Sage Journals: Discover world-class research

Abstract

Osteosarcoma is characterized by high malignancy and high metastasis rate, resulting in high mortality and disability. MiR-663a has been reported in a variety of tumors to promote tumorigenesis. However, miR-663a has not been reported in the pathogenesis of osteosarcoma. Bioinformatics analysis and experiments including real-time quantitative polymerase chain reaction (RT-qPCR), luciferase reporter, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, Western blot, RNA immunoprecipitation, and flow cytometry assay were applied to explore the function and mechanism of miR-663a in MG63, U2OS, Saos-2, SF-86, and hFOB1.19 cells. In this study, we found that miR-663a is highly expressed in osteosarcoma. At the same time, we discovered that miR-663a facilitates cell proliferation and migration, whereas suppresses cell apoptosis in osteosarcoma. Through a series of biological experiments, it was found that miR-663a regulates the cellular process in osteosarcoma by modulating the expression of MYL9. In addition, we also found that long noncoding RNA (lncRNA) GAS5 serves as a molecular sponge for miR-663a and regulates the progression of osteosarcoma via the ceRNA mechanism. We uncover that miR-663a promotes osteosarcoma development through targeting MYL9, which was regulated by lncRNA GAS5.

Keywords

Osteosarcoma miR-663a MYL9 lncRNA GAS5

Introduction

Osteosarcoma is one of the common musculoskeletal malignancies that originate in the interstitial cell line. The disease mainly occurs in the nutrient-rich long bones of human extremities, especially the distal femur and the proximal humerus around the knee joint.¹ Osteosarcoma is characterized by high malignancy and high metastasis rate, resulting in high mortality and disability.² Currently, the treatments for osteosarcoma include surgical treatment, chemotherapy, immunotherapy, and gene therapy.³ In recent years, despite the continuous update and development of radiotherapy and chemotherapy technology, the clinical diagnosis and treatment of osteosarcoma has been greatly improved, and the 5-year survival rate is expected to be close to 80%.⁴ However, the long-term prognosis of osteosarcoma is still not ideal, and distant metastasis remains the leading cause of death in patients with osteosarcoma.⁵ The pathogenesis of osteosarcoma remains unclear. It is widely believed that genetic mutations, bone microenvironment, and hereditary factors are the main causes of osteosarcoma.^6,7 Studies have found that a variety of oncogenes and tumor suppressor genes play a key role in the development of osteosarcoma^8
–10; however, the molecular regulation mechanism in osteosarcoma still needs further investigation to provide the theoretical basis for the clinical diagnosis and treatment of osteosarcoma.

MicroRNAs (MiRNAs), as noncoding regulatory single-stranded small RNAs, are widely expressed in organisms and highly conserved.¹¹ In recent years, the important role of miRNA in the progression of various cancers (including osteosarcoma) has attracted more and more researchers’ attention.¹² For example, miR-199a-3p plays an oncogenic role in gastric cancer by accelerating cell migration and invasion.¹³ MiR-1284 regulates the progression of osteosarcoma by hampering cell migration and proliferation.¹⁴ MiR-221/222 facilitates the development of triple-negative breast cancer by activating the Wnt/β-catenin signaling.¹⁵ Besides, miR-663a has been widely reported in the literature and can promote the development of a variety of tumors.^16,17 However, the biological role of miR-663a in the pathogenesis of osteosarcoma is unknown.

Increasing evidence has demonstrated that miRNAs can bind to the complementary sites of the 3′-UTR region of their target gene mRNAs and directly regulate the gene expression by degrading or inhibiting the translation of the target genes.^18
–20 Meanwhile, it is well known that long noncoding RNAs (lncRNAs) can function as competitive endogenous RNAs (ceRNAs) to regulate cancer development by sponging miRNAs and targeting mRNAs.^21
–23 However, the underlying regulatory mechanism of miR-663a in osteosarcoma requires more in-depth research.

In this study, we explored the exact role and mechanism of miR-663a in osteosarcoma development. Our observations may provide novel perceptions into the pathogenesis of osteosarcoma and help to develop strategies to improve osteosarcoma treatment.

Materials and methods

Cell culture

The osteosarcoma cell lines (MG63, U2OS, Saos-2, and SF-86) and normal osteoblasts (hFOB1.19) were purchased from the Chinese Academy of Sciences, Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). All the cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (10% fetal bovine serum (FBS)). All cells were incubated in a humidified atmosphere of 5% CO₂ at 37°C.

RNA extraction and RT-qPCR

Total RNA was extracted from cell or tissue samples using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The samples were then subjected to real-time fluorescent quantitative polymerase chain reaction (PCR) detection by the Applied Biosystems ABI detection system. RNA extraction and real-time PCR were performed according to the manufacturer’s instructions (Thermofisher, Waltham, MA, USA). The assay was performed as previously described.²² All the primers were designed as follows: miR-663a (F: AGGCGGGGCGCCGCGG; R: GTGCAGGGTCCGAGGT); U6 (F: CTCGCTTCGGCAGCACA; R: AACGCTTCACGAATTTGCGT); MYL9 (F: CCAGGGAAGGACTGGGTGTC; R: CGGGATTGGCTGTGGTGATT); and lncRNA GAS5 (F: CAGTGTGGCTCTGGATAGCA; R: TTAAGCTGGTCCAGGCAAGT).

