Notoginsenoside R1 protects hypoxia-reoxygenation deprivation-induced injury by upregulation of miR-132 in H9c2 cells

Abstract

Background:

Myocardial ischemia/reperfusion injury (IRI) is a common perioperative complication of heart and great vessels surgery, aggravating the original myocardial damage and seriously affecting the postoperative recovery of cardiac function. The aim of this study was to reveal the functional effects and potential mechanisms of notoginsenoside R1 (NG-R1) in myocardial cells injured by hypoxia-reoxygenation (H/R).

Methods:

The rat cardiomyocyte line H9c2 was subjected to H/R with or without NG-R1 treatment. The levels of miR-132 and HBEGF in the cell were altered by microRNA or short-hairpin RNA transfection. Cell viability, apoptosis, lactate dehydrogenase (LDH) and malondialdehyde (MDA) were monitored. Dual luciferin was used to detect the relationship between miR-132 and HBEGF.

Results:

NG-R1 (20 μM) had no impact on H9c2 cells, but cell viability was significantly reduced at 80 μM. NG-R1 (20 μM) protected H9c2 cells against H/R-induced cell damage, accompanied by increased cell viability, reduced cell apoptosis, and downregulation of LDH and MDA. Furthermore, the level of miR-132 was decreased in response to H/R exposure but then increased after NG-R1 treatment. When miR-132 was overexpressed, H/R-induced cell damage could be recovered. Downregulation of miR-132 limited the protective effect of NG-R1 on H/R damage. We also found that HBEGF was a direct target of miR-132. The expression of HBEGF was increased upon H/R damage, and this increase was reversed after NG-R1 treatment.

Conclusions:

This study demonstrated that NG-R1 markedly protected H9c2 cells against H/R-induced damage via upregulation of miR-132 and downregulation of its target protein HBEGF.

Keywords

HBEGF apoptosis lactate dehydrogenase malondialdehyde myocardial ischemia/reperfusion injury

Introduction

Ischemic heart disease (IHD) is a serious threat to health for middle-aged and elderly people.¹ Statistics predicted that coronary heart disease would be the top cause of death for humans by 2020 and that the number of deaths from IHD in China could reach 4 million per year.² Revascularization is an important measure for the treatment of severe IHD, but there are strict limitations on the treatment time window and applicable population. Studies have found that even in myocardial infarction patients with grade 3 thrombolytic blood flow, more than 30% fail to recover the level of myocardial tissue perfusion, and in severe cases, no reflow may occur.³ Following the great success of therapies to reduce ischemic injury, researchers have focused on reducing ischemia/reperfusion (I/R) injury.^4–6 However, there is currently no effective clinical treatment.

Heptanoside R1 (notoginsenoside R1, NG-R1) is the main vasoactive component of notoginsenoside. NG-R1 was found to protect smooth muscle cells by inhibiting the production of tumor necrosis factor (TNF)-A-induced fibronectin through the reactive oxygen species (ROS)/extracellular signal-regulated kinase (ERK) pathway.⁷ NG-R1 also inhibited the expression of plasminogen activator inhibitor-1 (PAI-1) in human aortic smooth muscle cells induced by inhibiting the ERK and protein kinase B (PKB) pathways.⁸ NG-R1 has been shown to protect many tissues and organs from injury. NG-R1 can inhibit NF-κB activity through the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) signaling pathway, thereby reducing lipopolysaccharide (LPS) damage to myocardial cells.⁹ In diabetic nephropathy models, NG-R1 reduced basement membrane damage by maintaining integrin-linked kinase activity.¹⁰ In acute hepatocyte injury, NG-R1 reduces the expression of tumor necrosis factor to reduce cell damage.¹¹ NG-R1 can stimulate estrogen receptors, so it is also known as a natural phytoestrogen.¹² NG-R1 can regulate the Akt/Nrf2 signaling pathway or tumor necrosis factor through the estrogen receptor under pathological conditions.¹³ NG-R1 could reduce renal damage caused by ischemia or tubular disease by inhibiting endoplasmic reticulum (ER) stress.¹⁴

