Sage Journals: Discover world-class research

Abstract

Background

Solasonine (SS), the main active ingredient of Solanumnigrum L, has been reported to boast extensive anti-tumor, anti-oxidant, and anti-inflammatory properties. This study is committed to exploring whether solasonine can alleviate neurotoxicity resulting from sevoflurane.

Materials and methods

The mouse hippocampal neuron cell line HT22 was treated with sevoflurane and/or solasonine of different doses. The proliferation, inflammation, oxidative stress response, and apoptosis of HT22 cells were examined. The AMP-activated protein kinase (AMPK)/FoxO3a signaling pathway was ascertained through Western blot and cellular immunofluorescence. In in-vivo experiments, Morris water maze figured out the changes in learning and memory abilities of mice treated with 8 mg/kg solasonine and exposed to SEV.

Results

Sevoflurane induced apoptosis and hampered proliferation in HT22 cells. It also aggravated the release of inflammatory factors and oxidative stress mediators. Solasonine weakened neuron damage mediated by sevoflurane in a concentration-dependent pattern. Mechanically, sevoflurane clogged AMPK/FoxO3a signaling pathway activation, which was strengthened by solasonine. AMPK inhibition greatly influenced solasonine’s protective effect on HT22 cells. Invivo, solasonine prominently ameliorated learning and memory disorders and nerve damage in mice exposed to sevoflurane.

Conclusions

Solasonine alleviates sevoflurane-induced neurotoxicity through activating the AMPK/FoxO3a signaling pathway.

Graphical Abstract

Keywords

solasonine sevoflurane neurotoxicity AMP-activated protein kinase FoxO3a pathway apoptosis

1. Introduction

As an inhalant anesthetic, sevoflurane (SEV) has been extensively employed in clinical practices due to its characteristics of low blood/gas ratio, zero irritating odor, rapid onset, quick dissipation, and limited cardiopulmonary inhibition.^1–3 SEV has also become prevalent in the field of pediatric general anesthesia. Notwithstanding, SEV can impede neurogenesis and result in neuronal apoptosis and neuroinflammation.^4-5 It also curbs neural progenitor proliferation, weakens neural stem cells’ self-renewal, and sparks neuroinflammation via mouse microglia.^6-7 These findings have drawn attention to the adverse effects of SEV in the central nervous system.

Solanumnigrum L, a traditional Chinese medicine in the solanum family, can be found worldwide. Its whole herb and fruit are edible. Solanumnigrum L has multiple activities like suppressing cancer development,⁸ curbing liver fibrosis formation,⁹ and protecting the liver.¹⁰ Solasonine (SS), a steroid alkaloid extracted from Solanumnigrum L, exerts an anti-proliferation function in human cancer cell lines and acts as an essential anti-tumor agent.¹¹ SS hampers glioma growth through hindering the p38/p-JNK/MAPK/NF-κBp50/p65 inflammatory signaling pathway.¹² SS also plays a valuable anti-cancer part in solid tumors like colon cancer¹³ and breast cancer.¹⁴ Notwithstanding, whether SS exerts an influence on SEV-caused neurotoxicity remains unknown.

As a member indispensable to the FoxO family, FoxO3a is an important transcriptional regulator pertaining to a variety of cell functions and functions significantly in cell proliferation, apoptosis, and metabolism, etc.¹⁵ FoxO3a is crucial to 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD)-caused neurotoxicity and cognitive and motor dysfunction in female mice. FoxO3a knockdown can stymie p27 (KIP1) transcription and TCDD-inspired apoptosis.¹⁶ AMP-activated protein kinase (AMPK) is a critical kinase engaged in the modulation of cell energy metabolism. AMPK activation can elicit FoxO3A nuclear accumulation, thus influencing autophagy, cell cycle arrest, and cell death.¹⁷ Hydrogen-rich water mitigates neurotoxicity, potential mitochondrial loss, and oxidative stress, which are triggered by Amyloid β through AMPK pathway activation in SK-N-MC cells and Sirt1-FoxO3a up-regulation.¹⁸ Solasonine hampers acute mononuclear leukemia proliferation via initiating the AMPK/FoxO3A axis.¹⁹ Nevertheless, whether solasonine can impact SEV-induced neurotoxicity by regulating the axis still needs to be further explored.

Here, both in-vitro and in-vivo models of SEV-induced neurotoxicity were established, with an aim to investigate SS’s influence on SEV-triggered toxicities, covering nerve inflammation, oxidative stress, nerve cell apoptosis, and cognitive impairment. Hopefully, some novel molecular mechanisms can be discovered in this way to lessen the above toxicities.

2. Materials and methods

2.1 The establishment of the sevoflurane injury model and pretreatment with solasonine

Twenty postnatal-day-6 (P6) C57BL/6 male mice (about 1.7 g in weight) were acquired from the Experimental Animal Laboratory of Xinjiang Medical college. Prior to exposure to sevoflurane, the mice and their mothers were subjected to a 12-h cycle of light and darkness at 24 ± 2°C and with 60 ± 10% humidity for 4 weeks, allowed to access food and water at any time. The study’s design received the all-clear from the Animal Ethics Committee of People’s Hospital of Xinjiang Uygur Autonomous Region, conforming to the standards and guidelines (NIH Publication No. 85–23, revised 1996) for use in animal care laboratories issued by the National Institutes of Health. Efforts were taken to alleviate animal suffering during the whole process.²⁰

The animals fell into four groups: sham (the control group), SEV, SEV and Solasonine (n = 5/group). The P6 mice were intraperitoneally transfused with solasonine (1 mg/kg) or normal saline of the comparable amount 2 h preceding exposure to sevoflurane (3%) or the negative control. Morris water maze (MWM) investigated the learning and memory abilities of the mice. Western blot determined the protein expressions of neurotrophic factors mBDNF, p-TrkB, TrkB, CREB, and the AMPK/FoxO3a signaling pathway and the levels of hippocampal synaptic proteins PSD95 and SYP. Subsequent to sevoflurane exposure, all mice were received euthanasia by CO₂ inhalation. With their brains taken out, the brain tissues were immediately harvested for the follow-up examination.