Western blotting analysis

The samples were washed twice with ice-cold phosphate-buffered saline (PBS) and centrifuged at 12,000 × g for 10 min at 4°C, lysed using radioimmunoprecipitation assay lysis buffer containing the protease inhibitor cocktail (Synthgene, China) and incubated on ice for about 30 min. Cell lysates were centrifuged for another 10 min at 4°C (12,000 × g). Subsequently, the protein concentration of the supernatant was determined with a BCA protein assay kit (Beyotime, China). The protein levels were then incubated with the following primary antibodies at 4°C overnight: MYL9 and GAPDH (CST, USA) served as a loading control and protein bands were quantified using Image J Software (v1.8.0).

Cell viability assay

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to assess the effects of miR-663a and MYL9 on MG63 cell viability. The specific method refers to the previous report.²⁴

Colony formation assay

Cells were cultured at 100 cells/1 mL with DMEM medium and 10% FBS in a 24-well dish. After 7 days in culture, the cells were fixed and stained with 0.1% crystal violet to visualize colonies for counting. The experiments were performed in duplicate or triplicate.

Flow cytometry assay

Transfected MG63 cells were collected and resuspended with PBS. Afterward, the density of cells was modulated to 1 × 10⁶ cells/mL. Transfected cells were double stained by propidium iodide and Annexin V-fluorescein isothiocyanate in line with the manufacturer’s instruction. Finally, cell apoptosis was detected using flow cytometry (BD Biosciences, Franklin Lakes, New Jersey, USA).

Bioinformatics analysis

To predict the potential downstream target genes of miR-663a, Targetscan (http://www.targetscan.org/vert_72/) and KEGG analysis (https://www.kegg.jp/) were used. StarBase online website (http://starbase.sysu.edu.cn/) was applied to predict lncRNAs that interact with miR-663a.

Luciferase reporter assay

To investigate the interaction between miR-663a and GAS5 or the 3′-UTR sequence of the MYL9 gene, luciferase reporter assay was carried out. In brief, the targeting sequence was inserted into the pGL3-Basic vectors (Promega, Cambridge, MA, USA) to obtain pGL3-GAS5-WT, pGL3-GAS5-Mut, pGL3-MYL9-3′-UTR-WT, and pGL3-MYL9-3′-UTR-Mut plasmids. The constructed reporter plasmids and miR-663a mimics (miR-663a), anti-miR-663a, Mock, or miR663a + GAS5 vectors are transfected into cells and the fluorescent signal in the cell lysate is detected. Specific experimental methods can be found in the previous report.²⁴

RNA immunoprecipitation assay

Magna RNA immunoprecipitation (RIP) kit (Millipore, Burlington, MA, USA) was used for the RIP experiments following the manufacturer’s protocol. All cell lysate was incubated with RIP buffer containing magnetic beads conjugated with Ago2 antibody (Abcam, Cambridge, MA, USA) and NC normal mouse IgG (Abcam). Then, co-precipitated RNAs were obtained and analyzed by RT-qPCR analysis.

Overexpression plasmid construction

The MYL9 and lncRNA GAS5 overexpression and control plasmids used in this study were synthesized by Synthgene. MYL9, transcript variant 1, mRNA NCBI Reference Sequence: NM_006097.5, and lncRNA GAS5:ENST00000430245.5 (GAS5) length = 723.

Statistical analyses

In this study, all experimental biology was repeated at least three times. The average value in each experiment is expressed as mean ± standard deviation (SD). The Student’s t-test was used to compare the significant differences between the two samples. The p value of <0.05 was considered significant.

Results

MiR-663a is upregulated in osteosarcoma tissues and cells

First, we found that miR-663a is highly expressed in osteosarcoma disease by GER2R analysis (GSE65071), indicating that miR-663a may play an important role in the development of osteosarcoma (Figure 1(a)). Then, we conducted hematoxylin and eosin staining assay to verify the architecture and pathological characteristics of osteosarcoma cells. As shown in Figure 1(b), remarkable features of osteosarcoma cells including nuclear pleomorphism, nuclear enlargement, and frequent multinucleation were observed. We also found that miR-663a was significantly higher in osteosarcoma tissues than that in normal tissues by RT-qPCR assay (Figure 1(c)). The expression of miR-663a in osteosarcoma cell lines MG63, U2OS, Saos-2, and SF-86 was significantly higher than that in hFOB1.19 cells (Figure 1(d)). In conclusion, miR-663a is highly expressed in osteosarcoma tissues and cells.

Figure 1.

