secretion in growth plate chondrocytes.^12,13 Recently, we and others have discovered that many antenatal insults or stress can cause fetal bone growth retardation by inhibiting IGF1 signaling pathway.^14–16 For example, antenatal nicotine exposure retarded the chondrogenesis through down-regulation of IGF1 signaling pathway to inhibit ECM synthesis of growth plate chondrocytes in fetal rats.¹⁴ Different stressors can be encountered in pregnancy. Notably, both human and animal studies have shown that acute and chronic stress could stimulate production and release of GCs.^9,17–19 GCs are also considered as primary mediators of the organism response to stressors.^9,19 This study speculated that antenatal GCs exposure may also affect fetal bone growth probably via regulating IGF1 signaling.

Materials and methods

Experimental animal

Pregnant Sprague–Dawley rats from the Animal Center of Soochow University were housed singly in a controlled environment of 22°C with a 12-h light/dark cycle, provided with standard rat food and tap water. They were randomly divided into the dexamethasone (DEX) and vehicle (VEH) groups from gestational day 14 (GD14) (N = 20 per group). Pregnant rats in DEX group were intraperitoneally injected once with DEX (200 µg/kg body weight, the dose is consistent with the clinical dosage) on GD14, 16, 18, and 20. The VEH pregnant rats were given the same amount of normal saline at the same time. Pregnant rats were anesthetized at GD21 with sodium pentobarbital (100 mg/kg) intraperitoneally. 8–12 pups per litter were included in the statistics, resorbed and stillborn pups did not been counted. The body weight and body length of pups were measured, respectively. Intrauterine growth restriction (IUGR) rate was diagnosed when the fetal body weight was two standard deviations lower than the mean body weight of the VEH group, and the IUGR rate was calculated according to the following formula: IUGR rate per group (%) = (the sum of IUGR rate per litter/litter number per group) ×100.²⁰ All experiments were approved by the Institutional Animal Care and Use Committee of Soochow University.

Histological and immunohistochemical assays

After cesarean section, rear limb femurs of pups were isolated for subsequent histological and immunohistochemical assays. Femurs were fixed in 4% paraformaldehyde, decalcified and embedded in paraffin. Serial longitudinal sections were stained with hematoxylin and eosin (HE) for quantification of the length of the primary ossification center and hypertrophic zone. The whole length of femur (FL) and the ratio of the calcifying zone (CL) to FL (CL/FL) were evaluated.¹⁶ Safranin O-fast staining was performed to measure femur proteoglycan levels. Immunohistochemistry was performed with a diaminobenzidine kit for determining expressions of Aggrecan (sc-33,695), Col2A1 (sc-52,658), Col1A1 (sc-293,182), IGF1 (sc-74,116), IGF2 (sc-515,805), IGF1R (sc-81,464), Akt (sc-81,434), and IRS1 (sc-515,017) in femur growth plates. The primary antibodies were from Santa Cruz Biotechnology. The slices were visualized under a Nikon microscope, and images were captured and analyzed using Image Pro Plus software. The intensity of immunohistochemistry was determined by measuring the mean optical density (MOD) in 10 sections from different samples.

Quantitative real-time Polymerase Chain Reaction (qRT-PCR) and western blot

Femurs tissues were ground under freezing of liquid nitrogen, total RNA was extracted with the TRIzol reagent (Invitrogen) and quantified by a NanoDrop 2000°C instrument. First-strand cDNA was synthesized from 500–1000 ng total RNA with a high-capacity cDNA reverse-transcription kit (TaKaRa, Dalian, China). Quantitative real-time Polymerase Chain Reaction (qRT-PCR) was performed using SYBR Green Supermix Taq Kit and analyzed on an iQ5 Real-Time PCR Detection System (Bio-Rad). Each qRT-PCR reaction was carried out in triplicate as follows: 60 s at 95°C for initial denaturation, and then 15 s at 95°C and 60 s at 56°C for 40 cycles. Relative gene expression was calculated by the 2^−ΔΔCT method with GAPDH for normalization. The primers were designed mainly using NCBI PRIMER BLAST, and the annealing temperature for each set of primers for the genes used in this study were shown in Table 1.

Table 1.