2.2 Cell culture

Mouse hippocampal neuron cells (HT22) were bought from the Cell Center of the Chinese Academy of Sciences (Shanghai, China). HT22 cells were incubated in a DMEM/F12 medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA), with 5% CO₂ at 37°C. The medium was changed anew twice a week. Morphological alterations were monitored with an inverted phase-contrast microscope (Nikon, Tokyo, Japan).

2.3 Cell counting kit-8 (CCK8) assay

Cell proliferation was gauged in accordance with the instructions of Cell Counting Kit-8 (CCK8, Beyotime, Jiangsu, China). After 3 h’ exposure to 3% sevoflurane (Sigma-Aldrich, St Louis, Mo, USA), the cells (5×10³) were inoculated into a 96-well plate incorporating solasonine of different concentrations (6, 8, and 10 μM). CCK8 solution was added for 12 h’ incubation. The absorbance was measured at 450 nm with the use of a Multiskan3 reader (Thermo Fisher Scientific, USA).

2.4 Detection of apoptosis

Apoptosis was measured through flow cytometry (BD Immunocytometry Systems, San Jose, CA, USA) with the Annexin V-FITC/PI Apoptosis Detection kit (Keygen Biotechnology, Nanjing, China) and FCS ExpressV3 software (De Novo Software, Los Angeles, CA). Cells in each group were identified as unlabeled living cells, PI-stained cells, early apoptotic cells (Annexin V-FITC bounded cells), or double-labeled cells.

2.5 RT-qPCR

Total RNA was extracted from the cells with Trizol reagent (Invitrogen, Waltham, MA, USA) and then reversely transcribed into cDNA with the PrimeScript™ RT Reagent kit (Invitrogen, Shanghai, China) as instructed by the manufacturer. The Bio-Rad CFX96 quantitative PCR system and SYBR were introduced in qPCR, based on the procedures stipulated by the producer. PCR was operated under the following conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 15 s, and annealing at 60°C for 30 s. GAPDH was taken as the internal control to ascertain the expression levels of inflammatory factors TNF-α, IL-1β, and HMGB1, anti-oxidation factors HO-1, NQO1, GCL, and Prx1, and Caspase3, Bad, Bcl-xl, etc. The 2^(-ΔΔCt) method was adopted for statistical analysis. Each experiment was repeated three times. The sequence information of specific primers is detailed in Table 1.

Table 1.

The sequences of primers used for the quantitative real-time PCR assay.

Name of genes	Primer sequence (5^′→3^′)
HO-1	forward: GAGTTTCCGCCTCCAACCAG
HO-1	reverse: AGGAGGCCA TCACCAGCTTA
NQO1	forward: CAGAAACGACA TCACAGGGGA
NQO1	reverse: AGCACTCTCTCAAACCAGCC
GCL	forward: CTGTACCAGTGGGCACAGGTAA
GCL	reverse: TTGGGTCA TTGTGAGTCAGTAGC
Prx1	forward: CCGCTCTGTGGA TGAGA TTCTG
Prx1	reverse: CTTCTGGCTGCTCAAAGCTGTC
TNF-α	forward: AGCCCTACTCTTTGCATGGT
TNF-α	reverse: CATCCTTTCTCCACTGCACG
IL-1β	forward: ACTCATTGTGGCTGTGGAGA
IL-1β	reverse: TTGTTCATCTCGGAGCCTGT
HMGB1	forward: TAATGCTCGTCTTCCAGGGG
HMGB1	reverse: GGTGTGTCCCTGTAATCCCA
Bad	forward: CAACAGTCATCATGGAGGCG
Bad	reverse: GGAACCCTCAAACTCATCGC
Caspase3	forward: GAGCAGCTTTGTGTGTGTGA
Caspase3	reverse: GGCAGGCCTGAATGATGAAG
Bcl-xl	forward: TCCCCTAAACCAGCTCCTTG
Bcl-xl	reverse: AGGCCACACACATCAAAACC
GAPDH	forward: TGATCTTCATGGTCGACGGT
GAPDH	reverse: CCACGAGACCACCACCTACAACT

2.6 Western blot

The cells were rinsed with PBS and lysed in lysate buffer (Beyotime, Shanghai, China). The lysates were incubated on ice for 30 min and oscillated for 30 s. With the supernatant obtained through centrifugation, the protein concentration was gauged with the BCA kit (SolarBio, Beijing, China). The protein was isolated on SDS-PAGE and moved onto polyvinylidene fluoride membranes (GE Healthcare, Little Chalfont, UK). After being sealed, the membranes were incubated overnight at 4°C along with primary antibodies Anti-cleaved-caspase3 Antibody (ab32042), Anti-Bad Antibody (ab32445), Antibody (ab32445), anti-Bcl-XL Antibody (ab32370), and anti-HO-1 Antibody (ab68477), Anti-NQO1 Antibody (ab80588), Anti-GCL Antibody (ab190685), Anti-Prx1 Antibody (ab106834), Anti-mBDNF Antibody (ab108319), Anti-p-TrkB Antibody (ab229908), Anti-TrkB Antibody (ab187041), Anti-CREB Antibody (ab32515), Anti-PSD95 Antibody (ab238135), Anti-SYP Antibody (ab184176), Anti-p-AMPK Antibody (ab23875), Anti-AMPK Antibody (ab110036), Anti-p-FoxO3a Antibody (ab154786), and Anti-FoxO3a Antibody (ab109629). Following three times’ washing, they were incubated for 1 h along with the horseradish peroxidase-conjugated secondary antibody (Zhongshan Golden Bridge, Beijing, China). The antibodies mentioned above were all supplied by Abcam (Cambridge, UK). The spectral band was examined through the molecular imaging instrument Versadoc MP 5000 system (Bio-Rad, Hercules, CA, USA), while the densitometry was determined by Quantity One (Bio-Rad).