An increasing number of studies have found that the expression of miRNAs is tissue-specific.¹⁵ MiRNAs specifically expressed in cardiomyocytes include miRNA-21, miRNA-1, miR-133a, iniR-133b, and miR-296, which are involved in heart development, myocardial cell apoptosis, myocardial remodeling, arrhythmia, heart failure, myocardial hypertrophy and other pathophysiological processes.¹⁶ MiR-132 prevents apoptosis of cardiomyocytes under hypoxic conditions.¹⁷ At present, there are few studies on miRNAs in the myocardium. It is thus necessary to illuminate their roles and regulatory mechanisms in ischemia-reperfusion injury.

Materials and methods

Cell culture and hypoxia/reoxygenation cell damage models

The H9C2 cardiomyocyte cell line was purchased from the American Type Culture Collection (ATCC). H9C2 cells were cultured in 10% fetal bovine serum in DMEM. The establishment of the H9C2 cell hypoxia/reoxygenation model was performed as previously described.¹⁸ Serum-free and sugar-free DMEM was used as hypoxic/ischemic fluid. For the hypoxia (ischemia) model, the hypoxic fluid was balanced with mixed gas (95% N₂ and 5% CO₂) for more than 2 hours, added to the cells and placed in a humidified atmosphere at 37°C containing 95% N₂ and 5% CO₂. For the reoxygenation (reperfusion) model, after 6 hours of the above ischemia model, the culture conditions were replaced by 95% air and 5% CO₂ for 0, 6, 18 and 24 hours.

NG-R1 with a purity greater than 98% was purchased from Sigma Aldrich. NG-R1 was dissolved in dimethyl sulfoxide. H9c2 cells were treated with 5 to 80 µM of NG-R1.

Cell transfection

H9C2 cells were inoculated into six-well plates at a cell density of 5 × 10⁵/well. MiR-132 mimic or mimic control, inhibitor or NC plasmid was mixed with Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc., CA, USA) and then transfected into H9C2 cells.

Cell viability

The cells were seeded in 96-well plates at a cell density of 5000 cells/well. After NG-R1 treatment, cell counting kit-8 (CCK-8; Dojindo Molecular Technologies, Kyushu, Japan) solution (5 mg/mL, 20 µL) was added to each well. The plates were incubated at 37°C for 3 hours, after which the absorbance was measured at 450 nm using a microplate reader (Bio-Rad, Hercules, CA).

Cell apoptosis

An Annexin V-FITC/PI Apoptosis Detection Kit (Beijing Biological Marine Biotechnology Co., Ltd., Beijing, China) was used to detect apoptosis. H9C2 cells were seeded in six-well plates at a density of 5 × 10⁵/well. After NG-R1 treatment, the cells were stained with FITC-Annexin V and propidium iodide (PI) and analyzed by flow cytometry.

Lactate dehydrogenase (LDH) level and measurement of malondialdehyde (MDA) activity

H9C2 cells were seeded in 96-well plates. LDH activity and MDA were determined using the appropriate kits (C0017, Beyotime, China).

RT-qPCR

TRIzol (Invitrogen, Carlsbad, CA, USA) was used to extract the total RNA. The PrimeScript RT Reagent Kit (Takara, Japan) was employed to reverse transcribe RNA into cDNA according to the manufacturer recommendations. Bio-Rad CFX96 and SYBR Green Premix Ex Taq II (Bio-Rad, USA) were used for RT-PCR. GAPDH was used as an internal reference gene, and the 2^−ΔΔCt method was used for statistical analysis. The primers are shown in Table 1.

Table 1.

Primer sequences of related genes.

