Maternal fluoride exposure during gestation and lactation decreased learning and memory ability,and glutamate receptor mRNA expressions of mouse pups

Abstract

Previous investigations demonstrated that high fluoride (F) exposure may adversely affect the neurodevelopment and learning and memory ability. However, whether maternal F exposure during gestation and lactation can influence the learning, memory ability, and glutamate receptor expressions of offspring has not yet been elucidated. Hence, in the present study, maternal mice were exposed to F (25, 50, or 100 mg/L sodium fluoride (NaF) in drinking water) during gestation and lactation. Results showed that exposure to 100 mg/L NaF significantly enhanced the number of total arm entries and working memory errors of offspring in the radial arm maze test compared to the control group. However, no difference was observed in open-field behaviors. For the subtypes of glutamate receptors in hippocampus, expression of GluR2 mRNA was significantly reduced by 25, 50, and 100 mg/L NaF. Besides, F exposure also suppressed the expression of NR2A, NR2B, and mGluR2 mRNA levels in a dose-dependent manner, where NR2A was significantly suppressed by 50 mg/L NaF and NR2B and mGluR2 by 100 mg/L NaF. However, no significant changes were observed in GluR1 and mGluR5 mRNA expression levels. Collectively, these findings suggested that F can pass through the cord blood and breast milk and may have deleterious impact on learning and memory of the mouse pups, which was mediated by reduced mRNA expression of glutamate receptor subunits.

Keywords

Fluoride gestation and lactation glutamate receptor learning and memory mouse pups

Introduction

Apart from dental and skeletal fluorosis, excessive fluoride (F) ingestion results in a broad array of symptoms and pathological changes.¹ In recent years, increasing epidemiological investigations have demonstrated the negative relationship between the high F exposure and the low children’s intelligence.^2

–5 It is worth to note that children living in high F areas had lower IQ scores than those in low F areas.³ Furthermore, animal experiments also confirmed the neurotoxicity of F. To our knowledge, diverse animal behavior methods like Y-maze test,⁶ open field test,⁷ transfer latency,⁸ and step-down test⁹ have been used in this field to support that F can induce behavior alteration and learning and memory impairment.

Long-term potentiation (LTP), the widely accepted electrophysiological model for the cellular mechanism underlying the spatial learning and memory formation, is triggered by the special receptors on the excitatory synapses.¹⁰ In mammalian brains, most excitatory synapses are glutamatergic, and they use glutamate (an amino acid neurotransmitter) as the chemical messenger.¹¹ Jiang et al. and our previous studies reported that the glutamate concentration in hippocampus was reduced in rats exposed to F.^12,13 Glutamate takes up over 30% of the total excitatory neurotransmitter in brain. Interestingly, because the glutamate in the blood serum cannot penetrate the blood–brain barrier, glutamates of brain are synthesized only in brain.¹³

Glutamate released from presynaptic nerve terminals binds specifically to glutamate receptors.¹⁴ Up to now, the subtypes of glutamate receptors are categorized as ionotropic receptors including kainate receptors, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs, GluR1-4), N-methyl-D-aspartate receptors (NR1-3), and metabotropic receptors (mGluRs, mGluR1-8).¹⁵ Earlier investigation revealed that the exposure to F decreased mGluR5 expression in rat hippocampus and cortex.¹² Additionally, our previous study showed that F altered the gene and protein levels of NR1 in rat hippocampus.¹⁶

Importantly, F can cross the placenta barrier and diffuse into cord blood, with the ranges from 60% to 91% of maternal F.^17,18 High F in breast milk suggested its accessibility for infants.^19,20 However, the maternal F exposure during gestation and lactation can influence the learning and memory ability and the glutamate receptor expressions of mice offspring are poorly understood. In view of this, in this study, we exposed the maternal mice to various concentrations of F during gestation and lactation, followed by behavioral tests like open field test and radial-arm maze, as well as the mRNA expressions of GluR1, GluR2, NR2A, NR2B, mGluR2, and mGluR5 in hippocampus of mouse pups.