MiR-663a is upregulated in osteosarcoma tissues and cells. (a) Expression of miR-663a in gene chip data (GER2R analysis). (b) H&E staining assay was used to verify the architecture and pathological characteristics of osteosarcoma cells. (c) RT-qPCR assay was used to detect the different levels of miR-663a in tumor tissues and control tissues. (d) RT-qPCR assay was used to detect the different expressions of miR-663a in osteosarcoma cell lines: MG63, U2OS, Saos-2, SF-86, and control cells: hFOB1.19. Data are the mean ± SD, n = 3. ^# p < 0.05 indicates significant differences from the control. H&E: hematoxylin and eosin.

MiR-663a promotes cell proliferation and inhibits cell apoptosis in osteosarcoma

To further demonstrate the function of miR-663a in osteosarcoma, we carried out a series of experiments. The knockdown efficiency of miR-663a was confirmed by RT-qPCR (Figure 2(a)). Moreover, we found that miR-663a knockdown inhibited the proliferation of MG63 cells (Figure 2(b) to (d)). In addition, knockdown of miR-663a inhibited the migration of MG63 cells by cell scratch assay (Figure 2(e) and (f)). Meanwhile, the mRNA expression of Cyclin A1 and Cyclin B1 was significantly reduced by transfection of anti-miR-663a (Figure 2(g)). Flow cytometry assay showed that miR-663a knockdown increased MG63 cell apoptosis (Figure 2(h) and (i)). Additionally, the mRNA level of Bax was notably increased by transfection of anti-miR-663a, while Bcl-2 mRNA expression was decreased by miR-663a knockdown (Figure 2(j)). Through the above results, we believe that miR-663a promotes cell proliferation and inhibits cell apoptosis in osteosarcoma. Its specific mechanism needs further verification.

Figure 2.

MiR-663a promotes cell proliferation and inhibits cell apoptosis in osteosarcoma. (a) RT-qPCR assay was used to detect the expression of miR-663a after transfection with anti-miR-663a in MG63 cells. (b) MTT assay was used to measure the proliferation of MG63 cells transfected with anti-miR-663a. (c) Cloning formation assay was applied to test the cell proliferation ability of MG63 cells transfected with anti-miR-663a. (d) The statistical results of colony formation experiments. (e) Cell scratch assay was used to evaluate the migration ability of MG63 cells by transfection of anti-miR-663a. (f) Statistical results of cell scratch test. (g) RT-qPCR was used to detect the mRNA level of Cyclin A1 and Cyclin B1. (h) and (i) Flow cytometry assay was carried out to test cell apoptosis. (j) The mRNA expression of Bax and Bcl-2 were measured by RT-qPCR. Data are the mean ± SD, n = 3. ^# p < 0.05 indicates significant differences from the control. MTT: 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.

Molecular mechanism of miR-663a targeting MYL9 to regulate the progression of osteosarcoma

We have clarified that miR-663a can promote the development of osteosarcoma. To further investigate the mechanism, we first screened the possible downstream target genes of miR-663a by Targetscan and KEGG analysis and eight candidate targets were as follows: JUND, EEF1A2, HSPG2, HRAS, JUNB, MYL9, PIK3CD, and TGFβ1. Then, the mRNA levels of these candidate genes in the control group and the anti-miR-663a group were detected by RT-qPCR assay. The results showed that the expression of MYL9 in the anti-miR-663a group was significantly increased, indicating that MYL9 may play an important role in the development of osteosarcoma (Figure 3(a)). At the same time, the GEPIA database analysis also revealed that MYL9 is closely associated with osteosarcoma prognosis. The survival period of patients with low MYL9 expression in osteosarcoma was significantly shorter than that with high expression of MYL9 (Figure 3(b)). The mRNA level of MYL9 was significantly reduced in clinical osteosarcoma tissues (Figure 3(c)). To further verify whether miR-663a can directly regulate the expression of MYL9, we first analyzed the binding sites of miR-663a and MYL9 3′-UTR by Targetscan. We also constructed the MYL9 3′-UTR wide-type and mutant sequence luciferase reporter plasmids. The luciferase reporter gene experiment demonstrated that miR-663a could directly bind to MYL9 3′-UTR region (Figure 3(d) and (e)). Then, MG63 cells were transfected with miR-663a mimics and anti-miR-663a, and the Western blot analysis showed that miR-663a knockdown significantly increased the protein expression of MYL9, and miR-663a overexpression obviously reduced the protein level of MYL9 (Figure 3(f) and (g)). The above research results demonstrate that miR-663a can directly target the 3′-UTR of MYL9.

Figure 3.