Primer	Forward (5′-3′)	Reverse (5′-3′)
U6	CTTCGGCAGCACATATAC	GAACGCTTCACGAATTTGC
miR-132	GCGCGCGTAACAGTCTACAGC	GTCGTATCCAGTGCAGGGTCC
GAPDH	TCAAGGCTGAGAACGGGAAG	TGGACTCCACGACGTACTCA
HBEGF	CTCTTTCTGGCTGCAGTTCTC	AGCTGGTCCGTGGATACAGT

Western blot

RIPA lysis buffer was utilized to extract total proteins. Then, the protein concentration was detected by a BCA protein assay kit. Total proteins were separated by SDS-PAGE electrophoresis and then transferred to PVDF membranes. Then, the membranes were blocked with 5% nonfat milk for 2 hours and incubated with an antibody against HBEGF (1:1,000; Santa Cruz) at 4°C overnight. Horseradish peroxidase-labeled secondary antibody (ab205719, 1:5000, Abcam) was added and incubated at room temperature for 1 hour. Finally, the band was developed with chemiluminescence using hypersensitive ECL (Guangzhou Xiangbo Biotechnology Co., Ltd.).

Prediction of target

miRNA-mRNA interactions were predicted by TargetScan (http://www.targetscan.org/vert_71/).

Dual-luciferase reporter assay

Wild-type (WT) or mutant (Mut) HBEGF was transfected with miR-132 mimic into cells. Luciferase activities were detected by the Dual-Luciferase Reporter Assay System (Promega, USA).

Statistical analysis

Data are shown as the mean ± standard error of the mean (SEM). Group differences were compared by performing two-way ANOVA followed by Dunnett’s multiple comparisons. The statistical analyses were carried out in GraphPad Prism 7.0. A p < 0.05 was defined as a significant difference.

Results

Construction of cardiomyocyte hypoxia-reoxygenation model

To understand the mechanism of ischemic heart disease and possible treatment options, we first used cardiomyocytes for hypoxia-reoxygenation to simulate clinical ischemia-reperfusion injury. Cardiomyocytes were first placed into hypoxic chambers for 6 h of hypoxia, followed by reoxygenation for 6, 12, 18 and 24 h. At 6 h of hypoxia and 0 h of reoxygenation, a small number of round-shaped cells were observed to float on the Petri dish, and the floating cells gradually increased as the reoxygenation time increased (Figure 1(a)). Furthermore, cell viability was determined by CCK-8 assay. The results indicated that cell viability decreased significantly with increasing reoxygenation time (Figure 1(b)). These data indicate that the cell hypoxia-reoxygenation model was constructed successfully, and hypoxia-reoxygenation for 6 hours and 12 hours was selected for subsequent experiments.

Figure 1.

Construction of the cardiomyocyte hypoxia-reoxygenation model. (a) The number of floating cells gradually increased as the reoxygenation time increased. (b) Cell viability decreased significantly with increasing reoxygenation time. (c) mRNA level of miR-132 decreased with increasing reoxygenation time. **p < 0.01.

NG-R1 alleviates H9c2 cardiomyocyte injury after hypoxia-reoxygenation

To investigate the protective effects of NG-R1 on hypoxia-reoxygenation-induced H9c2 cardiomyocyte death, we initially evaluated the general toxicity of NG-R1. After treatment with various concentrations of 5–80 μM for 24 h, there was no significant difference in cell viability among the 5–40 μM groups. However, high concentrations of NG-R1 (80 μM) decreased cell viability (Figure 2(a)). Subsequently, the potential cardioprotective effects of NG-R1 against hypoxia-reoxygenation-induced H9c2 cardiomyocyte injury were assessed. Cell viability was increased after pretreatment with different concentrations (5, 10 or 20 μM) of NG-R1 compared with the H/R group (Figure 2(b)). LDH and MDA, which are used as biomarkers of oxidative stress and cardiac injury, were also measured. Hypoxia-reoxygenation treatment significantly increased LDH leakage and MDA content compared with the control group. Pretreatment with NG-R1 effectively decreased LDH and MDA release (Figure 2(c) and (d)). Additionally, cell apoptosis was analyzed, and the results showed that cell apoptosis was decreased in the NG-R1 pretreatment group compared with the H/R group (Figure 2(e)). These results suggest that NG-R1 could protect H9c2 cells from hypoxia-reoxygenation-induced cell death.