Materials and methods

Experimental animals

Forty-eight adult mice of Kunming strain with half males and half females, weighing 20–25 g each, were obtained from Experimental Animal Center of Shanxi Medical University. The mice were placed in plastic cages and acclimated to the laboratory condition of 12-light/12-h dark cycle and 22–25°C for 1 week before the experiment. All animals received their food and water freely. After a week of acclimatization, one male and two female mice were housed together in one cage in the evening, and sperm plug in the female mice vagina was examined in the next day morning. The day when sperm plug presence was noticed was designated as day 0 of gestation. Each pregnant mouse was then separated and kept individually in a cage and randomly divided into four groups with different sodium fluoride (NaF) concentrations of 0, 25, 50, and 100 mg/L. After delivery, the females were continued with the same treatment until the end of the lactation. The offspring at the postnatal day 21 were allowed to attend the future tests. The experimental design was approved by the Ethics Committee of Shanxi Agricultural University (Taigu, China).

Open field test

As shown in Figure 1, the open field apparatus was a 72 × 72 × 72 cm³ black plastic box which contained an outer field and a center square field (36 × 36 cm²) at the bottom. The test was allowed to record the activities in a quiet test room (walking distance, residence time, and average speed) in the outer field and the center field. The mice were placed individually in the center of the chamber for 3 min before the test. Then, the movements were continuously monitored by the digital video camera fixed on the top of the box for 5 min; 70% ethanol was applied to clean the testing arenas after each trial.

Figure 1.

The photo (a) and schematic diagram (b) of open field apparatus which contained an outer field and a center square field (36 × 36 cm²) at the bottom.

Radial arm maze test

The device was composed of eight 50 × 10 × 20 cm³ extending radial arms, with a platform (25 cm in diameter) in the cross center, presented in Figure 2(a). The maze was 50 cm above the floor. The test was performed as previously described by Wang et al.²¹ Briefly, in the training phase, each mouse was trained to collect food pellets placed at the ends of the four randomly selected testing arms, while no food was presented in the remaining four arms. The training was conducted for a couple of days. In the testing phase, mice were first placed on the cross-center platform for 15 s and then freely explored in the maze for 5 min. The camera above the maze monitored the activity of the mice. The test indicators included (1) the number of total arm entries and (2) the number of working memory errors, entering a food arm that had been entered previously. The test was conducted twice daily for seven consecutive days.

Figure 2.

The photo (a) and schematic diagrams (b and c) of radial arm maze. An illustrative example of a control (b) and a 100-mg/L NaF (c) treatment mouse’s travel pathway showed the mouse in the fluoride group entered into more arms. NAF: sodium fluoride.

RNA extraction and quantitative real-time polymerase chain reaction

Total RNA was extracted from the hippocampus of offspring by using Trizol reagent (Invitrogen, California, USA) according to the manufacturer’s instructions. Specific primers (Invitrogen, Shanghai, China) for GluR1, GluR2, NR2A, NR2B, mGluR2, mGluR5, and β-actin (an internal control) were designed with Primer 3.0 plus and the sequences are presented in Table 1. Quantitative real-time polymerase chain reaction (QRT-PCR) amplification was carried out with two-step SYBR® QRT-PCR kit (Takara, Dalian, China) on the Mx3000P™ QPCR system (Stratagene, San Diego, California, USA) for 40 cycles with denaturation at 95°C for 5 s, annealing at 61°C for 15 s, and extension at 72°C for 6 s. The relative mRNA abundance of each target gene was calculated using comparative 2^−ΔΔCt method.

Table 1.

Primer sequences and product sizes for QRT-PCR.