2.7 Lipid peroxidation and GSH level determination

Subsequent to sevoflurane exposure, the lipid peroxidation level was gauged as malondialdehyde (MDA) content. MDA (Cat.No. A003-1–2) and GSH (Cat.No. A006-2–1) levels were measured with kits supplied by Nanjing Jiancheng Bioengineering Institute (Nanjing, China), in line with the guidance of the manufacturer.

2.8 Morris water maze test

Morris water maze ascertained the animals’ memory and spatial learning capabilities. Navigation and space probes were utilized in the test. Put simply, the mice were put into the water in four different places. Their escape latency periods (the time spent on finding the hidden platform) and the times they crossed the platform were tallied. With space exploration implemented and the platform discarded, the mice were placed in new locations to swim randomly. The total swimming distance was recorded.

2.9 Cell immunofluorescence

HT22 cells (1×10⁵/ mL) suspended in a 6 mL medium were inoculated in a 6-well plate, and then treated with 6 μM, 8 μM, and 10 μM solasonine, respectively, for 12 h. Cells were gathered in a 1.5 mL Eppendorf tube and fixed with 1% paraformaldehyde for 20 min 0.1% Triton X-100 was administered for 1-h permeation, and 1% BSA was taken for 1-h sealing. The immobilized cells were incubated overnight at 4°C with Anti-FoxO3a (Proteintech, United States, 1:200). After a rinse in PBS, the cells were incubated with the goat anti-IgG/CY-3 secondary antibody (Wuhan Good Bio Technology Co, Ltd, China, 1:500) for 1 h at room temperature and dyed with DAPI (Beyotime, China) for 30 min. In the end, images of the cells were captured employing a camera equipped with a laser-scanning confocal microscope (Zeiss 710, Germany).

2.10 Statistical analysis

The data were analyzed by SPSS22.0 and the GraphPad Prism 8.0 software, displayed as mean ± standard deviation. The student’s t-test was adopted to compare two different groups, while ANOVA was taken for the comparison among multiple groups. p<.05 was regarded as statistically meaningful.

3 Results

3.1 Solasonine hindered mouse hippocampal neuron apoptosis caused by sevoflurane

To uncover the influence of SEV and SS on HT22 hippocampal neurons in mice, we first treated HT22 cells with SEV and SS of varied doses. CCK8 revealed that SEV vigorously dampened neuron proliferation and elicited apoptosis dose-dependently Figure 1(A). SS of different concentrations (0.25, 0.5, 1 μM) exerted no substantial impact on HT22 cell proliferation Figure 1(B). HT22 cells were dealt with SEV (3%) and/or SS. In contrast with the Con group, SEV considerably repressed neuron proliferation and contributed to apoptosis. SS treatment facilitated cell proliferation and curbed apoptosis in a concentration-dependent mode (p <.05, Figure 1(C)-(E)). The pro-apoptotic mediators, including Bad, Caspase3 and Bcl-xL were tested by RT-PCR and Western blot. It was found that SEV promoted Bax, Caspase3/cleaved Caspase3 levels, whereas attenuated Bcl-xL expression. SS treatment reduced Bax, Caspase3/cleaved Caspase3, and enhanced Bcl-xL expression Figure 1(F)-(H). These findings unraveled that SS could impede the SEV-mediated apoptosis on neurons.

Figure 1.

Solasonine hampered mouse hippocampal neuron apoptosis induced by sevoflurane. A: HT22 cells were dealt with SEV of different doses (1.7%, 3.4%, 5.1%). CCK8 examined cell proliferation. B. HT22 cells were treated with SS of different doses (0, 0.25, 0.5, 1 μM). CCK8 monitored cell proliferation. HT22 cells were dealt by SEV (3.4%) and/or SS (0.25, 0.5, 1 μM). C–E: CCK8 and flow cytometry evaluated cell proliferation and apoptosis, respectively. F–H: The mRNA and protein profiles of apoptotic mediators, including Bad, Caspase3, and Bcl-XL were determined by RT-qPCR and Western blot. ***p<.001 (vs. the Con group), &p<.05,&&p<.01,&&&p<.001 (vs. the SEV group) N=3.

3.2 Solasonine hampered the oxidative stress and inflammation of sevoflurane-induced neurons

To look into the influence of SS on oxidative stress and inflammation of HT22 hippocampal neurons, we treated the SEV-induced neurons with SS of various concentrations (0.25, 0.5, 1 μM). MDA and GSH levels were ascertained with corresponding kits. In contrast with the Con group, SEV considerably enhanced MDA activity and dampened GSH level. SS treatment, on the other hand, cramped MDA activity and up-regulated GSH’s level in a concentration-dependent pattern (p <.05, Figure 2(A)-(B)). Given the RT-qPCR results, the SEV group underwent an apparent ascent in the mRNA levels of inflammatory factors TNF-α, IL-1β, and HMGB1 and a considerable descent in the mRNA levels of anti-oxidant factors HO-1, NQO1, GCL, and Prx1, compared to the Con group. By contrast to the SEV group, SS treatment restrained the levels of the above-mentioned cytokines in a concentration-dependent pattern and boosted anti-oxidation cytokine up-regulation (p <.05, Figure 2(C)-(D)). Western blot was further implemented to examine the protein profiles of anti-oxidation factors HO-1, NQO1, GCL, and Prx1, and the outcomes were aligned with those of RT-qPCR. In contrast with the Con group, a vigorous descent in the protein profiles of the above anti-oxidation factors was discovered in the SEV group, whereas SS augmented their protein expressions concentration-dependently (p <.05, Figure 2(E)). These discoveries indicated that SS dampened SEV-sparked oxidative stress and inflammation in neurons.