Figure 2.

NG-R1 alleviated H9c2 cardiomyocyte injury after hypoxic reoxygenation. (a) There was no significant difference in cell viability among 5–40 μM NG-R1-treated cells, but high concentrations of NG-R1 (80 μM) decreased cell viability. (b) Cell viability was increased compared with that in the H/R group after pretreatment with different concentrations (5, 10 or 20 μM) of NG-R1. (c) LDH was downregulated in the NG-R1 pretreatment group compared with H/R group. (d) MDA was downregulated in the NG-R1 pretreatment group compared with H/R group. (e and f) Cell apoptosis was decreased in the NG-R1 pretreatment group compared with the H/R group. *p < 0.05; **p < 0.01; ^&p < 0.05; ^&&p < 0.01.

NG-R1 protects H9c2 cardiomyocytes by promoting miRNA-132 and consequently inhibiting HBEGF

Numerous studies have shown that miRNA-132 is associated with cardiovascular diseases.^19,20 In addition, our previous experiment found that HBEGF induced cardiomyocyte hypertrophy. A qPCR assay showed that NG-R1 significantly promoted miRNA-132 expression under hypoxia-reoxygenation conditions in H9c2 cardiomyocytes (Figure 3(a)). qPCR assays and Western blot assays both showed that NG-R1 vitally inhibited HBEGF expression under hypoxia-reoxygenation conditions in H9c2 cardiomyocytes (Figure 3(b) and (c)).

Figure 3.

NG-R1 protects H9c2 cardiomyocytes by promoting miRNA-132, which inhibits HBEGF. (a) NG-R1 significantly promoted miRNA-132 expression under hypoxia-reoxygenation conditions in H9c2 cardiomyocytes. (b) NG-R1 vitally inhibited HBEGF mRNA expression under hypoxia-reoxygenation conditions in H9c2 cardiomyocytes. (c) NG-R1 vitally inhibited HBEGF protein expression under hypoxia-reoxygenation conditions in H9c2 cardiomyocytes. (d) Statistical analysis chart of HBEGF protein expression. **p < 0.01; ^&p < 0.05; ^&&p < 0.01.

Upregulation of miR-132 attenuates H/R damage to H9c2 cardiomyocytes

The above experiments show that miR-132 may alleviate the damage to cardiomyocytes caused by hypoxia-reoxygenation. To investigate the functional role of miR-132 in hypertension, a mimic experiment was used to upregulate miR-132 in H9c2 cardiomyocytes. The mRNA level of miR-132 in mimic-transfected cells was 1.8-fold higher than that in the scramble group (Figure 4(a)). Cell viability was increased (Figure 4(b)) and LDH leakage and MDA content were downregulated (Figure 4(c) and (d)) in the miR-132 mimic + H/R group compared with the H/R group, similar to the results found for the NG-R1 + H/R group. Meanwhile, the apoptosis rate was lower in the miR-132 mimic + H/R group than in the mimic control + H/R group (Figure 4(e)).

Figure 4.

Upregulation of miR-132 attenuates H/R damage to H9c2 cardiomyocytes. (a) The mRNA level of miR-132 in mimic-transfected cells was 1.8-fold higher than the mRNA level in the scramble group. (b) Cell viability was increased in the miR-132 mimic + H/R group compared with the H/R group. (c) LDH leakage was downregulated in the miR-132 mimic + H/R group compared with the H/R group. (d) MDA content was decreased in the miR-132 mimic + H/R group compared with the H/R group. (e) Cell apoptosis was decreased in the miR-132 mimic + H/R group compared with the H/R group.**p < 0.01; ^&p < 0.05; ^&&p < 0.01; ^#p < 0.05; ^##p < 0.01.