Molecular mechanism of miR-663a targeting MYL9 to regulate the progression of osteosarcoma. (a) Detection of the mRNA level of target genes (JUND, EEF1A2, HSPG2, HRAS, JUNB, MYL9, PIK3CD, and TGFβ1) by transfection of anti-miR-663a. (b) GEPIA database analysis showed that MYL9 was associated with osteosarcoma prognosis. (c) RT-qPCR assay was used to detect the mRNA expression of MYL9 in osteosarcoma. (d) Targetscan predicted the binding site of miR-663a to the 3′-UTR of MYL9. (e) Luciferase assay was used to detect the expression level of the MYL9 3′-UTR reporter gene in each group. (f) and (g) Western blot was used to detect the protein level of MYL9 in each group, and the grayscale analysis statistics. Statistical results of cell scratch test. Data are the mean ± SD, n = 3. ^# p < 0.05 indicates significant differences from the control.

MiR-663a promotes the progression of osteosarcoma by regulating MYL9

To further confirm whether miR-663a affects MG63 cell behavior by directly regulating MYL9, we constructed the empty plasmid pcDNA3.1 and the MYL9 overexpression plasmid pcDNA3.1-MYL9 (pcDNA-MYL9). The MG63 cells were transfected with different plasmids: Mock + pcDNA3.1, miR-663a + pcDNA3.1, and miR-663a + pcDNA-MYL9. As shown in Figure 4(a), miR-663a mimics significantly increased the level of miR-663a, whereas decreased MYL9 expression. And MYL9 overexpression could obviously reverse the decline of MYL9 expression induced by miR-663a mimics. However, overexpression of MYL9 had no effect on the expression of miR-663a, further confirming that MYL9 was the downstream target gene of miR-663a. As displayed in Figure 4(b) to (d), the promotive effects induced by miR-663a upregulation on MG63 cell proliferation could be reversed by MYL9 overexpression. Moreover, the mRNA expression of Cyclin A1 and Cyclin B1 was increased by miR-663a mimics, and these effects could be overturned by MYL9 overexpression (Figure 4(e)). In addition, the suppressive effects caused by miR-663a overexpression on MG63 cell apoptosis was countervailed by MYL9 amplification (Figure 4(f)). The declined mRNA level of Bax and the enhanced mRNA expression of Bcl-2 were offset by MYL9 upregulation (Figure 4(g)). These results indicated that overexpression of MYL9 can significantly attenuate the function of miR-663a amplification. We believe that miR-663a promotes the progression of osteosarcoma by directly regulating MYL9.

Figure 4.

MiR-663a promotes the progression of osteosarcoma by regulating MYL9. (a) RT-qPCR assay was used to detect the expression of miR-663a and MYL9 in Mock + pcDNA3.1, miR-663a + pcDNA3.1, and miR-663a + pcDNA-MYL9 groups. (b) MTT assay was used to detect the cell proliferation in each group. (c) and (d) Cloning formation assay was performed to examine the regulation of cell proliferation in each group and the statistical results of colony formation experiments. (e) The mRNA level of Cyclin A1 and Cyclin B1 was detected by RT-qPCR. (f) Cell apoptosis in different transfected cells was shown. (g) The mRNA level of Bax and Bcl-2 was detected by RT-qPCR. Statistical results of cell scratch test. Data are the mean ± SD, n = 3. ^# p < 0.05 indicates significant differences from the control.

LncRNA GAS5 sponges miR-663a in osteosarcoma

It is well known that lncRNAs could function as ceRNAs in various diseases by sponging miRNAs and targeting specific mRNAs. Hence, we wonder if lncRNA plays the same role in osteosarcoma. Firstly, the binding site between miR-663a and lncRNAs was predicted by StarBase, and among 10 lncRNAs, lncRNA GAS5 showed the most reduction in MG63 cells transfected with anti-miR-663a (Figure 5(a)). The expression of GAS5 was found significantly lower in the osteosarcoma group (Figure 5(b)). Meanwhile, we examined the localization of GAS5 in MG63 cells and found that GAS5 was mainly presented in the cytoplasm (Figure 5(c)). These results showed that GAS5 may affect the function of downstream target genes through post-transcriptional regulation. Lots of research literature have reported that GAS5 is closely related to the development of osteosarcoma, but the specific mechanism needs further study. The results in Figure 5(d) showed that overexpression of GAS5 can significantly downregulate the expression of miR-663a, therefore we believe that GAS5 may affect the function of miR-663a through ceRNA mechanism. We then predicted the binding site of miR-663a and GAS5 by StarBase, and further confirmed that miR-663a could directly bind with GAS5 by luciferase reporter and RIP assays (Figure 5(e) to (g)). In addition, luciferase reporter assay further validated that GAS5 could sponge miR-663a and MYL9 was the downstream target gene of miR-663a (Figure 5(h)). Finally, we confirmed that miR-663a and GAS can synergistically regulate the protein level of MYL9 by Western blot (Figure 5(i); and (j)). The above experimental results demonstrate that lncRNA GAS5 can act like a “sponge adsorption” of miR-663a to regulate the expression of downstream MYL9, and ultimately affect the behavior of osteosarcoma cells.