Gene	Primer sequences (5′–3′)	Accession no.	Product sizes (bp)
β-actin	F: TTGCTGACAGGATGCAGAAG R: ACATCTGCTGGAAGGTGGAC	NM_007393	141
GluR1	F: ACAGCCAGACAGGAAAGGTG R: TGCACCAAGAGTGAGAGTGG	NM_001113325	124
GluR2	F: ATTTCGGGTAGGGATGGTTC R: CATTGGTGACTGCGAAACTG	NM_001039195	98
NMDA2A	F: GACAAGGATCCGACATCCAC R: AGATGGTGGTGACCAAGGAG	NM_008170	121
NMDA2B	F: AGAACGGTCAGAGGTGGTTG R: GTGACACAGTCCCATTGCTG	NM_008171	89
mGluR2	F: GCCAAGTTCATCGGCTTTAC R: ACGCACATCGTAGTGGTCTG	NM_001160353	113
mGluR5	F: TGCGTTCAAGACCAGAAATG R: CAGCCATATGATGCAGGTTG	NM_001081414	88

SEM: standard error of the mean; QTR: quantitative real time; PCR: polymerase chain reaction.

Statistical analysis

The raw data of spontaneous behavior and learning and memory were analyzed by SMART version 3.0 tracking system (Panlab, Spain). The data in this study are shown as mean ± standard error of the mean. The difference among groups was compared by one-way analysis of variance with Dunnett as the posttest (GraphPad Software Inc., San Diego, California, USA). A probability of p < 0.05 was considered as being statistically significant.

Results

Open field test

Results showed that F exposure during embryonic to suckling periods had no significant effects on the spontaneous behavior of offspring mouse. No statistical difference was observed in walking distance, residence time, or average speed in both outer and center field in three experimental groups compared to the control group. For the overall activity, there was no difference in the total distance and average speed among the four groups.

Radial arm maze

The data of radial arm maze in Tables 2 and 3 show the effect of F on the learning and memory ability of offspring. Compared to control group, 100 mg/L NaF significantly enhanced the number of total arm entries from day 2 to 7. In 50 mg/L NaF group, a significant increase was observed on day 5 and 6, while 25 mg/L NaF have no effects on the number of total arm entries. With respect to the number of working memory errors, it was significantly increased in 100 mg/L NaF group from day 2 to 6 and in 50 mg/L NaF group on day 3, 5, and 6. No statistical difference was observed in 25 mg/L NaF group during the whole test period.

Table 2.

Effect of maternal fluoride exposure during gestation and lactation on the number of total arm entries of mouse pups in radial arm maze test (mean ± SEM, n = 6).

Trial day	Control	25 mg/L NaF	50 mg/L NaF	100 mg/L NaF	F value
Day 1	8.00 ± 1.35	14.40 ± 0.98	19.00 ± 4.92	24.75 ± 8.04	2.383
Day 2	7.25 ± 1.03	12.60 ± 1.50	17.00 ± 2.48	18.25 ± 4.84^a	3.138
Day 3	6.75 ± 1.11	12.00 ± 2.61	17.00 ± 3.39	18.75 ± 3.95^a	3.324
Day 4	7.25 ± 0.48	10.20 ± 0.92	10.75 ± 1.11	13.75 ± 1.03^b	7.846
Day 5	7.25 ± 0.48	9.25 ± 0.48	11.50 ± 1.44^a	14.25 ± 1.03^b	10.05
Day 6	7.25 ± 0.48	11.60 ± 1.17	14.00 ± 3.46^a	19.25 ± 1.70^b	8.970
Day 7	7.50 ± 0.96	10.60 ± 1.17	10.75 ± 1.70	14.00 ± 1.68^a	3.427

NAF: sodium fluoride; SEM: standard error of the mean.

^a p < 0.05: a statistical difference when compared to the control group.

^b p < 0.01: a statistical difference when compared to the control group.

Table 3.

Effect of maternal fluoride exposure during gestation and lactation on the number of working memory errors of mouse pups in radial arm maze test (mean ± SEM, n = 6).