The list of the primers used in this study.

qRT-PCR Primers		Sequence
Gene name	Sense	Anti-sense	Annealing temperature
Aggrecan	CAGGAATCC CTAGCTGCTT A	CTGAGATCACTGCAGCGATGA	60
Col2A1	GAGTGGAAGAGCGGAGACTACT	CTCCATGTTG CAGAAGACTTTC	58
Col1A1	GCCAAGAAGA CATCCCTGAA	ATAGCACGCC ATCGCACACA	60
IGF1	CTGGTGGACG CTCTTCAGTT	TTCAGCGGAG CACAGTACATC	56
IGF2	GTCGATGTTGGTG CTTCTCA	TTG AAGGCCTGC TGAA GTAG	60
IGF1R	GAATGAAGTCTGGCTCCGGA	TCAGCTGCTGATAGTGCTTG	58
AKT1	GGATACCATG AACGACGTAG	GTGCCAC TGAGAAGTTG TTG	60
AKT2	CTCTCTCAAG CTAGGTGACA	TAGATGAGAGG ATCTCCCGA	61
IRS1	CACCTATGCCA GCATCAAC	GTGAGGTCCTGGTTGTGAAT	58
IRS2	GCCGCCG TGGTGAAAG AGTAA	GACAGCGG AGAGGCAAGC CCT	60

Aggrecan, cartilage aggregating proteoglycan; Col1A1, collagen type A 1; Col2A1, collagen type II A 1; IGF1, insulin-like growth factor-1; IGF2, insulin-like growth factor-2; IGF1R, insulin-like growth factor-1 receptor; AKT1, serine–threonine protein kinase A; AKT2, serine-threonine protein kinase B; IRS1, insulin receptor substrate 1; IRS2, insulin receptor substrate 2.

Protein abundance of Aggrecan, Col2A1, Col1A1, IGF1/2, IGF1R, AKT, and IRS1 in femur growth plates were assessed by Western blot normalized to β-actin. Femurs tissues lysates were extracted using RIPA lysis buffer (Beyotime Biotechnology, Haimen, China) supplemented with protease and phosphatase inhibitor cocktail (Roche, Branford, CT, USA). The protein concentration in lysate was then determined using Pierce BCA protein assay kit (Beyotime Biotechnology, Haimen, China). For the western blot, 20 μg of protein extracts from each sample was loaded onto 8% SDS-PAGE gels and transferred to polyvinylidene difluoride membranes. After blocking with 5% nonfat milk for 2 h at room temperature, the membranes were incubated with specific primary antibodies overnight at 4°C. Then, the membrane was incubated with appropriate secondary antibodies for 1 h at room temperature. Signals were visualized using chemiluminescence and imaging system (EC3-Imaging-System, Upland, CA, USA), and the ratio of band intensity to β-actin was analyzed using the ImageJ software to quantify the relative protein expression. All experiments were repeated three times with independently prepared tissue.^20,21

Isolation fetal growth plate chondrocytes

Fetal growth plate chondrocytes were isolated from pups at GD21 as previously described.^14,16 Briefly, the growth plates of the femur were dissected under an anatomy scope. Minced growth plates were incubated in 0.2% trypsin for 1 h, and then 0.2% collagenase for 3 h. Cell suspension was aspirated repeatedly and filtered through a 70 μm cell strainer, then rinsed first in serum-free Dulbecco’s modified eagle medium (DMEM). After centrifugation at 1200 rpm for 5 min, the chondrocytes were cultured as monolayers in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml streptomycin at 37°C under a humidified atmosphere of 95% air and 5% CO2. Cultures were passaged every 2–3 days in 10 cm² dish and used in experiments between passages 3 and 5. Total RNA was extracted from cells from VEH and DEX fetal femurs for qRT-PCR. To study the effect of DEX on proteoglycan and IGF1 signaling in growth plate chondrocytes in vitro, the cells from VEH fetal femurs were seeded and allowed to grow for 24 h with or without DEX (1 µM), then total RNA were extracted for qRT-PCR.