Figure 5.

lncRNA GAS5 sponges miR-663a in osteosarcoma. (a) RT-qPCR assay was used to detect the expression level of 10 candidate lncRNAs in anti-miR-663a transfected cells. (b) RT-qPCR assay was used for the detection of GAS5 expression in a lot number of normal tissues and osteosarcoma tissues. (c) RT-qPCR assay was used for the distribution of lncRNA GAS5 in MG63 cells. (d) RT-qPCR assay was used for the detect the expression of miR-663a and MYL9 after GAS5 overexpression. (e) StarBase predicted the binding site of miR-663a to GAS5. (f) Luciferase reporter assay was used to verify the binding capacity of miR-663a and GAS5. (g) RIP assay was conducted to further confirm the interaction between miR-663a and GAS5. (h) Luciferase reporter assay showed that GAS5 could sponge miR-663a and MYL9 was the downstream target gene of miR-663a. (i) and (j) Western blot analysis suggested that miR-663a and GAS5 synergistically regulate the protein expression of MYL9. Statistical results of cell scratch test. Data are the mean ± SD, n = 3. ^# p < 0.05 indicates significant differences from the control. lncRNA: long noncoding RNA; RIP: RNA immunoprecipitation.

Discussion

Osteosarcoma is characterized by high malignancy and high metastasis rate, resulting in high mortality and disability.^25
–27 Therefore, studying the pathogenesis of osteosarcoma is conducive to the promotion of osteosarcoma treatment. This study aimed to investigate the role of miRNAs in osteosarcoma pathogenesis. As a single-stranded small RNA, miRNAs are widely expressed in plants and animals, and their sequences are highly conserved.^28,29 MiRNAs can bind to the 3′-UTR region of a target gene by base pairing and can regulate gene expression by directly degrading or inhibiting translation of the target gene.^30
–32

Studies have demonstrated that the abnormal expression of miRNAs is closely related to the biological processes such as the occurrence, proliferation, and metastasis of multiple cancers, including osteosarcoma.^33
–35 In this study, we first found that the expression of miR-663a in osteosarcoma disease was significantly higher than that in normal tissues. We also demonstrated that miR-663a played an important role in the development of osteosarcoma by analyzing osteosarcoma clinical samples and osteosarcoma cell lines. According to previous studies, miR-663a is highly expressed in various cancers and can promote the proliferation and metastasis of tumor cells.^16,17 Likewise, we observed that miR-663a could promote the proliferation and migration of osteosarcoma cells. However, the mechanism of action of miR-663a in osteosarcoma has not been reported. An in-depth study of the pathogenesis of miR-663a in osteosarcoma is a major highlight of this study.

It has been well-documented that miRNAs elicit their impacts on cancer development by targeting specific genes.^36,37 For example, miR-204 targets ATF2 to regulate cervical cancer cell proliferation and autophagy.³⁸ MiR-429 suppresses thyroid cancer development by modulating ZEB1.³⁹ MiR-9-5p serves as a tumor promoter by targeting StarD13 in prostate cancer progression.⁴⁰ Moreover, increasing evidence has demonstrated that miRNA participates in the development of osteosarcoma in the same way. For instance, miR-34c-5p represses osteosarcoma cell proliferation, migration, and invasion through targeting FLOT2.⁴¹ Attenuation of miR-384 facilitates osteosarcoma MG63 cell growth and metastasis via regulating SLBP.⁴² MiR-127-3p plays an anti-oncogenic role in osteosarcoma through targeting ITGA6 to inhibit cell growth.⁴³ To verify whether miR-663a involves in the development of osteosarcoma in a similar way, we first screened the possible downstream target genes of miR-663a by bioinformatics analysis and MYL9 caught our attention. Western blot and luciferase reporter gene experiments showed that miR-663a could directly regulate MYL9 expression. Meanwhile, cell proliferation and colony formation experiments indicated that miR-663a could affect MG63 cell proliferation by directly regulating MYL9. It is worth noting that GEPIA database analysis showed that MYL9 was closely related to the prognosis of osteosarcoma. MYL9 is a tumor-associated gene and has been reported to have a high expression level favoring the clinical prognosis of cancer.^44
–46 However, miRNAs associated with MYL9 have not been reported. Therefore, this article reports for the first time about the key role of miR-663a/MYL9 signaling pathway in osteosarcoma.