Figure 2.

Solasonine curbed sevoflurane-induced oxidative stress and inflammation in primary neurons. HT22 cells were treated with SEV (3.4%) and/or SS (0.25, 0.5, 1 μM). A–B: MDA and GSH levels in the cells were gauged with corresponding kits. C–D: RT-qPCR checked the mRNA levels of inflammatory factors TNF-α, IL-1β, and HMGB1 and anti-oxidant factors HO-1, NQO1, GCL, and Prx1. E: Western blot figured out the protein profiles of HO-1, NQO1, GCL, and Prx1. ***p<.001 (vs. the Con group), &p<.05,&&p<.01,&&&p<.001 (vs. the SEV group) N = 3.

3.3 Solasonine upregulated the AMPK/FoxO3a signaling pathway

To develop better insights into the exact mechanism of SS hindering SEV-induced neurotoxicity, we figured out the protein levels of AMPK/FoxO3a through Western blot. In contrast with the Con group, SEV greatly hampered the phosphorylation levels of AMPK and FoxO3a, whereas SS elevated the levels in a concentration-dependent mode in comparison with the SEV group (p <.05, Figure 3(A)-(B)). Cell immunofluorescence corroborated that FoxO3a nuclear translocation was reduced in the SEV group vis-a-vis the Con group. SS treatment brought up the nuclear level of p-FoxO3a (p <.05, Figure 3(C)). These findings disclosed that SS activated the FoxO3a signaling pathway via inducing the expression of AMPK upstream of it and gave rise to FoxO3a nuclear translocation.

Figure 3.

Solasonine up-regulated the AMPK/FoxO3a signaling pathway. HT22 cells were treated by SEV (3.4%) and/or SS (0.25, 0.5, 1 μM). A–B: The protein level of the AMPK/FoxO3a signaling pathway was confirmed by Western blot. C: Cell immunofluorescence inspected FoxO3a (red signal) nuclear translocation. ***p<.001 (vs. the Con group), nsp>.05, &&p<.01,&&&p<.001 (vs. the SEV group) N=3.

3.4 AMPK inhibition weakened the inhibitory impact of solasonine on neuronal apoptosis

Aiming to figure out the specific mechanism of SS curbing apoptosis, we administered 2 μM of the AMPK inhibitor Compound C to the neurons treated with SEV and/or SS (1 μM). CCK8 and flow cytometry examined cell proliferation and apoptosis, respectively, reflecting that SS substantially accelerated cell proliferation and restrained cell apoptosis in contrast with the Con group, while the Compound C group experienced a massive decrease in neuron proliferation and a substantial increase in apoptosis. Compared to the SS group, the SS+Compound C group went through a remarkable reduction in cell proliferation and a notable increase in apoptosis (p <.05, Figure 4(A)-(C)). RT-PCR and Western blot uncovered that by contrast to the Con group, the profiles of pro-apoptotic genes or proteins, including Bad and Caspse3 or cleaved caspase3 were substantially lowered, and the expression of the anti-apoptotic protein Bcl-xL was considerably uplifted following SS treatment. Compound C alone contributed to the opposite phenomenon. In comparison with the SS group, Bad and cleaved caspase3 expressions were notably elevated, while Bcl-xL expression was obviously down-regulated in the SS+Compound C group (p <.05, Figure 4(D)-(E)). In light of these outcomes, AMPK inhibition could impair the anti-apoptotic function of SS.

Figure 4.

AMPK inhibition abated the inhibitory impact of solasonine on neuronal apoptosis. HT22 cells were dealt by SEV (3.4%) and/or solasonine (1 μM), with 2 μM of the AMPK inhibitor Compound C administered to the cells. A–C: CCK8 and flow cytometry monitored cell proliferation and apoptosis, respectively. D–E: The mRNA and protein profiles of apoptotic mediators, including Bad, Caspase3, and Bcl-XL were determined by RT-qPCR and Western blot. **p<.01,***p<.001 (vs. the Con group), &p<.05,&&p<.01,&&&p<.001 (vs. the SS group) N = 3.

3.5 AMPK attenuated the inhibitory impact of solasonine on oxidative stress and inflammation

To find out the specific mechanism of SS impeding neuronal inflammation and oxidative stress, we administered the AMPK inhibitor Compound C (2 μM) to the neurons treated with SS (1 μM). The levels of MDA and GSH were gauged with corresponding kits. In contrast with the Con group, SS clogged MDA activity and enhanced GSH level, while Compound C resulted in the inverted landscape. In comparison with the SS group, MDA activity was markedly repressed, and GSH level was lowered in the SS + Compound C (p <.05, Figure 5(A)-(B)). As denoted by RT-qPCR, in contrast with the Con group, the mRNA levels of inflammatory cytokines TNF-α, IL-1β, and HMGB1 were brought down to a great extent, and those of anti-oxidant factors HO-1, NQO1, GCL, and Prx1 went up remarkably. Compound C upended the outcomes. The levels of the above inflammatory factors were considerably elevated, while those of the anti-oxidant factors were prominently decreased in the SS + Compound C group against the SS group (p <.05, Figure 5(C)-(D)). Western blot checked the protein profiles of HO-1, NQO1, GCL, Prx1, and the AMPK/FoxO3a signaling pathway, displaying that SS treatment bolstered the protein profiles of the above factors and the signaling pathway compared with the Con group, but such an effect was reversed by Compound C. In contrast with the SS group, their expressions in the SS + Compound C group were substantially suppressed (p <.05, Figure 5(E)-(F)). As disclosed by the outcomes, AMPK inhibition could abate SS’s restraint on oxidative stress and inflammation of primary neurons.