Data analysis and statistics

All data were analyzed with GraphPad Prism 5.01 software (GraphPad Software, La Jolla, CA, USA), presented as the mean values ±S.E.M. Means between the VEH and DEX groups were compared by independent Student’s t-test. A value of p < .05 was considered statistically significant.

Results

Intrauterine growth restriction rate, and skeletal growth in fetuses

At GD21, fetal body weight in the DEX group was significantly lower than that in the VEH group (3.866 g ± 0.0932 vs 4.803 g ± 0.4034, p < .001, Figure 1(a)), and the IUGR rate was increased from 10.18% (VEH) to 37.14% (DEX) (p < .01, Figure 1(b)). Fetal length was significantly decreased from 4.217 (VEH) to 3.507 cm (DEX) (p < .001, Figure 1(c)). Fetal femur length (FL) was statistically shorter in DEX group than that in VEH group (5.386 vs 6.329 mm, respectively). Moreover, the ratio of femur calcifying zone in the total length of femur (CL/FL) was 30.01%, which was lower than that in VEH group (35.60%) (p < .05, Figures 1(d–f)). The ECM levels were detected in femoral growth plates chondrocytes by Safranin O-fast staining. Compared with the VEH group, the growth plates in DEX group exhibited a deceased level in cartilage ECM proteoglycan (Figure 1(g)). These results indicated that antenatal DEX exposure increased the IUGR rates, and delayed fetal skeletal growth in fetuses.

Figure 1.

Fetal body weight, IUGR rate, fetal length and femur growth at GD21. (A) Fetal body weight. (B) IUGR rate. (C) Fetal length. (D) Hematoxylin and eosin staining of fetal femur; FL, femur lengths, CL, calcifying zone lengths. (E, F) Femur length and CL/FL ratio. (G) Safranin O-fast staining was performed on the femur sections to measure proteoglycan levels; proteoglycan levels in fetal growth plates as determined by measuring mean optical density. DEX, dexamethasone group; VEH, vehicle group; IUGR, intrauterine growth retardation; GD, gestational day; Data are presented as the mean ± SEM, N = 20, N, number of litters; *p < .05; **p < .01.

Inhibiting extracellular matrix levels in the fetal femoral growth plates

Immunohistochemical staining showed that the expressions of Aggrecan, Col2A1, and Col1A1 in the DEX group were lower than those in the VEH group (Figures 2(a)–(d)). qRT-PCR and Western blot assays showed that both mRNA and protein levels of these ECM genes were lower in the DEX group (Figures 2(e) and (f)). These data suggested that antenatal DEX exposure markedly inhibited the synthesis of proteoglycan in the femoral growth plates.

Figure 2.

Secretion of cartilage ECM in the fetal growth plate. (A–D) Levels of Aggrecan, Col2A1 and Col1A1 detected by Immunohistochemical analysis. (E and F) Expressions of Aggrecan, Col2A1 and Col1A1 in fetal growth plate determined by qRT-PCR and Western blot. Data are presented as the mean ± SEM, N = 6; *p < .05; **p < .01; ***p < .001.

Insulin-like growth factor1 signaling in the fetal femoral growth plates

The expressions of IGF1, IGF2, IGF1R, IRS1/2, and AKT/2 in growth plates were determined. As shown in Figures 3(a)–(d), levels of IGF1 and IGF1R were decreased in the DEX group, whereas no significant differences were observed in IGF2 levels between the two groups. Consistently, significant decreases in mRNA and protein levels of IGF1 and IGF1R were observed in the DEX group (Figures 3(e) and (f)). We also determined the levels of IRS1, IRS2, AKT1, and AKT2 in growth plates. As shown in Figure 4, the expressions of IRS1 and AKT1/2 was also significantly decreased in the DEX group.

Figure 3.

Expressions of IGF1, IGF1 and IGF1R in fetal growth plates. (A–D) Expressions of IGF1, IGF2, and IGF1R determined by Immunohistochemical analysis. (E and F) mRNA and protein levels of IGF1, IGF2, and IGF1R in the fetal growth plate. Data are presented as the mean ± SEM, N = 20; *p < .05; **p < .01; ***p < .001.

Figure 4.