Next, we screened the relevant lncRNAs from upstream of miR-663a to further investigate its mechanism in osteosarcoma. LncRNAs are long noncoding RNA sequences greater than 200 bp in length.^47,48 LncRNAs are closely related to tumors and can affect the occurrence and development of tumors by silencing or promoting the expression of tumor suppressor genes.^49
–51 Regulation between lncRNA and miRNA can be achieved by the ceRNA mechanism. It is well known that miRNAs can cause gene silencing by binding to mRNA, and the ceRNA mechanism means that lncRNA can regulate the expression of functional genes by competitively binding miRNAs.^52
–54 We searched for lncRNAs that can regulate miR-663a by bioinformatics. We predicted the binding site of miR-663a by StarBase and selected 10 lncRNAs for RT-qPCR experimental validation. From the experimental results, we found that GAS5 expression was significantly lower in osteosarcoma tissues than in normal group. LncRNA GAS5 is a long-chain noncoding RNA that has been reported to play an important role in various cancers development, including osteosarcoma. For example, lncRNA GAS5 suppresses cell proliferation and induces cell apoptosis in cervical cancer cells.⁵⁵ LncRNA GAS5 serves as a tumor suppressor in colorectal cancer by sponging miR-182-5p and targeting FOXO3a.⁵⁶ LncRNA GAS5 inhibits cell growth and epithelial–mesenchymal transition in osteosarcoma by modulating the miR-221/ARHI pathway.⁵⁷ Similarly, we found that the expression level of lncRNA GAS5 in osteosarcoma was also significantly reduced in clinical samples, which was inversely related to the expression level of miR-663a. RT-qPCR analysis showed that overexpression of lncRNA GAS5 significantly upregulated the expression of miR-663a, therefore we believe that lncRNA GAS5 may regulate miR-663a function through ceRNA mechanism. The luciferase reporter gene demonstrated that miR-663a interacts directly with lncRNA GAS5. Finally, Western blot experiments demonstrated that miR-663a and lncRNA GAS can synergistically regulate the expression of MYL9 protein. The above experiments demonstrated that lncRNA GAS5 affects the behavior of MG63 cells by binding to miR-663a to regulate the expression level of downstream MYL9.

In conclusion, we demonstrated that miR-663a played an important role in the pathogenesis of osteosarcoma. MiR-663a regulated the proliferation and migration of osteosarcoma cells by regulating the expression level of the downstream target gene MYL9. We also found that the function of miR-663a was regulated by GAS5 through the ceRNA mechanism. This study details a new mechanism of miR-663a in osteosarcoma and provides a good theoretical basis for the clinical treatment of osteosarcoma. Based on the experimental results of this study, we will continue to study the mechanism of miR-663a in osteosarcoma at animal level.

Footnotes

Acknowledgment

The authors showed their gratitude to the “Zhejiang Province Chinese Medicine Science and Technology Projection (2018ZB117)” and all participants in the study.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was financially supported by the Zhejiang Province Chinese Medicine Science and Technology Projection (2018ZB117).

ORCID iD

W Xiong

References

Serlo

Tarkkanen

Sampo

, et al. Incidence, treatment and survival of paediatric patients with bone sarcomas in Finland from 1991 to 2005. Acta Paediatr (Oslo, Norway: 1992) 2015; 104: 738–745.

Ottaviani

Jaffe

. The epidemiology of osteosarcoma. Cancer Treat Res 2009; 152: 3–13.

Zhu

Wang

, et al. A review and outlook in the treatment of osteosarcoma and other deep tumors with photodynamic therapy: from basic to deep. Oncotarget. 2017; 8: 39833–39848.

Wittig

Bickels

Priebat

, et al. Osteosarcoma: a multidisciplinary approach to diagnosis and treatment. Am Fam Physician 2002; 65: 1123–1132.

Berner

Johannesen

Berner

, et al. Time-trends on incidence and survival in a nationwide and unselected cohort of patients with skeletal osteosarcoma. Acta Oncol (Stockholm, Sweden) 2015; 54: 25–33.

Ottaviani

Jaffe

. The etiology of osteosarcoma. Cancer Treat Res 2009; 152: 15–32.

Alfranca

Martinez-Cruzado

Tornin

, et al. Bone microenvironment signals in osteosarcoma development. Cell Mol Life Sci: CMLS 2015; 72: 3097–3113.

Jiang

Fang

. Up-regulated lnc-SNHG1 contributes to osteosarcoma progression through sequestration of miR-577 and activation of WNT2B/Wnt/beta-catenin pathway. Biochem Biophys Res Commun 2018; 495: 238–245.

Wang

Luo

Liu

, et al. miR-491 inhibits osteosarcoma lung metastasis and chemoresistance by targeting αB-crystallin. Mol Ther: J Am Soc Gene Ther 2017; 25: 2140–2149.

10.

Zhou

Jiang

Zong

, et al. miR-146a promotes growth of osteosarcoma cells by targeting ZNRF3/GSK-3β/β-catenin signaling pathway. Oncotarget 2017; 8: 74276–74286.

11.

Kai

Dittmar

Sen

. Secretory microRNAs as biomarkers of cancer. Semin Cell Dev Biol 2018; 78: 22–36.

12.

Sasaki

Osaki

Okada

. MicroRNA-based diagnosis and treatment of metastatic human osteosarcoma. Cancers 2019; 11(4): 553.

13.

Mou

Wang

, et al. miR-199a-3p targets ETNK1 to promote invasion and migration in gastric cancer cells and is associated with poor prognosis. Pathol Res Pract 2019; 215: 152511.

14.