Figure 5.

AMPK inhibition attenuated the inhibitory impact of solasonine on oxidative stress and inflammation. HT22 cells were treated with SEV (3.4%) and/or solasonine (1 μM), with 2 μM of the AMPK inhibitor Compound C administered to the cells. A-B: MDA and GSH levels in the cells were measured with corresponding kits. C-D: RT-qPCR checked the mRNA levels of inflammatory factors TNF-α, IL-1β, and HMGB1 and anti-oxidant factors HO-1, NQO1, GCL, and Prx1. E-F: Western blot determined the protein profiles of anti-oxidant factors HO-1, NQO1, GCL, and Prx1 and the AMPK/FoxO3a signaling pathway. **p<.01,***p<.001 (vs. the Con group), &p<.05,&&p<.01,&&&p<.001 (vs. the SS group) N = 3.

3.6 Solasonine relieved cognitive impairment in mice exposed to sevoflurane invivo

To better understand the influence of SS on the cognitive function of mice exposed to SEV, we carried out in-vivo experiments on mice. Morris water maze (MWM) evaluated the mice’s learning and memory abilities. As shown by the results, the swimming latency of the mice exposed to SEV was greatly extended, but it could be reduced by the administration of SS (p <.05, Figure 6(A)-(B)). The target quadrant residence time and platform crossing area of the mice were notably on the rise in the SEV group as opposed to the sham group, while those of the mice treated with SS were substantially decreased (p <.05, Figure 6(C)-(D)). These phenomena revealed that SS could enhance the learning and memory capabilities of mice subsequent to SEV exposure.

Figure 6.

Solasonine ameliorated cognitive impairment in the mice exposed to sevoflurane invivo. The mice under sevoflurane exposure (3%) were intraperitoneally transfused with solasonine (1 mg/kg) for in-vivo experiments. The learning and memory abilities of mice exposed to SEV were examined by Morris water maze test. A-B: The swimming path diagram and swimming latency period of the mice. C-D: The target quadrant residence time and platform crossing area of the mice. ***p<.001 (vs. the sham group), &&&p<.001 (vs. the SEV group) N = 5.

3.7 Solasonine up-regulated AMPK/FoxO3a invivo

In-vivo experiments were implemented to further explore the influence of SS on nerve damage in mice after SEV exposure. The protein profiles of neurotrophic factors mBDNF, TrkB, and CREB were confirmed by Western blot. Their protein expressions were hugely decreased in the SEV group against the sham group. However, after an intervention with 1 mg/kg SS, their expressions were dramatically uplifted (p < .05, Figure 7(A)). Synaptic density is indispensable to the brain’s ability to learn and memorize. The representative proteins pertaining to synaptic density encompass postsynaptic density protein 95 (PSD95) and synaptophysin (SYP). We further looked into the protein profiles of hippocampal synaptic proteins PSD95 and SYP and the signaling AMPK/FoxO3a pathway via Western blot. The protein profiles of PSD95, SYP, and the AMPK/FoxO3a signaling pathway were greatly restrained in the SEV group vis-a-vis the sham group. But SS intervention (1 mg/kg) apparently up-regulated the profiles of the genes (p <.05, Figure 7(B)-(C)). The findings denoted that SS could mitigate mouse nerve injury arising from SEV invivo.

Figure 7.

Solasonine up-regulated the AMPK/FoxO3a pathway in the hippocampus of the mice exposed to sevoflurane. The mice under sevoflurane exposure (3%) were intraperitoneally transfused with solasonine (1 mg/kg) for in-vivo experiments. A: The protein profiles of neurotrophic factors mBDNF, TrkB, and CREB were confirmed through Western blot. B–C: Western blot verified the protein profiles of hippocampal synaptic proteins PSD95 and SYP and the AMPK/FoxO3a signaling pathway. ***p<.001 (vs. the sham group), &&p<.01,&&&p<.001 (vs. the SEV group) N = 5.

4. Discussion

Sevoflurane, one of the most extensively used volatile anesthetics in clinical practices, has been reported to trigger severe neuronal apoptosis, long-term memory impairment, and cognitive disorder.^21-22 The present study concentrates on how solasonine, the primary active ingredient of Solanumnigrum L, influences neurotoxicity in mice exposed to SEV. It turns out that solasonine can stymie mice’s neuronal apoptosis oxidative stress and inflammation, which are caused by SEV, via activating the AMPK/FoxO3a pathway, thus protecting nerves from damage. We may offer a novel molecular mechanism for mitigating SEV-incurred nerve injury in mice.

Solasonine, a steroidal alkaloid, is mainly discovered in Solanumnigrum L. Solasonine chiefly plays its significant suppressive role in solid tumors like liver cancer²³ and bladder cancer,²⁴ but we are still in the dark about its influence on neurons. Solasodine and tomatidine, similar to solasonine, are steroidal alkaloids stemming from solasonine plants. The anti-oxidant activity of solasodine can shield the mouse brain from ischemia reperfusion injury.²⁵ More significantly, solasodine is also of great importance in enhancing neurogenesis invitro and invivo.²⁶ Strengthened lysosome activity can relieve OGD/R-induced N₂ cell and neuron damage, bringing into full play tomatidine’s neuroprotective function in ischemic injury.²⁷ Given these studies, we have ventured to surmise that solasonine, subordinate to this kind of steroid alkaloids, may also exert a neuroprotective function. Anesthetic exposure can step up cell apoptosis through Bax up-regulation and caspase3 activation.²⁸ Here, Western Blot indicated that sevoflurane resulted in increased Cleaved caspase-3 expression. Moreover, the level of Bad was considerably elevated, whereas that of Bcl-xL was brought down, which displayed that the apoptotic pathways were initiated. These findings jibe with the previous studies.²⁹ Nonetheless, Solasonine curbed the rise in SEV-triggered apoptosis, and relieved inflammatory factor expression. Sevoflurane helped achieve MDA level up-regulation and GSH level down-regulation, which aggravate neuron damage,³⁰ while solasonine reversed the situation. The aforementioned results revealed that solasonine could prominently ameliorate neuronal apoptosis, oxidative stress, and inflammatory damage in mice exposed to sevoflurane.