Downregulation of miR-132 hindered the protective effect of NG-R1 on H9c2 cardiomyocytes

To validate the abovementioned hypothesis, an inhibitor specific for miR-132 was transfected into H9c2 cells with or without NG-R1 (20 µg/ml) treatment. RT-qPCR assays showed that the miR-132 inhibitor had no obvious effects on miR-132 levels in H9C2 cells (Figure 5(a)). Transfection with the miR-132 inhibitor markedly aggravated H9C2 cardiomyocyte viability under H/R + NG-R1 conditions (Figure 5(b)). The miR-132 inhibitor partially reversed the inhibitory effect of NG-R1 on LDH and MDA in H/R-induced H9c2 cardiomyocytes (Figure 5(c) and (d)). Similarly, cell apoptosis in H/R-induced H9C2 cardiomyocytes was inhibited by NG-R1, which was reversed by the miR-132 inhibitor (Figure 5(e)).

Figure 5.

Downregulation of miR-132 hindered the protective effect of NG-R1 on H9c2 cardiomyocytes. (a) miR-132 inhibitor had no obvious effects on miR-132 levels in H9C2 cells. (b) Transfection with miR-132 inhibitor markedly aggravated H9C2 cardiomyocyte viability under H/R + NG-R1 conditions. (c) miR-132 inhibitor partially reversed the inhibitory effect of NG-R1 on LDH content in H/R-induced H9c2 cardiomyocytes. (d) miR-132 inhibitor partially reversed the inhibitory effect of NG-R1 on MDA content in H/R-induced H9c2 cardiomyocytes. (e) Apoptosis in H/R-induced H9C2 cardiomyocytes was inhibited by NG-R1, and this effect was reversed by a miR-132 inhibitor. **p < 0.01; ^&p < 0.05; ^&&p < 0.01; ^##p < 0.01.

miR-132 negatively regulated the expression of HBEGF in H9c2 cells

TargetScan 7.2 suggested that HBEGF was the target gene of miR-132 in H2c9 cells. The 3′-UTR of HBEGF mRNA contained a binding site for miR-132 (Figure 6(a)). miR-132 decreased the luciferase activity of the HBEGF 3′UTR-WT reporter vector, while miR-132 had no effect on the luciferase activity of the HBEGF 3′UTR-MUT reporter vector (Figure 6(b)). RT-qPCR and Western blot analysis were carried out, and we determined that the mRNA and protein expression of HBEGF was increased in H/R-induced H9c2 cells and decreased in cells expressing the miR-132 mimic (Figure 6(c) and (d)). Additionally, the mRNA and protein levels of HBEGF in H/R-induced H9c2 cells were inhibited by NG-R1, while the inhibitor reversed this phenomenon (Figure 6(e) and (f)).

Figure 6.

miR-132 negatively regulated the expression of HBEGF in H9c2 cells. (a) The 3′-UTR of HBEGF mRNA contained a binding site for miR-132. (b) miR-132 decreased the luciferase activity of the HBEGF 3′UTR-WT reporter vector. (c) The mRNA expression of HBEGF was increased in H/R-induced H9c2 cells and decreased in cells expressing the miR-132 mimic. (d) The protein expression of HBEGF was increased in H/R-induced H9c2 cells and decreased in cells expressing the miR-132 mimic. (e) The mRNA expression of HBEGF in H/R-induced H9c2 cells was inhibited by NG-R1, while the inhibitor reversed this phenomenon. (f) The protein expression of HBEGF in H/R-induced H9c2 cells was inhibited by NG-R1, while the inhibitor reversed this phenomenon. **p < 0.01; ^&p < 0.05; ^&&p < 0.01; ^##p < 0.01.

