Oxyresveratrol suppresses lipopolysaccharide-induced inflammatory responses in murine macrophages

Abstract

Excessive inflammation is considered a critical factor in many human diseases. Oxyresveratrol(trans-2,3′,4,5′-tetrahydroxystilbene), a natural hydroxystilbene, has been shown to possess antioxidant and free radical-scavenging activity. In this study, we investigated the effects of oxyresveratrol (OxyR) on the lipopolysaccharide (LPS)-induced production of inflammatory cytokines and mediators and further explored the mechanism of action in RAW264.7 murine macrophage cell line. Production of nitric oxide (NO), prostaglandin E2 (PGE₂), messenger RNA (mRNA) and protein expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin 6 (IL-6), and granulocyte macrophage colony-stimulating factor (GM-CSF), phosphorylation of mitogen-activated protein kinases (MAPKs; extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), p38), and the activation of nuclear factor κ-light chain enhancer of activated B cells (NFκB) with OxyR were assayed in LPS-stimulated RAW264.7 cells. OxyR inhibited the productions of NO, PGE₂, IL-6, and GM-CSF significantly in LPS-stimulated RAW264.7 cells. OxyR suppressed mRNA and protein expressions of iNOS, COX-2, IL-6, and GM-CSF in LPS-stimulated RAW264.7 cells. OxyR suppressed the phosphorylation of Akt and JNK and p38 MAPKs and the translocation of NFκB p65 subunit into the nucleus. These results indicate that OxyR inhibits LPS-stimulated inflammatory responses though the blocking of MAPK and NFκB signaling pathway in macrophages, and suggest that OxyR possesses anti-inflammatory effects.

Introduction

Inflammation is an essential response by which the body attempts to protect itself, but when not controlled it may result in disease conditions. Macrophages, the major immune cells of innate immunity, can kill pathogens directly by phagocytosis and indirectly via the secretion of various proinflammatory mediators including prostanoids, reactive oxygen and nitrogen species, metalloproteinases, cyclooxygenase-2 (COX-2), and proinflammatory cytokines. ¹ Lipopolysaccharide (LPS), an endotoxin, induces septic shock and stimulates the production of inflammatory mediators such as nitric oxide (NO), tumor necrosis factor (TNF)-α, interleukins (ILs), prostanoids, and leukotrienes. ² NO is produced from l-arginine via nitric oxide synthase (NOS). NOS plays a major role in regulating vascular tone, neurotransmission, the killing of microorganisms, and tumor cells, and other homeostatic mechanisms. ³ The inducible NOS (iNOS) is induced by stress, proinflammatory cytokines, such as IL-1β, interferon (IFN)-γ, TNF-α, and bacterial LPS. ⁴ The-iNOS-mediated high output of NO can cause cell injury through generation of potent reactive radicals, including peroxynitrite. ⁵ Thus, controlling the inflammatory cytokines and mediators may have therapeutic potential in the treatment of various inflammatory diseases.

Stilbenes, naturally occurring polyphenolic compounds, have numerous remarkable biological properties in human health. The most well-known stilbene is resveratrol (trans-3,4′,5-trihydroxystilbene), which is present in fruits, such as grapes, wines, and root extracts of the weed Polygonum cuspidatum, and is believed to be responsible for the much-acclaimed phenomenon of the “French Paradox.” ⁶ Resveratrol has a wide range of biological and pharmacological activities including its action as a potent antioxidant, free radical-scavenger, and antiviral properties. In addition, resveratrol has been claimed to protect against cancer, heart disease, neurodegenerative disease, and inflammation. ^7–9 Oxyresveratrol(trans-2,3′,4,5′-tetrahydroxystilbene) is another natural hydroxystilbene that is readily available from mulberry (Morus alba L.). It has one more hydroxyl group than resveratrol. Morus plants have long been used as food and herbal medicine to treat inflammatory diseases in China. ¹⁰ Oxyresveratrol (OxyR) shows potential as an antioxidant and free radical-scavenger, ¹¹ an effective tyrosinase inhibitor, ¹² has hepatoprotective ¹³ and COX-inhibitory activities, ^14,15 and is a neuroprotective agent. ¹⁶ However, its effects have not been as extensively studied as those of resveratrol. Only limited data are available about effects of OxyR on inflammatory processes and kinase signaling pathways. As it is now known, anti-inflammatory properties of OxyR are through inhibition of the iNOS expression, NF-κB activation, CXCR-4-mediated chemotaxis, and MEK/ERK pathway. ^10,17

By investigating the anti-inflammatory mechanism of OxyR, several inflammatory diseases can be prevented and cured. Therefore, in this study, we investigated the effects of OxyR on the LPS-induced production of inflammatory cytokines and mediators and further explored the molecular mechanism of action in RAW264.7 murine macrophage cell line.