As a typical signaling pathway, the AMPK pathway is of great significance in terms of anti-inflammation, anti-apoptosis, anti-oxidative stress, and so on.^31-32 Two major upstream kinases, including the LKB1³³ and the Ca₂ + /calmodulin-activated protein kinases kinase (CaMKKβ),³⁴ are significantly altered during neuron injury caused by oxygen-glucose deprivation (OGD). In addition to ADP/AMP changes in the cellular level, LKB1 or CaMKKβ can also activate AMPK pathway.³⁵ LKB1- or CaMKKβ-mediated AMPK pathway activation prevents neuronal apoptosis induced by hypoxia-ischemia.^36-37 After sevoflurane treatment, CaMKKβ was markedly downregulated in the hippocampus of rats,³⁸ and AMPK/SIRT1 activity was inhibited, accompanied with increased neuronal apoptosis,³⁹ suggesting sevoflurane plays a role in neuron damage by altering AMPK pathway. Presently, we also observed that sevoflurane caused neuron apoptosis and inhibited AMPK/FoxO3a axis.

Recently, increasing bioactive components have been found with neuroprotective effects by activating AMPK/FoxO3a pathway. For instance, Metformin (MTF), an antidiabetic medication and AMPK regulator, protects against rotenone-induced nigrostriatal neuronal death by upregulating AMPK-FOXO3 protein.⁴⁰ Catechin abates TNF-α-incurred inflammation in 3T3-L1 adipocytes by upregulating AMPK/FoxO3a pathway.^3,41 These discoveries demonstrate that the AMPK/FoxO3A signaling pathway may exert a considerable protective function in inflammation and injury related to diverse diseases. Interestingly, a recent study supports that solasonine has a regulatory role in AMPK/FoxO3A pathway,¹⁹ and we found that Solasonine heightened the protein expression of the pathway in HT22 neuronal cells. AMPK inhibition greatly impaired the inhibitory impact of solasonine on neuronal apoptosis, oxidative stress, and inflammation, which revealed that this substance could relieve SEV-mediated nerve lesions and inflammation by triggering the AMPK/Foxo3a pathway. What is more, the in-vivo researches signified that solasonine remarkably mitigated learning and memory impairments in mice under sevoflurane exposure, uplifted the protein profiles of neurotrophic factors mBDNF, TrkB, and CREB and hippocampal synaptic proteins PSD95 and SYP, and ameliorated hippocampal nerve damage caused by sevoflurane. All these discoveries disclosed that solasonine played an essential neuroprotective role in sevoflurane-mediated neurotoxicity via AMPK/FoxO3a pathway activation.

To summarize, the sevoflurane-induced mouse nerve injury model established here unravels that solasonine may be a new candidate drug against SEV-elicited nerve damage, able to exert protective effects like anti-inflammation, anti-oxidative stress, and anti-neuron apoptosis in neuron damage elicited by sevoflurane via AMPK/FoxO3a pathway activation. Nevertheless, how solasonine affects AMPK/FoxO3a pathway activation needs further exploration.

Abbreviati ons

SS: Solasonine; AMPK, AMP: activated protein kinase; SEV: sevoflurane; TCDD: tetrachlorodibenzo-p-dioxin; P6: postnatal-day-6; MWM: Morris water maze; HT22: Mouse hippocampal neuron cells; FBS: fetal bovine serum; FoxO3a: Forkhead box O3

Footnotes

Author’s contribution

Conceived and designed the experiments: Lei Yan; Performed the experiments: Huifang Zhang, Lei Yan; Statistical analysis: Huifang Zhang; Wrote the paper: Huifang Zhang, Lei Yan. All authors read and approved the final manuscript.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Ethics statement

Our study was approved by the Animal Ethics Committee of People’s Hospital of Xinjiang Uygur Autonomous Region

Data availability statement

The data sets used and analyzed during the current study are available from the corresponding author on reasonable request.

ORCID iD

Lei Yan

References

Edwards

Shah

Cao

, et al. Bumetanide alleviates epileptogenic and neurotoxic effects of sevoflurane in neonatal rat brain. Anesthesiology 2010; 112(3): 567–575. DOI: 10.1097/ALN.0b013e3181cf9138 (PMID: 20124973.

Gibert

Sabourdin

Louvet

, et al. Epileptogenic effect of sevoflurane. Anesthesiology 2012; 117(6): 1253–1261. DOI: 10.1097/ALN.0b013e318273e272 (PMID: 23103557.

Cheng

Tan

Sun

, et al. Catechin attenuates TNF-α induced inflammatory response via AMPK-SIRT1 pathway in 3T3-L1 adipocytes. PLoS One 2019; 14(5): e0217090. DOI: 10.1371/journal.pone.0217090 (PMID: 31100089.

Shen

Dong

, et al. Selective anesthesia-induced neuroinflammation in developing mouse brain and cognitive impairment. Anesthesiology 2013; 118(3): 502–515. DOI: 10.1097/ALN.0b013e3182834d77 (PMID: 23314110.

Zhang

Dong

Zheng

, et al. Sevoflurane inhibits neurogenesis and the Wnt-catenin signaling pathway in mouse neural progenitor cells. Curr Mol Med 2013; 13(9): 1446–1454. DOI: 10.2174/15665240113139990073. PMID: 23971735.