Discussion

Cardiovascular disease is currently the leading cause of morbidity and mortality worldwide, killing more than 7 million people each year.²¹ I/R injury leads to massive cardiomyocyte death and plays a key role in the development of coronary artery disease.²² Several studies have reported that NG-R1 has a protective effect on heart damage, but the underlying mechanism is still vague, especially as related to miRNA.^23,24 In our work, we found that H/R provoked lethal insult in cardiomyocyte H9c2 cells and led to cell apoptosis. NG-R1 treatment significantly increased cell viability and decreased cell apoptosis and LDH and MDA biomarkers of H/R-induced H9C2 cell injury. Furthermore, downregulation of miR-132 impeded the protective effect of NG-R1 on H/R-induced H9C2 cell injury cells by targeting HBEGF.

NG-R1 is a phytoestrogen of the main component of Panax ginseng that is responsible for its pharmacological activity.²⁵ There is reason to believe that NG-R1 may confer its beneficial effects through its structure, as it is a natural compound with a molecular structure similar to that of estrogen.²⁴ This view is consistent with the observation that high levels of estrogen in women protect them against oxidative stress-induced aging.²⁶ Previous studies have demonstrated that NG-R1 could protect cardiomyocytes against ischemia-reperfusion injury through antioxidative and antiapoptotic effects.^27,28 Recently, the cardioprotective effects of NG-R1 against H/R-induced injury in H9c2 cells have also been revealed.²⁴ Our findings are in accordance with previous findings confirming that NG-R1 alone had no effect on the viability of H9c2 cells, while NG-R1 could protect H9c2 cells against H/R. However, the underlying mechanism is unclear.

In recent years, an increasing number of researchers have begun to recognize the pharmacological role of miRNA regulation in traditional Chinese medicine.^29,30 Although NG-R1 has a protective effect in heart damage, it is mainly associated with apoptosis, inflammation, and oxidative stress.^23,31 However, little is known about the role of NG-R1 in regulating miRNAs in cardiac injury. In this study, miR-132 was found to be significantly downregulated in H/R-induced H9C2 cells. Further analysis suggested that miR-132 exerted cardioprotective effects, as the miR-132 mimic rescued H9c2 cells from H/R-induced injury, including cell viability, apoptosis, LDH and MDA. Interestingly, a study reported that inhibition of miR-132 may ameliorate myocardial I/R injury by inhibiting oxidative stress,³² which is inconsistent with our results and due to the different treatment conditions. Another study showed that miR-132 was expressed at low levels in myocardial infarction and inhibited cardiomyocyte apoptosis and myocardial remodeling by downregulating IL-1β.³³ This study provided another possible mechanism: NG-R1 protected cardiomyocytes through miR-132 regulation.

Noncoding RNAs are a class of RNAs that cannot be translated into proteins in cells. Although noncoding RNAs cannot be translated into proteins, they regulate multiple biological functions. At present, one of the recognized regulatory modes is that microRNA binds to the 3′UTR (3′ untranslated region) of target gene mRNA and functions through the RNA-induced silencing complex (RISC),^34,35 which blocks the translation of target genes or degrades target gene mRNA, thus inhibiting the expression of target proteins.³⁶ HBEGF has been shown to play an important regulatory role in myocardial hypertrophy and recovery in the ischemic heart.^37–39 Through bioinformatics analysis, we found that miR-132 regulated the expression of HBEGF. Furthermore, HBEGF was highly expressed in H/R-treated H9c2 cells, but its expression was reduced by treatment with the miR-132 mimic or NG-R1. These data suggest that NG-R1 may alleviate H/R-treated H9c2 cell damage through the miR-132/HBEGF axis.

Conclusions

Overall, this work demonstrated that NG-R1 protected H9c2 cardiomyocyte cells against H/R-induced injury. The cardioprotective actions of NG-R1 may occur via upregulation of miR-132, repressing the expression of the miR-132 target HBEGF. Further studies are required to fully appreciate the complexity of NG-R1 in miRNA regulation.

Footnotes

Availability of data and material

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by Quzhou Science and Technology Project [2018K23].

ORCID iD

S Yao

References

Gaziano

Bitton

Anand

, et al. Growing epidemic of coronary heart disease in low- and middle-income countries. Curr Probl Cardiol 2010; 35: 72–115.