Expressions of AKT1/2 and IRS1 in fetal growth plates. (A–C) Immunohistochemical analysis detecting AKT1/2, and IRS1 expressions. (D) mRNA levels of AKT1, AKT2, IRS1, and IRS2. (F) Protein levels of AKT1/2, and IRS1. Data are presented as the mean ± SEM, N = 20; *p < .05; **p < .01; ***p < .001.

The effect of DEX on proteoglycan and IGF1 signaling genes in fetal growth plate chondrocytes in vitro

As already observed in fetal femurs, proteoglycan and IGF1 signaling were also decreased in the isolated DEX-exposed fetal growth plate chondrocytes (Figures 5(a)–(c)). To study the direct effects of DEX on growth plates chondrocytes in vitro, we cultured chondrocytes in DEX-exposed environment for 48 h, and then determined the expressions of ECM and IGF1 signaling genes. DEX exposure caused a significant decrease in expressions of all three ECM-specific genes (Figures 5(d) and (e)). Additionally, DEX exposure also markedly reduced the expressions of IGF1, IGF2, IRS1, and AKT2 in growth plate chondrocytes (Figures 5(f) and (g)). These data indicated that DEX exposure could directly decrease the expressions of ECM and IGF1 signaling genes in growth plate chondrocytes. Summarily, our study indicated antenatal DEX-retarded fetal bone growth was associated with the reduced ECM levels via down-regulating IGF1 signaling in fetal growth plates. Figure 6 summarized the working model for the fetal skeletal growth dysfunction following antenatal DEX treatment.

Figure 5.

The effect of DEX on ECM and IGF1 signaling genes in growth plate chondrocytes in vitro. (A–C) qRT-PCR to detect the expressions of ECM and IGF1 signaling genes in the isolated fetal growth plate chondrocytes in vitro. (D) Cultured growth plate chondrocytes in vitro. (E–G) Expressions of ECM and IGF1 signaling genes under DEX condition. Data are presented as the mean ± SEM, Results from 3–6 independent experiments; *p < .05; **p < .01; ***p < .001.

Figure 6.

A model for a mechanistic explanation of the effect of antenatal DEX treatment on fetal skeletal growth. Antenatal DEX treatment-retarded fetal long bone growth was associated with the reduced ECM levels via the down-regulating IGF1 signaling in fetal growth plates. Summarized the working model for the fetal skeletal growth dysfunction following antenatal DEX treatment.

Discussion

Dexamethasone is increasingly used during the perinatal and neonatal periods. We know relatively little about how antenatal DEX exposure affects signaling molecules during bone development. As the use of antenatal DEX has been extensive, it is very important to understand any potentially harmful side effects on fetal bone development. Therefore, the aim of this study was to provide information on the effects of antenatal DEX usage on fetal bone growth and clarify the mechanisms. The dose of DEX used in human pregnancy is 0.1–0.5 mg/kg body weight every course for indicated preterm labor (e.g., single or repeated dose, usually one to four courses of DEX treatment). Considering the dose conversion between rat and human (conversion factor is 0.16),²² antenatal DEX treatment in rats at 200 µg/kg in this study is comparable with that prescribed for pregnant women (0.15 mg/kg).²³ In addition, time of DEX administration was once every 2 days from GD14 to 20, basically mimic clinical application four courses for preterm labor.

As in previous studies, antenatal DEX treatment could increase IUGR rate, decrease body length and weight.^21,24 This study found that antenatal DEX treatment exhibited an adverse effect on long bone with shortened and less mineralized femur in fetuses. Antenatal DEX treatment could remarkably reduce the expression levels of ECM genes in fetal growth plates, suggesting that antenatal DEX exposure delayed skeletal growth via inhibiting ECM synthesis. Secretion of ECM are controlled by complex endocrine factors, such as IGF1.^25,26 IGF1-deficient mouse exhibits skeletal malformations, indicating that IGF1 signaling was participated in regulating intrauterine fetal skeletal growth.¹³ In addition, when the fetus suffered adverse factors or stress, IGF1 was reported to regulate ECM synthesis of growth plate chondrocytes in fetal bone development process.^14–16 The present study found that the expressions of several components of IGF1 signaling pathway were significantly decreased in the fetal growth plates following antenatal DEX exposure, suggesting that antenatal DEX exposure inhibited ECM synthesis mainly through down-regulating IGF1 signaling. Meanwhile, DEX-exposed growth plate chondrocytes exhibited a significant decrease in expressions of ECM genes and several genes of the IGF1 signaling pathway. These data demonstrated that DEX could decrease ECM synthesis and IGF1 signaling gene expressions in vivo and in vitro, and indicated that antenatal DEX exposure-retarded fetal bone growth was associated with the down-regulation of IGF1 signaling in growth plate chondrocytes.