Nie

Peng

Lao

, et al. Effects of sevoflurane on self-renewal capacity and differentiation of cultured neural stem cells. Neurochem Res 2013; 38(8): 1758–1767. DOI: 10.1007/s11064-013-1074-4 (Epub 2013 Jun 12. PMID: 23756731.

Zhang

Yang

, et al. Isoflurane and sevoflurane increase interleukin-6 levels through the nuclear factor-kappa B pathway in neuroglioma cells. Br J Anaesth 2013; 110(Suppl 1): i82–i91. DOI: 10.1093/bja/aet115 (Epub 2013 Apr 19. PMID: 23604542.

Pan

Zhong

Deng

, et al. Inhibition of prostate cancer growth by solanine requires the suppression of cell cycle proteins and the activation of ROS/P38 signaling pathway. Cancer Med 2016; 5(11): 3214–3222. DOI: 10.1002/cam4.916 (Epub 2016 Oct 10. PMID: 27726305.

Tai

Choong

Shi

, et al. Solanum nigrum protects against hepatic fibrosis via suppression of hyperglycemia in high-fat/ethanol diet-induced rats. Molecules 2016; 21(3): 269. DOI: 10.3390/molecules21030269. PMID: 26927042.

10.

Liu

, et al. Hepatoprotective effects of solanum nigrum against ethanol-induced injury in primary hepatocytes and mice with analysis of glutathione S-transferase A1. J Chin Med Assoc 2016; 79(2): 65–71. DOI: 10.1016/j.jcma.2015.08.013 (Epub 2016 Jan 8. PMID: 26775601.

11.

Zhang

Han

Cao

, et al. Solasonine inhibits gastric cancer proliferation and enhances chemosensitivity through microRNA-486-5p. Am J Transl Res 2020; 12(7): 3522–3530 (PMID: 32774717.

12.

Wang

Zou

Lan

, et al. Solasonine inhibits glioma growth through anti-inflammatory pathways. Am J Transl Res 2017; 9(9): 3977–3989 (PMID: 28979674.

13.

Namgyal

Ali

Mehta

, et al. The neuroprotective effect of curcumin against Cd-induced neurotoxicity and hippocampal neurogenesis promotion through CREB-BDNF signaling pathway. Toxicology 2020; 442: 152542. DOI: 10.1016/j.tox.2020.152542 (Epub 2020 Jul 28. PMID: 32735850.

14.

Friedman

. Chemistry and anticarcinogenic mechanisms of glycoalkaloids produced by eggplants, potatoes, and tomatoes. J Agric Food Chem 2015; 63(13): 3323–3337. DOI: 10.1021/acs.jafc.5b00818 (Epub 2015 Mar 30. PMID: 25821990.

15.

Nho

Hergert

. FoxO3a and disease progression. World J Biol Chem 2014; 5(3): 346–354. DOI: 10.4331/wjbc.v5.i3.346. PMID: 25225602.

16.

Liu

Yoshimoto

, et al. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces expression of p27kip1 and FoxO3a in female rat cerebral cortex and PC12 cells. Toxicol Lett 2014; 226: 294–302.

17.

Chiacchiera

Simone

. The AMPK-FoxO3A axis as a target for cancer treatment. Cell Cycle 2010; 9(6): 1091–1096. DOI: 10.4161/cc.9.6.11035 (Epub 2010 Mar 15. PMID: 20190568.

18.

Lin

Huang

, et al. Hydrogen-rich water attenuates amyloid β-induced cytotoxicity through upregulation of Sirt1-FoxO3a by stimulation of AMP-activated protein kinase in SK-N-MC cells. Chem Biol Interact 2015; 240: 12–21. DOI: 10.1016/j.cbi.2015.07.013 (Epub 2015 Aug 10. PMID: 26271894.

19.

Zhang

Tian

Jiang

, et al. Solasonine suppresses the proliferation of acute monocytic leukemia through the activation of the AMPK/FoxO3a axis. Front Oncol 2021; 10: 614067. DOI: 10.3389/fonc.2020.614067 (PMID: 33585239.

20.

National Research Council (US) . Committee for the Update of the Guide for the Care and Use of Laboratory Animals. Guide for the Care and Use of Laboratory Animals. 8th ed. Washington DC: National Academies Press (US), 2011 (PMID: 21595115.

21.

Berry

Nedivi

. Spine dynamics: are they all the same? Neuron 2017; 96(1): 43–55. DOI: 10.1016/j.neuron.2017.08.008. PMID: 28957675.

22.

Satomoto

Satoh

Terui

, et al. Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 2009; 110(3): 628–637. DOI: 10.1097/ALN.0b013e3181974fa2 (PMID: 19212262.

23.

Zheng

Cheng

, et al. Sevoflurane causes neuronal apoptosis and adaptability changes of neonatal rats. Acta Anaesthesiol Scand 2013; 57(9): 1167–1174. DOI: 10.1111/aas.12163 (Epub 2013 Jul 29. PMID: 23889296.

24.

Liu

Tang

, et al. The reciprocal interaction between LncRNA CCAT1 and miR-375-3p contribute to the downregulation of IRF5 gene expression by solasonine in HepG2 human hepatocellular carcinoma cells. Front Oncol 2019; 9: 1081. DOI: 10.3389/fonc.2019.01081 (PMID: 31681610.

25.

Miranda

Silva

Carvalho

IPS

, et al. Targeted uptake of folic acid-functionalized polymeric nanoparticles loading glycoalkaloidic extract in vitro and in vivo assays. Colloids Surf B: Biointerfaces 2020; 192: 111106. DOI: 10.1016/j.colsurfb.2020.111106 (Epub ahead of print. PMID: 32474325.

26.

Sharma

Airao

Panara

, et al. Solasodine protects rat brain against ischemia/reperfusion injury through its antioxidant activity. Eur J Pharmacol 2014; 725: 40–46. DOI: 10.1016/j.ejphar.2014.01.005 (Epub 2014 Jan 17. PMID: 24444441.