Guan

. miRNA-1284, a regulator of HMGB1, inhibits cell proliferation and migration in osteosarcoma. Biosci Rep 2018; 38(4): BSR20171675.

15.

Liu

Wang

Liu

, et al. miR-221/222 activate the Wnt/β-catenin signaling to promote triple-negative breast cancer. J Mol Cell Biol 2018; 10: 302–315.

16.

Zhang

Liang

, et al. EMP3, which is regulated by miR-663a, suppresses gallbladder cancer progression via interference with the MAPK/ERK pathway. Cancer Lett 2018; 430: 97–108.

17.

Zhou

Pan

, et al. Oncogenic miR-663a is associated with cellular function and poor prognosis in renal cell carcinoma. Biomed Pharmacother 2018; 105: 1155–1163.

18.

Zhao

, et al. MiRNA-616 aggravates the progression of bladder cancer by regulating cell proliferation, migration and apoptosis through downregulating SOX7. Eur Rev Med Pharmacol Sci 2019; 23: 9304–9312.

19.

Zhang

, et al. Hypoxia-induced microRNA-10b-3p promotes esophageal squamous cell carcinoma growth and metastasis by targeting TSGA10. Aging 2019; 11(22): 10374–1038.

20.

Liu

Wang

Shi

, et al. MicroRNA-1269 promotes cell proliferation via the AKT signaling pathway by targeting RASSF9 in human gastric cancer. Cancer Cell Int 2019; 19: 308.

21.

Zhang

, et al. Long noncoding RNA LUCAT1 promotes malignancy of ovarian cancer through regulation of miR-612/HOXA13 pathway. Biochem Biophys Res Commun 2018; 503: 2095–2100.

22.

Wang

Chen

Zhao

, et al. The long noncoding RNA HULC promotes liver cancer by increasing the expression of the HMGA2 oncogene via sequestration of the microRNA-186. J Biol Chem 2017; 292: 15395–15407.

23.

Long

, et al. Long noncoding RNA LOXL1-AS1 regulates prostate cancer cell proliferation and cell cycle progression through miR-541-3p and CCND1. Biochem Biophys Res Commun 2018; 505: 561–568.

24.

Chen

Zhou

. MiRNA-708/CUL4B axis contributes into cell proliferation and apoptosis of osteosarcoma. Eur Rev Med Pharmacol Sci 2018; 22: 5452–5459.

25.

Mirabello

Troisi

Savage

. Osteosarcoma incidence and survival rates from 1973 to 2004: data from the surveillance, epidemiology, and end results program. Cancer 2009; 115: 1531–1543.

26.

Marko

Diessner

Spector

. Prevalence of metastasis at diagnosis of osteosarcoma: an international comparison. Pediatr Blood Cancer 2016; 63: 1006–1011.

27.

Carina

Costa

Sartori

, et al. Adjuvant biophysical therapies in osteosarcoma. Cancers 2019; 11(3): 348.

28.

Rothenberg

. MicroRNA. J Allergy Clin Immunol 2018; 141: 1202–1207.

29.

Basso

Ferreira

PCG

Kobayashi

, et al. MicroRNAs and new biotechnological tools for its modulation and improving stress tolerance in plants. Plant Biotechnol J 2019; 17: 1482–1500.

30.

Fan

Cui

, et al. MiR-125a suppresses tumor growth, invasion and metastasis in cervical cancer by targeting STAT3. Oncotarget 2015; 6: 25266–25280.

31.

Zhang

Zou

, et al. miR-215 promotes malignant progression of gastric cancer by targeting RUNX1. Oncotarget 2016; 7: 4817–4828.

32.

Wang

Chen

, et al. MicroRNA-4472 promotes tumor proliferation and aggressiveness in breast cancer by targeting RGMA and inducing EMT. Clin Breast Cancer 2020; 20(2): e113–e126.

33.

Tang

Liu

Zhang

, et al. Decreased expression of miR-490-3p in osteosarcoma and its clinical significance. Eur Rev Med Pharmacol Sci 2017; 21: 246–251.

34.

Xie

Sun

Deng

, et al. MiR-302b suppresses osteosarcoma cell migration and invasion by targeting Runx2. Sci Report 2017; 7: 13388.

35.

Zhou

Wang

, et al. miR-421 is a diagnostic and prognostic marker in patients with osteosarcoma. Tumour Biol 2016; 37: 9001–9007.

36.

Petrovic

Ergün

Isenovic

. Levels of microRNA heterogeneity in cancer biology. Mol Diagn Ther 2017; 21: 511–523.

37.

Mato Prado

Frampton

Giovannetti

, et al. Investigating miRNA-mRNA regulatory networks using crosslinking immunoprecipitation methods for biomarker and target discovery in cancer. Expert Rev Mol Diagn 2016; 16: 1155–1162.

38.

Guo

Liu

, et al. Molecular mechanism of miR-204 regulates proliferation, apoptosis and autophagy of cervical cancer cells by targeting ATF2. Artif Cells Nanomed Biotechnol 2019; 47: 2529–2535.