Materials and methods

Materials

The reagents used in this study were purchased from the following suppliers: OxyR from Cayman Chemical Company (Ann Arbor, Michigan, USA); Dulbecco’s Modified Eagle’s Medium (DMEM) from Gibco BRL (Gaithersburg, Maryland, USA); fetal bovine serum (FBS), trypsin–ethylenediaminetetraacetic acid and penicillin/streptomycin from Cambrex Bio Technology (Walkersville, Maryland, USA); dimethylsulfoxide (DMSO), LPS derived from Escherichia coli, resveratrol and anti-β-actin antibody from Sigma-Aldrich Co. (St Louis, Missouri, USA); cytokine antibody array kit, enzyme-linked immunosorbent assay (ELISA) kit for IL-6, granulocyte macrophage-colony stimulating factor (GM-CSF), and prostaglandin E2 (PGE₂) from R&D Systems (Minneapolis, Minnesota, USA); anti-NFκB p65 antibody from Santa Cruz Biotechnology (Santa Cruz, California, USA); antibodies against Akt, p-Akt, extracellular signal-regulated kinase (ERK), p-ERK, IκBα, p-IκBα (Ser32), c-Jun N-terminal kinase (JNK), p-JNK, p38 mitogen-activated protein kinase (MAPK), and p-p38 MAPK from Cell Signal Technology, Inc. (Beverly, Massachusetts, USA); unless noted otherwise, all other materials were obtained from Sigma-Aldrich Co.

Cell culture and cell viability assay

RAW264.7 murine macrophages were purchased from the Korean Cell Bank (Seoul, Korea) and maintained in DMEM containing 100 mL/L FBS, 100,000 U/L penicillin, and 100 mg/L streptomycin at 37°C in a humidified atmosphere of 5% carbon dioxide in air. To determine the effects of OxyR on cell viability, cells were plated at a density of 2 × 10⁴ cells/well in a 96-well plate, and treated with various concentrations of OxyR for 24 h. Cell viability was measured using a CellTiter 96^® AQ_ueous One Solution Cell Proliferation Assay kit (Promega, Madison, Wisconsin, USA) according to the manufacturer’s instructions. OxyR was dissolved in DMSO, and all of the cells were treated with DMSO to a final concentration of 0.01%.

Measurements of NO and PGE₂

RAW264.7 cells were plated at a density of 5 × 10⁵ cells/well in a 24-well plate and incubated for 24 h. Cells were then treated for 24 h with various concentrations of OxyR in the presence of 100 μg/L LPS. The 24-h conditioned media were collected for NO and PGE₂ analyses. As an indicator of NO production, the nitrite concentrations were measured using the Griess reagent system (Promega) and the PGE₂ concentrations were determined using an ELISA kit for PGE₂ according to the manufacturer’s instructions.

Measurement of cytokines

Cells were treated with OxyR and/or LPS, and then the 24-h conditioned media were collected, as described above. To determine whether OxyR suppressed the production of proinflammatory cytokines, the 24-h conditioned media were applied to a cytokine antibody array kit in accordance with the manufacturers’ instructions. The relative abundance of each band was quantified using the Bio-profile Bio-1D application (Vilber-Lourmat, Marine la Valle, France), and expression levels were normalized to the control protein. The levels of IL-6 and GM-CSF in the 24-h conditioned media were estimated using the relevant ELISA kits according to the manufacturer’s instructions.

Western blot analysis

Cells were lysed as described previously. ¹⁸ The protein contents of the cell lysates were measured using a BCA protein assay kit (Pierce, Rockford, Illinois, USA). Western blot analyses were conducted as described previously. ¹⁹ Signals were visualized using ECL Plus™ Western blotting Reagents (Amersham Biosciences, Boston, Massachusetts, USA). The relative abundance of each band was quantified using the Chemi Smart-2100 imaging System (Vilber-Lourmat), and expressions were normalized to β-actin.

Quantitative RT-PCR analysis

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, California, USA) and complementary DNA (cDNA) was synthesized with SuperScript II reverse transcriptase (Invitrogen), as described previously. ²⁰ Real-time polymerase chain reaction (RT-PCR) was conducted using a Roter-gene 3000 PCR (Corbett Research, Australia) as described previously. ²¹ The sequences for PCR primer sets are listed in Table 1. PCR amplification of cDNA was carried out at 94°C for 3 min, followed by 30 cycles as follows: 94°C for 5 s, 54°C for 12 s, and 72°C for 15 s. The analysis of PCR results and the calculations of relative concentrations were performed with Rotor-gene software (version 6) and the control levels (0 μg/L LPS + 0 μmol/L OxyR) were set at 1.

Table 1.

Primers sequences of murine proinflammatory mediators and GAPDH.