Liu

Zeng

, et al. Burden of cardiovascular diseases in China, 1990–2016: findings from the 2016 Global Burden of Disease Study. JAMA Cardiol 2019; 4: 342–352.

Harrison

Aggarwal

, et al. Incidence and outcomes of no-reflow phenomenon during percutaneous coronary intervention among patients with acute myocardial infarction. Am J Cardiol 2013; 111: 178–184.

Zhang

Jin

, et al. Protective effects of leptin against cerebral ischemia/reperfusion injury. Exp Ther Med 2019; 17: 3282–3290.

Kan

Ungelenk

Lupp

, et al. Ischemia-reperfusion injury in aged livers—the energy metabolism, inflammatory response, and autophagy. Transplantation 2018; 102: 368–377.

Binder

Ali

Chawla

, et al. Myocardial protection from ischemia-reperfusion injury post coronary revascularization. Exp Rev Cardiovasc Ther 2015; 13: 1045–1057.

Zhang

Wang

. Notoginsenoside R1 inhibits TNF-alpha-induced fibronectin production in smooth muscle cells via the ROS/ERK pathway. Free Radic Biol Med 2006; 40: 1664–1674.

Zhang

Wang

. Notoginsenoside R1 from Panax notoginseng inhibits TNF-alpha-induced PAI-1 production in human aortic smooth muscle cells. Vasc Pharmacol 2006; 44: 224–230.

Sun

Xiao

Sun

, et al. Notoginsenoside R1 attenuates cardiac dysfunction in endotoxemic mice: an insight into oestrogen receptor activation and PI3K/Akt signalling. Br J Pharmacol 2013; 168: 1758–1770.

10.

Gui

Wei

Jian

, et al. Notoginsenoside R1 ameliorates podocyte adhesion under diabetic condition through α3β1 integrin upregulation in vitro and in vivo. Cell Physiol Biochem 2014; 34: 1849–1862.

11.

Zhao

Shi

Liu

, et al.

Ginsenosides Rg1 from Panax ginseng: a potential therapy for acute liver failure patients?

Evid Based Complement Alternat Med 2014; 2014: 538059.

12.

Chan

Chen

Dong

, et al. Estrogen-like activity of ginsenoside Rg1 derived from Panax notoginseng. J Clin Endocrinol Metabol 2002; 87: 3691–3695.

13.

Deng

, et al. Ginsenoside-Rg1 inhibits endoplasmic reticulum stress-induced apoptosis after unilateral ureteral obstruction in rats. Renal Fail 2015; 37: 890–895.

14.

Liu

Deng

, et al. Ginsenoside Rg1 protects chronic cyclosporin A nephropathy from tubular cell apoptosis by inhibiting endoplasmic reticulum stress in rats. Transpl Proceed 2015; 47: 566–569.

15.

Larotrectinib. LiverTox: clinical and research information on drug-induced liver injury. Bethesda, MD: National Institute of Diabetes and Digestive and Kidney Diseases, 2012.

16.

Bartel

. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116: 281–297.

17.

Hong

Lee

Seo

, et al. Na(+)-Ca(2+) exchanger targeting miR-132 prevents apoptosis of cardiomyocytes under hypoxic condition by suppressing Ca(2+) overload. Biochem Biophys Res Commun 2015; 460: 931–937.

18.

Ekhterae

Lin

Lundberg

, et al. ARC inhibits cytochrome C release from mitochondria and protects against hypoxia-induced apoptosis in heart-derived H9c2 cells. Circ Res 1999; 85: e70–e77.

19.

Liu

Tong

Chen

, et al. The role of miRNA-132 against apoptosis and oxidative stress in heart failure. BioMed Res Int 2018; 2018: 3452748.

20.

Masson

Batkai

Beermann

, et al. Circulating microRNA-132 levels improve risk prediction for heart failure hospitalization in patients with chronic heart failure. Eur J Heart Fail 2018; 20: 78–85.