The behavior of growth plate chondrocytes is tightly regulated by circulating growth hormone, locally produced growth factors (including Indian hedgehog (IHH), Wnt, IGF1, and bone morphogenetic proteins (BMP)) and the components of ECM.^10,27 Like IGF1, the BMP, IHH, and Wnt signaling pathways are also key regulators in the long bone development.^10,27 In this study, we also tested the effects of antenatal DEX exposure on these signaling pathways, and did not observe the abnormal expression of these signaling pathways in fetal femoral growth plate (data not show), indicating that there were unique effects of antenatal DEX exposure on IGF1 signaling with four courses of DEX treatment in late gestational stages. Thus, it is of great significance to take a further step in the research of the precise molecular mechanism of antenatal DEX reprogrammed IGF1 signaling in fetal femoral growth plate, which would be targeted in our future works.

Clinical follow-up studies have shown that the adverse effects of DEX treatment on fetal bone development are substantial in the last trimester of pregnancy.^5–6,28 Infants who had received multiple courses of DEX in intrauterine, had a reduced head circumference at birth.^29–30 A 2-year follow-up study showed similar findings for children exposed to only a single course of DEX during pregnancy.³¹ Numerous animal-based and in vitro studies have also shown that DEX exerts different effects on bone growth at different developmental stages.^32–34 For example, in early gestational stages, antenatal DEX exposure can cause minor cranial-skeletal abnormalities in rhesus macaques.³² In middle and late gestational stages, antenatal DEX exposure shortened long bones in rats.³³ In the late gestational stage, maternal treatment with DEX during the last 24 days resulted in a dramatic reduction in bone mineral density and content finally increasing the risk of fractures of limb bones in piglets.³⁴ In addition, numerous animal data indicated that antenatal GCs exposure have adverse bone effects in the adult offspring, with alterations in parameters of long bones, being a common finding in animal models across several species.^35–38 Over the past several years, several studies have revealed the underline mechanisms of antenatal DEX exposure-induced long bone development retardation.^33,39 For example, Zhang et al.³³ reported prenatal DEX exposure delays endochondral ossification by suppressing chondrocyte maturation, which may be partly mediated by mitogen-inducible gene-6 activation in bone.³³ Here, this study indicated that antenatal DEX exposure impaired fetal long bones growth via decreasing IGF1 signaling gene expression and ECM synthesis. The possible reasons for these different conclusions might be the course and dose, and the gestational week of DEX exposure.

In summary, the present study, established animal model that basically mimic DEX clinical application, revealed that fetal bone growth changes following antenatal DEX treatment and clarified the related mechanisms, providing important information about the impact of antenatal DEX application four courses on premature infant. From a clinical point of view, a fuller understanding of the negative effects of DEX on bone development would have important implications for the routine use of DEX in clinical practice. Of course, further clinical observation of the infants who had received antenatal DEX treatment in pregnancy are necessary to verify our study results.

Footnotes

Author contributions

GQ and ZZ conceived and designed experiments and wrote the article.

GQ, JQ, XF, HD, TX, and MZ performed most of the experiments, analyzed the data, and prepared figures.

All authors reviewed and gave approval of the final draft.

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: Supported partly by Ministry of Science and Technology of China (2019YFA0802600), National Nature and Science Foundation of China (81873841, 81741024, and 814012442), Suzhou “Wei Sheng Ren Cai (GSWS2019029)” program, Suzhou Medical and Industrial Integration Collaborative Innovation Research Project (SL J202012, SKY2021035) and Clinical Trial Institution Capacity Enhancement Project (SLT202003), and General Programs of Jiangsu Commission of Health (M2021087).