27.

Lecanu

Hashim

McCourty

, et al. The naturally occurring steroid solasodine induces neurogenesis invitro and invivo. Neuroscience 2011; 183: 251–264. DOI: 10.1016/j.neuroscience.2011.03.042 (Epub 2011 Apr 7. PMID: 21496476.

28.

Ahsan

Zheng

, et al. Tomatidine protects against ischemic neuronal injury by improving lysosomal function. Eur J Pharmacol 2020; 882: 173280. DOI: 10.1016/j.ejphar.2020.173280 (Epub 2020 Jun 21. PMID: 32580039.

29.

Wang

Yang

, et al. N-stearoyl-l-tyrosine ameliorates sevoflurane induced neuroapoptosis via MEK/ERK1/2 MAPK signaling pathway in the developing brain. Neurosci Lett 2013; 541: 167–172. DOI: 10.1016/j.neulet.2013.02.041 (Epub 2013 Mar 5. PMID: 23470632.

30.

Istaphanous

Howard

Nan

, et al. Comparison of the neuroapoptotic properties of equipotent anesthetic concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 2011; 114(3): 578–587. DOI: 10.1097/ALN.0b013e3182084a70 (PMID: 21293251.

31.

Wang

Zeng

Zhang

, et al. Lipid peroxidation was involved in the memory impairment of carbon monoxide-induced delayed neuron damage. Neurochem Res 2009; 34(7): 1293–1298, DOI: 10.1007/s11064-008-9908-1.

32.

Lyons

Roche

. Nutritional Modulation of AMPK-Impact upon Metabolic-Inflammation. Int J Mol Sci 2018; 19(10): 3092, DOI: 10.3390/ijms19103092.

33.

Kosuru

Kandula

Rai

, et al. Pterostilbene decreases cardiac oxidative stress and inflammation via activation of AMPK/Nrf2/HO-1 pathway in fructose-fed diabetic rats. Cardiovasc Drugs Ther 2018; 32(2): 147–163, DOI: 10.1007/s10557-018-6780-3.

34.

Xie

Ding

Shen

. Silibinin activates AMP-activated protein kinase to protect neuronal cells from oxygen and glucose deprivation-re-oxygenation. Biochem Biophys Res Commun 2014; 454(2): 313–319, DOI: 10.1016/j.bbrc.2014.10.080.

35.

Rousset

Leiper

Kichev

, et al. A dual role for AMP-activated protein kinase (AMPK) during neonatal hypoxic-ischaemic brain injury in mice. J Neurochem 2015; 133(2): 242–252, DOI: 10.1111/jnc.13034.

36.

Hardie

Ross

Hawley

. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol 2012; 13(4): 251PMC5726489–262. DOI: 10.1038/nrm3311. PMID: 22436748.

37.

Zhang

Doycheva

, et al. Adiponectin attenuates neuronal apoptosis induced by hypoxia-ischemia via the activation of AdipoR1/APPL1/LKB1/AMPK pathway in neonatal rats. Neuropharmacology 2018; 133: 415–428, DOI: 10.1016/j.neuropharm.2018.02.024.

38.

Zhang

Ding

, et al. Chemerin reverses neurological impairments and ameliorates neuronal apoptosis through ChemR23/CAMKK2/AMPK pathway in neonatal hypoxic-ischemic encephalopathy. Cell Death Dis 2019; 10(2): 97, DOI: 10.1038/s41419-019-1374-y.

39.

Ling

Zhang

Wang

, et al. Changes of CaM-CaMK-CREB signaling pathway and related neuron factors in hippocampus of rats after sevoflurane and propofol administration. Eur Rev Med Pharmacol Sci 2021; 25(2): 957–967.

40.

Liu

Fang

. AMPK-SIRT1 pathway dysfunction contributes to neuron apoptosis and cognitive impairment induced by sevoflurane. Mol Med Rep 2021; 23(1): 56, DOI: 10.3892/mmr.2020.11694.

41.

El-Ghaiesh

Bahr

Ibrahiem

, et al. Metformin protects from rotenone-induced nigrostriatal neuronal death in adult mice by activating AMPK-FOXO3 signaling and mitigation of angiogenesis. Front Mol Neurosci 2020; 13: 84, DOI: 10.3389/fnmol.2020.00084.

Solasonine relieves sevoflurane-induced neurotoxicity via activating the AMP-activated protein kinase/FoxO3a pathway

Abstract

Background

Materials and methods

Results

Conclusions

Keywords

1. Introduction

2. Materials and methods

2.1 The establishment of the sevoflurane injury model and pretreatment with solasonine

2.2 Cell culture

2.3 Cell counting kit-8 (CCK8) assay

2.4 Detection of apoptosis

2.5 RT-qPCR

2.6 Western blot

2.7 Lipid peroxidation and GSH level determination

2.8 Morris water maze test

2.9 Cell immunofluorescence

2.10 Statistical analysis

3 Results

3.1 Solasonine hindered mouse hippocampal neuron apoptosis caused by sevoflurane

3.2 Solasonine hampered the oxidative stress and inflammation of sevoflurane-induced neurons

3.3 Solasonine upregulated the AMPK/FoxO3a signaling pathway

3.4 AMPK inhibition weakened the inhibitory impact of solasonine on neuronal apoptosis

3.5 AMPK attenuated the inhibitory impact of solasonine on oxidative stress and inflammation

3.6 Solasonine relieved cognitive impairment in mice exposed to sevoflurane invivo

3.7 Solasonine up-regulated AMPK/FoxO3a invivo

4. Discussion

Footnotes

Author’s contribution

Declaration of conflicting interests

Funding

Ethics statement

Data availability statement

ORCID iD

References