21.

Aon

Tocchetti

Bhatt

, et al. Protective mechanisms of mitochondria and heart function in diabetes. Antioxid Redox Signal 2015; 22: 1563–1586.

22.

Wei

Liu

Xie

, et al. Nerve growth factor protects the ischemic heart via attenuation of the endoplasmic reticulum stress induced apoptosis by activation of phosphatidylinositol 3-kinase. Int J Med Sci 2015; 12: 83–91.

23.

Liu

Wang

Hou

, et al. Notoginsenoside R1 protects oxygen and glucose deprivation-induced injury by upregulation of miR-21 in cardiomyocytes. J Cell Biochem 2019; 120: 9181–9192.

24.

Zhong

Zhou

Liu

, et al. Estrogen receptor α mediates the effects of notoginsenoside R1 on endotoxin-induced inflammatory and apoptotic responses in H9c2 cardiomyocytes. Mol Med Rep 2015; 12: 119–126.

25.

Guo

Notoginsenoside R1: a systematic review of its pharmacological properties. Pharmazie 2019; 74: 641–647.

26.

Wilkinson

Hardman

. The role of estrogen in cutaneous ageing and repair. Maturitas 2017; 103: 60–64.

27.

Zhang

Wojta

Binder

. Effect of notoginsenoside R1 on the synthesis of components of the fibrinolytic system in cultured smooth muscle cells of human pulmonary artery. Cell Mol Biol (Noisy-le-Grand, France) 1997; 43: 581–587.

28.

Chen

Wang

Liu

, et al. Effect of notoginsenoside R1 on hepatic microcirculation disturbance induced by gut ischemia and reperfusion. World J Gastroenterol 2008; 14: 29–37.

29.

Liu

Wang

Luo

, et al. MiRNA-target network analysis identifies potential biomarkers for traditional Chinese medicine (TCM) syndrome development evaluation in hepatitis B caused liver cirrhosis. Sci Rep 2017; 7: 11054.

30.

Wang

Masika

Zhou

, et al. Traditional Chinese medicine baicalin suppresses mESCs proliferation through inhibition of miR-294 expression. Cell Physiol Biochem 2015; 35: 1868–1876.

31.

Liu

Yang

, et al. Focus on notoginsenoside R1 in metabolism and prevention against human diseases. Drug Des Devel Ther 2020; 14: 551–565.

32.

Zhou

Liu

, et al. MicroRNA-132 promotes oxidative stress-induced pyroptosis by targeting sirtuin 1 in myocardial ischaemia-reperfusion injury. Int J Mol Med 2020; 45: 1942–1950.

33.

Zhao

Shen

, et al. microRNA-132 inhibits cardiomyocyte apoptosis and myocardial remodeling in myocardial infarction by targeting IL-1β. J Cell Physiol 2020; 235: 2710–2721.

34.

Hausser

Zavolan

. Identification and consequences of miRNA-target interactions—beyond repression of gene expression. Nat Rev Genet 2014; 15: 599–612.

35.

Bartel

. MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: 215–233.

36.

Alvarez-Garcia

Miska

. MicroRNA functions in animal development and human disease. Development 2005; 132: 4653–4662.

37.

Zhang

Gao

Sun

, et al. H₂S restores the cardioprotective effects of ischemic post-conditioning by upregulating HB-EGF/EGFR signaling. Aging 2019; 11: 1745–1758.

38.

Molnár

Érsek

Wiener

, et al. MicroRNA-132 targets HB-EGF upon IgE-mediated activation in murine and human mast cells. Cell Mol Life Sci 2012; 69: 793–808.

39.

Uetani

Nakayama

Okayama

, et al. Insufficiency of pro-heparin-binding epidermal growth factor-like growth factor shedding enhances hypoxic cell death in H9c2 cardiomyoblasts via the activation of caspase-3 and c-Jun N-terminal kinase. J Biol Chem 2009; 284: 12399–12409.