ORCID iDs

Gao Qinqin

Zhixiang Zhuang

References

Caplan

Fett

Rosenbach

, et al. Prevention and management of glucocorticoid-induced side effects: a comprehensive review. J Am Acad Dermatol 2017; 76: 201–207.

Henneicke

Gasparini

Brennan-Speranza

, et al. Glucocorticoids and bone: local effects and systemic implications. Trends Endocrinol Metab 2014; 25: 197–211.

Buckley

Humphrey

. Glucocorticoid-induced osteoporosis. N Engl J Med 2018; 379: 2547–2556.

Langenbach

Handschel

. Effects of dexamethasone, ascorbic acid and β-glycerophosphate on the osteogenic differentiation of stem cells in vitro. Stem Cell Res Ther 2013; 4: 117.

Cheng

Wang

Lee

, et al. Dexamethasone use during pregnancy: potential adverse effects on embryonic skeletogenesis. Curr Pharm Des 2014; 20: 5430–5437.

McKinlay

CJD

Cutfield

Battin

, et al. Mid-childhood bone mass after exposure to repeat doses of antenatal glucocorticoids: a randomized trial. Pediatrics 2017; 139(5): e20164250.

Park

Tse

Yang

, et al. A genetic factor associated with low final bone mineral density in children after a long-term glucocorticoids treatment. Pharmacogenomics J 2017; 17: 180–185.

Mildenhall

Battin

Morton

, et al. Exposure to repeat doses of antenatal glucocorticoids is associated with altered cardiovascular status after birth. Arch Dis Child Fetal Neonatal 2006; 91: F56–F60.

Harris

Seck

. Glucocorticoids, prenatal stress and the programming of disease. Horm Behav 2011; 59(3): 279–289.

10.

Mackie

Tatarczuch

Mirams

. The skeleton: a multi-functional complex organ. The growth plate chondrocyte and endochondral ossification. J Endocrinol 2011; 211: 109–121.

11.

Berendsen

Olsen

. Bone development. Bone 2015; 80: 14–18.

12.

Giustina

Mazziotti

Canalis

. Growth hormone, insulin-like growth factors, and the skeleton. Endocr Rev 2008; 29: 535–559.

13.

Wang

Nishida

Sakata

, et al. Insulin-like growth factor-I is essential for embryonic bone development. Endocrinology 2006; 147: 4753–4761.

14.

Deng

Cao

, et al. Nicotine-induced retardation of chondrogenesis through down-regulation of IGF-1 signaling pathway to inhibit matrix synthesis of growth plate chondrocytes in fetal rats. Toxicol Appl Pharmacol 2013; 269: 25–33.

15.

Tan

Liu

Deng

, et al. Caffeine-induced fetal rat over-exposure to maternal glucocorticoid and histone methylation of liver IGF-1 might cause skeletal growth retardation. Toxicol Lett 2012; 214: 279–287.

16.

Yang

Fan

Tao

, et al. Impact of prenatal hypoxia on fetal bone growth and osteoporosis in ovariectomized offspring rats. Reprod Toxicol 2018; 78: 1–8.

17.

Xiao

, et al. The low‐expression programming of 11β‐HSD2 mediates osteoporosis susceptibility induced by prenatal caffeine exposure in male offspring rats. Br J Pharmacol 2020; 177(20): 4683–4700.

18.

Wang

, et al. Effects of prenatal nicotine exposure on hepatic glucose and lipid metabolism in offspring rats and its hereditability. Toxicology 2020; 432: 152378.

19.

Khulan

Drake

. Glucocorticoids as mediators of developmental programming effects. Best Pract Res Clin Endocrinol Metab 2012; 26(5): 689–700.

20.

Fan

Zhao

, et al. DNA methylation-reprogrammed ang II (angiotensin II) type 1 receptor-early growth response gene 1-protein kinase C ε axis underlies vascular hypercontractility in antenatal hypoxic offspring. Hypertension 2021; 77: 491–506.

21.

Zhao

, et al. Antenatal dexamethasone exposure impairs the high-conductance Ca2+-activated K+ channels via epigenetic alteration at gene promoter in male offspring. Arterioscler Thromb Vasc Biol 2020; 40: e284–e295.

22.