Trial day	Control	25 mg/L NaF	50 mg/L NaF	100 mg/L NaF	F value
Day 1	3.75 ± 1.11	7.40 ± 0.81	9.25 ± 3.01	12.50 ± 4.09	2.039
Day 2	2.25 ± 0.48	6.60 ± 0.87	7.75 ± 1.65	9.75 ± 2.59^a	3.978
Day 3	2.00 ± 0.41	6.25 ± 1.44	9.50 ± 1.85^b	8.75 ± 1.60^a	5.574
Day 4	3.00 ± 0.41	5.40 ± 0.61	4.75 ± 0.48	6.25 ± 1.03^a	4.046
Day 5	3.00 ± 0.41	3.75 ± 0.48	5.25 ± 0.63^a	6.75 ± 0.48^b	10.84
Day 6	3.00 ± 0.58	5.00 ± 0.55	7.00 ± 1.53^b	10.75 ± 0.25^b	15.87
Day 7	3.25 ± 0.75	4.60 ± 0.40	5.50 ± 1.56	7.00 ± 1.08	2.454

NAF: sodium fluoride; SEM: standard error of the mean.

^a p < 0.05: a statistical difference when compared to the control group.

^b p < 0.01: a statistical difference when compared to the control group.

mRNA expressions of glutamate receptors

The mRNA expression levels of NR2A, NR2B, GluR1, GluR2, mGluR2, and mGluR5 in hippocampus are shown in Figure 3. For the subtypes of glutamate receptors, compared to controls, expression of GluR2 mRNA was significantly reduced by 25, 50, and 100 mg/L NaF. Besides, F exposure also suppressed the expression of NR2A, NR2B, and mGluR2 mRNA levels in a dose-dependent manner, where NR2A was significantly suppressed by 50mg/L and NR2B and mGluR2 by 100mg/L. However, no significant changes were observed in GluR1and mGluR5 mRNA expression levels.

Figure 3.

Effect of maternal fluoride exposure during gestation and lactation on the mRNA expressions of GluR1, GluR2, NR2A, NR2B, mGluR2, and mGluR5 in hippocampus of mouse pups. Bars represent mean ± SEM (n = 6). *p < 0.05 or **p < 0.01: a statistical difference when compared to the control group. SEM: standard error of the mean.

Discussion

F accumulation in different brain regions^22,23 and impaired learning and memory^3,24 have been consistently reported in previous investigations. However, the F source of subjects in those studies was from the diet and/or water. In the present study, the F exposure of offspring was through cord blood and breast milk. Results of open field test and radial-arm maze test revealed that F ingestion through this way during developmental period impaired the spatial learning and memory ability of offspring.

Hippocampal neurons are considered to be responsible for encoding space.²⁵ Results of pharmacological and physiological experiments have been established the link between hippocampal LTP and spatial learning.²⁶ In addition, glutamate receptors participate in the formation of spatial learning and memory.²⁶ Therefore, the expressions of different subtypes of glutamate receptors in hippocampus were analyzed in this present study.

AMPARs, which have been demonstrated to underlie the formation of learning and memory, are assembled from four subunits designated glutamate receptor GluR1, 2, 3 and 4.²⁷ During the first postnatal week, the expression of the GluR1 is higher, but in the later developmental period, GluR2 gets dramatically increased.²⁸ In adult hippocampus, most AMPARs are comprised of GluR1/GluR2 heteromers with small portion of GluR2/GluR3.²⁹ Hence, GluR2 is a critical subunit in determining the function of AMPAR in mammals.²⁸ The different subunits endue AMPAR channel with specific physiological properties.²⁷ GluR2-containing AMPARs serve for the flow of monovalent cations, while those lacking the GluR2 subunit are permeable to divalent cations, such as calcium.³⁰ In the current study, the expression level of GluR2 mRNA was significantly inhibited in hippocampus of offspring from mice treated with 25, 50, or 100 mg/L NaF. In contrast, GluR1 mRNA expression in experimental groups had no significant changes. Therefore, we suggest that F impaired learning and memory ability mainly through the reduced GluR2-containing AMPARs.