39.

Zheng

, et al. miR-429 suppresses cell growth and induces apoptosis of human thyroid cancer cell by targeting ZEB1. Artif Cells Nanomed Biotechnol 2019; 47: 548–554.

40.

Chen

, et al. Inhibition of miR-9-5p suppresses prostate cancer progress by targeting StarD13. Cell Mol Biol Lett 2019; 24: 20.

41.

Wang

Tang

, et al. The study of mechanism of miR-34c-5p targeting FLOT2 to regulate proliferation, migration and invasion of osteosarcoma cells. Artif Cells Nanomed Biotechnol 2019; 47: 3559–3568.

42.

Wang

Huang

. Knocking down miR-384 promotes growth and metastasis of osteosarcoma MG63 cells by targeting SLBP. Artif Cells Nanomed Biotechnol 2019; 47: 1458–1465.

43.

Wang

Tang

, et al. MiR-127-3p inhibits cell growth and invasiveness by targeting ITGA6 in human osteosarcoma. IUBMB Life 2018; 70: 411–419.

44.

Wang

Cai

Zhang

, et al. HBXIP up-regulates ACSL1 through activating transcriptional factor Sp1 in breast cancer. Biochem Biophys Res Commun. 2017; 484: 565–571.

45.

Luo

Zhang

Zhao

, et al. Histone methyltransferase SMYD3 promotes MRTF-A-mediated transactivation of MYL9 and migration of MCF-7 breast cancer cells. Cancer Lett 2014; 344: 129–137.

46.

Kruthika

Sugur

Nandaki

, et al. Expression pattern and prognostic significance of myosin light chain 9 (MYL9): a novel biomarker in glioblastoma. J Clin Pathol 2019; 72: 677–681.

47.

Mattick

. The genetic signatures of noncoding RNAs. PLoS Genetics 2009; 5: e1000459.

48.

Vishnubalaji

Shaath

Elango

, et al. Noncoding RNAs as potential mediators of resistance to cancer immunotherapy. Semin Cancer Biol 2019; S1044-579X: 30223–8.

49.

Han Li

Chen

. Small and long non-coding RNAs: novel targets in perspective cancer therapy. Curr Genom 2015; 16: 319–326.

50.

Chi

Wang

, et al. Long non-coding RNA in the pathogenesis of cancers. Cells. 2019; 8: 1015.

51.

Dou

Liu

, et al. Application of long noncoding RNAs in osteosarcoma: biomarkers and therapeutic targets. Cell Physiol Biochem 2017; 42: 1407–1419.

52.

Zhang

Shan

, et al. SSTR5AS1 functions as a ceRNA to regulate CA2 by sponging miR15b5p for the development and prognosis of HBV-related hepatocellular carcinoma. Mol Med Rep 2019; 20: 5021–5031.

53.

Liu

Zhang

Yuan

, et al. Long noncoding RNA RP4 functions as a competing endogenous RNA through miR-7-5p sponge activity in colorectal cancer. World J Gastroenterol 2018; 24: 1004–1012.

54.

Zhang

Cai

Zheng

, et al. Long noncoding RNA NEAT1 regulate papillary thyroid cancer progression by modulating miR-129-5p/KLK7 expression. J Cell Physiol 2018; 233: 6638–6648.

55.

Yang

Hong

, et al. Upregulation of lncRNA GAS5 inhibits the growth and metastasis of cervical cancer cells. J Cell Physiol 2019; 234: 23571–23580.

56.

Cheng

Zhao

Wang

, et al. lncRNA GAS5 inhibits colorectal cancer cell proliferation via the miR1825p/FOXO3a axis. Oncol Rep 2018; 40: 2371–2380.

57.

Wang

Zhang

, et al. Long noncoding RNA GAS5 suppresses cell growth and epithelial-mesenchymal transition in osteosarcoma by regulating the miR-221/ARHI pathway. J Cell Biochem 2017; 118: 4772–4781.

MiR-663a,regulated by lncRNA GAS5,contributes to osteosarcoma development through targeting MYL9

Abstract

Keywords

Introduction

Materials and methods

Cell culture

RNA extraction and RT-qPCR

Western blotting analysis

Cell viability assay

Colony formation assay

Flow cytometry assay

Bioinformatics analysis

Luciferase reporter assay

RNA immunoprecipitation assay

Overexpression plasmid construction

Statistical analyses

Results

MiR-663a is upregulated in osteosarcoma tissues and cells

MiR-663a promotes cell proliferation and inhibits cell apoptosis in osteosarcoma

Molecular mechanism of miR-663a targeting MYL9 to regulate the progression of osteosarcoma

MiR-663a promotes the progression of osteosarcoma by regulating MYL9

LncRNA GAS5 sponges miR-663a in osteosarcoma

Discussion

Footnotes

Acknowledgment

Data availability statement

Declaration of conflicting interests

Funding

ORCID iD

References