Reagan-Shaw

Nihal

Ahmad

. Dose translation from animal to human studies revisited. FASEB J 2008; 22: 659–661.

23.

Jobe

Soll

. Choice and dose of corticosteroid for antenatal treatments. Am J Obstet Gynecol 2004; 190: 878–881.

24.

Chen

Pan

, et al. Dexamethasone induces fetal developmental toxicity through affecting the placental glucocorticoid barrier and depressing fetal adrenal function. Environ Toxicol Pharmacol 2011; 32: 356–363.

25.

Olson

Ohlsson

Mohan

. The role of GH/IGF-I-mediated mechanisms in sex differences in cortical bone size in mice. Calcif Tissue Int 2011; 88: 1–8.

26.

Mohan

Richman

Guo

, et al. Insulin-like growth factor regulates peak bone mineral density in mice by both growth hormone-dependent and -independent mechanisms. Endocrinology 2003; 144: 929–936.

27.

Perrini

Laviola

Carreira

, et al. The GH/IGF1 axis and signaling pathways in the muscle and bone: mechanisms underlying age-related skeletal muscle wasting and osteoporosis. J Endocrinol 2010; 205: 201–210.

28.

Weiler

Paes

Shah

, et al. Longitudinal assessment of growth and bone mineral accretion in prematurely born infants treated for chronic lung disease with dexamethasone. Early Hum Dev 1997; 47: 271–286.

29.

Rodriguez-Pinilla

Prieto-Merino

Dequino

, et al. Exposición prenatal a glucocorticoides para acelerar la maduración pulmonar fetal y su repercusión sobre el peso, la talla y el perímetro cefálico del recién nacido. Med Clin (Barc) 2006; 127: 361–367.

30.

Elfayomy

Almasry

. Effects of a single course versus repeated courses of antenatal corticosteroids on fetal growth, placental morphometry and the differential regulation of vascular endothelial growth factor. J Obstet Gynaecol Res 2014; 40: 2135–2145.

31.

Rijken

Wit

Le Cessie

, et al. The effect of perinatal risk factors on growth in very preterm infants at 2 years of age: the Leiden follow-up project on prematurity. Early Hum Dev 2007; 83: 527–534.

32.

Jerome

Hendrickx

. Comparative teratogenicity of triamcinolone acetonide and dexamethasone in the rhesus monkey (macaca mulatta ). J Med Primatol 1988; 17: 195–203.

33.

Zhang

Shang-Guan

, et al. Mitogen-inducible gene-6 partly mediates the inhibitory effects of prenatal dexamethasone exposure on endochondral ossification in long bones of fetal rats. Br J Pharmacol 2016; 173: 2250–2262.

34.

Sliwa

Dobrowolski

Piersiak

. Bone development of suckling piglets after prenatal, neonatal or perinatal treatment with dexamethasone. J Anim Physiol Anim Nutr (Berl) 2010; 94: 293–306.

35.

Xiao

Wen

Pan

, et al. Increased H3K27ac level of ACE mediates the intergenerational effect of low peak bone mass induced by prenatal dexamethasone exposure in male offspring rats. Cell Death Dis 2018; 9: 638.

36.

Tomaszewska

Dobrowolski

Wydrych

. Postnatal administration of 2-oxoglutaric acid improves articular and growth plate cartilages and bone tissue morphology in pigs prenatally treated with dexamethasone. J Physiol Pharmacol 2012; 63: 547–554.

37.

Tomaszewska

Dobrowolski

Bienko

, et al. Effects of 2-oxoglutaric acid on bone morphometry, densitometry, mechanics, and immunohistochemistry in 9-month-old boars with prenatal dexamethasone-induced osteopenia. Connect Tissue Res 2015; 56: 483–492.

38.

Swolin-Eide

Dahlgren

Nilsson

, et al. Affected skeletal growth but normal bone mineralization in rat offspring after prenatal dexamethasone exposure. Endocrinol 2002; 174: 411–418.

39.

Chen

Zhao

, et al. Course-, dose-, and stage-dependent toxic effects of prenatal dexamethasone exposure on long bone development in fetal mice. Toxicol Appl Pharmacol 2018; 351: 12–20.