Resembling AMPARs, NMDA receptor-dependent LTP in the hippocampus is considered to be the crucial neural substrate for spatial learning and memory.²⁶ Here, the results showed that mRNA expression of NR2B was significantly suppressed in 50mg/L NaF group, while no changes were observed in NR2A subunit. The current mediated by heteromers containing NR2B is about three to four times slower than by those composed of NR2A.³¹ Furthermore, the overexpressed NR2B enhanced synaptic plasticity in hippocampus and spatial learning.³² Taken together, the decreased levels of NR2B in our experiment revealed that NR2B was also involved in the molecular mechanisms underlying fluoride-induced learning and memory impairment.

However, with respect to the subunits of metabotropic glutamate receptors, no changes were observed in the mGluR5 mRNA expression levels, indicating that the learning and memory impairment caused by F was independent to mGluR5-containing receptors. Notably, mGluR2 mRNA expression level in 100 mg/L NaF group was significantly inhibited. Previous studies found that mGluR2 activation modulated a specific olfactory memory formation which helped the females to be successful in the mating test.³³ In this study, the learning and memory formation relies on whether mice could find the food in certain arm of the maze. Hence, whether the low mGluR2 expression induced by F is related to impaired olfactory sensation requires further investigation.

In conclusion, F exposure during embryonic to suckling stages impaired the learning and memory ability of the mouse pups, by inhibiting the mRNA expression of glutamate receptor subunits including GluR2, NR2B, and mGluR2, among which GluR2 was the more sensitive molecule in hippocampus.

Footnotes

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was supported by National Natural Science Foundation of China (grant no. 31201965), Program for the Top Young Innovative Talents of Shanxi Agricultural University (grant no. TYIT201408), and Program for the Outstanding Innovative Teams of Higher Learning Institutions of Shanxi.

References

Jagtap

Yenkie

Labhsetwar

. Fluoride in drinking water and defluoridation of water. Chem Rev 2012; 112: 2454–2466.

Trivedi

Sangai

Patel

. Assessment of groundwater quality with special reference to fluoride and its impact on IQ of schoolchildren in six villages of the Mundra region, Kachchh, Gujarat, India. Fluoride 2012; 45: 377–383.

Choi

Sun

Zhang

. Developmental fluoride neurotoxicity: a systematic review and meta-analysis. Environ Health Perspect 2012; 120: 1362–1368.

Poureslami

Horri

Garrusi

. A comparative study of the IQ of children age 7–9 in a high and a low fluoride water city in Iran. Fluoride 2011; 44: 163–167.

Ding

Gao

Sun

. The relationships between low levels of urine fluoride on children’s intelligence, dental fluorosis in endemic fluorosis areas in Hulunbuir, Inner Mongolia, China. J Hazard Mater 2011; 186: 1942–1946.

Niu

Sun

Wang

. Effects of fluoride and lead on locomotor behavior and expression of Nissl body in brain of adult rats. Fluoride 2008; 41: 276–282.

Basha

Rai

Begum

. Fluoride toxicity and status of serum thyroid hormones, brain histopathology, and learning memory in rats: a multigenerational assessment. Biol Trace Elem Res 2011; 144: 1083–1094.

Balaji

Kumar

. Evaluation of standardized Bacopa monniera extract in sodium fluoride-induced behavioural, biochemical, and histopathological alterations in mice. Toxicol Ind Health 2015; 31: 18–30.

Wang

Ning

. Effects of high fluoride and low iodine on biochemical indexes of the brain and learning-memory of offspring rats. Fluoride 2004; 37: 201–208.

10.

Rebola

Srikumar

Mulle

. Activity-dependent synaptic plasticity of NMDA receptors. J Physiol 2010; 588: 93–99.

11.

Genoux

Montgomery

. Glutamate receptor plasticity at excitatory synapses in the brain. Clin Exp Pharmacol Physiol 2007; 34: 1058–1063.

12.

Jiang

Yao

. Fluoride and arsenic exposure impairs learning and memory and decreases mGluR5 expression in the hippocampus and cortex in rats. PLoS One 2014; 9: e96041.

13.

Niu

Sun

Cheng

. Decreased learning ability and low hippocampus glutamate in rats exposed to fluoride and lead in different developmental stages. Environ Toxicol Phar 2009; 28: 254–258.

14.

Karakas

Regan

Furukawa

. Emerging structural insights into the function of ionotropic glutamate receptors. Trends Biochem Sci 2015; 40: 328–337.

15.

Traynelis

Wollmuth

McBain

. Glutamate receptor ion channels: structure, regulation, and function. Pharmacol Rev 2010; 62: 405–496.

16.

Niu

Sun

Cheng

. Effects of fluoride and lead on n-methyl-d-aspartate receptor 1 expression in the hippocampus of offspring rat pups. Fluoride 2008; 41: 101–110.

17.

Opydo-Szymaczek

Borysewicz-Lewicka

. Transplacental passage of fluoride in pregnant Polish women assessed on the basis of fluoride concentrations in maternal and cord blood plasma. Fluoride 2007; 40: 46–50.

18.

Doull

Boekelheide

Farishian

. Fluoride in drinking water: a scientific review of EPA’s standards. Washington, DC: National Academies Press, 2006.

19.

Gupta

Meena

. Concentration of fluoride in cow’s and buffalo’s milk in relation to varying levels of fluoride concentration in drinking water of mathura city in India—a pilot study. J Clin Diagn Res 2015; 9: LC05–LC07.

20.

Faraji

Mohammadi

Akbari-Adergani

. Correlation between fluoride in drinking water and its levels in breast milk in golestan province, Northern Iran. Iran J Public Health 2014; 43: 1664–1668.

21.

Wang

Niu

Zhu

. Changes in memory and synaptic plasticity induced in male rats after maternal exposure to bisphenol A. Toxicology 2014; 322: 51–60.

22.

Whitford

Hobbs

. Appetitive-based learning in rats: lack of effect of chronic exposure to fluoride. Neurotoxicol Teratol 2009; 31: 210–215.

23.

Mullenix

Denbesten

Schunior

. Neurotoxicity of sodium fluoride in rats. Neurotoxicol Teratol 1995; 17: 169–177.

24.

Liu

Zhang

. Fluoride exposure during development affects both cognition and emotion in mice. Physiol Behav 2014; 124: 1–7.

25.

Riedel

Platt

Micheau

. Glutamate receptor function in learning and memory. Behav Brain Res 2003; 140: 1–47.

26.

Cercato

Colettis

Snitcofsky

. Hippocampal NMDA receptors and the previous experience effect on memory. J Physiol Paris 2014; 108: 263–269.

27.

Keifer

Zheng

. AMPA receptor trafficking and learning. Eur J Neurosci 2010; 32: 269–277.

28.

Bassani

Valnegri

Beretta

. The GLUR2 subunit of AMPA receptors: synaptic role. Neuroscience 2009; 158: 55–61.

29.

Roche

. Posttranslational regulation of AMPA receptor trafficking and function. Curr Opin Neurobiol 2012; 22: 470–479.

30.

Isaac

Ashby

McBain

. The role of the GluR2 subunit in AMPA receptor function and synaptic plasticity. Neuron 2007; 54: 859–871.

31.

Erreger

Geballe

Dravid

. Mechanism of partial agonism at NMDA receptors for a conformationally restricted glutamate analog. J Neurosci 2005; 25: 7858–7866.

32.

Zhao

Toyoda

Lee

. Roles of NMDA NR2B subtype receptor in prefrontal long-term potentiation and contextual fear memory. Neuron 2005; 47: 859–872.

33.

Kaba

Hayashi

Higuchi

. Induction of an olfactory memory by the activation of a metabotropic glutamate receptor. Science 1994; 265: 262–264.