Primer		Sequence (5′–3′)
iNOS	Forward	AACGGAGAACGTTGGATTTG
	Reverse	CAGCACAAGGGGTTTTCTTC
COX-2	Forward	CCCTTGGGTGTCAAAGGTAA
	Reverse	GCCCTCGCTTATGATCTGTC
IL-6	Forward	TCCAGTTGCCTTCTTGGGAC
	Reverse	GTACTCCAGAAGACCAGAGG
GM-CSF	Forward	GCTTCTAGATCATTCTCTCCAC
	Reverse	GGAGCAGCAGCAGGAATCAA
GAPDH	Forward	AAGGGCTCATGACCACAGTC
	Reverse	ACTTGGCAGGTTTCTCCAGG

GAPDH: glyceraldehyde 3-phosphate dehydrogenase; iNOS: inducible nitric oxide synthase; COX-2: cyclooxygenase-2; IL-6: interleukin 6; GM-CSF: granulocyte macrophage colony-stimulating factor.

NFκB DNA binding activity assay

Nuclear extracts were prepared using Nuclear Extract kit (Active Motif, Carlsbad, California, USA). The NFκB DNA binding activity was assessed using TransAM™ NFκB p65 Transcription Factor Assay kit (Active Motif) in accordance with the manufacturer’s instructions.

Statistical analysis

The data were expressed as the means ± SEM and analyzed usinganalysis of variance. The differences between treatment groups were assessed with Duncan’s multiple-range test, using SAS system software for Windows, version 9.1 (SAS Institute, Cary, North Carolina, USA). A p value of <0.05 was considered to indicate statistical significance.

Results

OxyR has no effect in RAW264.7 cell viability

We first examined the effect of OxyR on RAW264.7 cell viability. Figure 1 presents the viability of RAW264.7 macrophages in the presence of OxyR. No notable cytotoxicity was observed when the cells were exposed at up to 80 μmol/L for 24 h. On the other hand, resveratrol, the analog of OxyR with high structural and biological similarity, caused cytotoxicity when the cells were incubated with 50 μmol/L resveratrol for 24 h (Figure 1). Because OxyR did not show cytotoxic effects up to 80 μmol/L, we used it at concentration of 0–40 μmol/L in the subsequent experiments.

Figure 1.

Effects of OxyR and R on cell viability in RAW264.7 cells. RAW264.7 cells were incubated with the indicated concentration of OxyR and R for 24 h, and the numbers of viable cells were determined using CellTiter 96^® AQ_ueous One Solution Cell Proliferation Assay kit. Each bar represents the mean ± SEM (n = 8). Means without a common letter differ, p < 0.05. OxyR: oxyresveratrol; R: resveratrol.

OxyR inhibits LPS-induced NO and PGE₂ production and iNOS and COX-2 expression in RAW264.7 cells

In order to investigate the anti-inflammatory activity of OxyR, we determined the effects of OxyR on the LPS-stimulated release of the inflammatory mediators NO and PGE₂ in RAW264.7 cells. The productions of NO and PGE₂ were dramatically increased by treatment of 100 μg/L of LPS in RAW264.7 cells. OxyR inhibited LPS-stimulated NO and PGE₂ production in a concentration-dependent fashion (Figure 2(a) and (b)).

Figure 2.

Effect of OxyR on LPS-induced NO and PGE₂ production and iNOS and COX-2 expression in RAW264.7 cells. Cells were treated with 0–40 μmol/L of oxyresveratrol in the presence of 100 μg/L LPS or with LPS alone for 24 h. The media were conditioned for 24 h and then collected for NO and PGE₂ assays. (a) NO and (b) PGE₂ production was determined. Each bar represents the mean ± SEM (n = 8). Means without a common letter differ, p < 0.05. (c) Cell lysates were analyzed by Western blotting with an anti-iNOS, COX-2, or β-actin antibody. Photographs of chemiluminescent detection of the blots, which are representative of three independent experiments, are shown. The relative abundance of each band to their own β-actin was quantified and the control levels were set at 100. The adjusted mean ± SEM (n = 3) of each band is shown above each blot. Means without a common letter differ, p < 0.05. (d) and (e) Total RNA was isolated, reverse-transcribed, and RT-PCR was conducted. Each bar represents the mean ± SEM (n = 8). Means without a common letter differ, p < 0.05. OxyR: oxyresveratrol; LPS: lipopolysaccharide; NO: nitric oxide; PGE₂: prostaglandin E2; iNOS: inducible nitric oxide synthase; COX-2: cyclooxygenase-2.

We next examined whether the inhibitory effects of OxyR on NO and PGE₂ production result from decreased mRNA and protein expression of iNOS and COX-2, because those enzymes catalyze the reactions generating NO and PGE₂, respectively. As shown in Figure 2(c), the protein expressions of iNOS and COX-2 were markedly induced by treatment of 100 μg/L LPS in RAW264.7 cells. OxyR also inhibited the LPS-stimulated increases of iNOS and COX-2 expression in a dose-dependent manner (Figure 2(c)). Consistent with these results, OxyR suppressed LPS-stimulated iNOS and COX-2 mRNA expression (Figure 2(d) and (e)). These results suggest that the anti-inflammatory properties of OxyR may involve the inhibition of iNOS and COX-2 expression.

OxyR inhibits LPS-stimulated IL-6 and GM-CSF production in RAW264.7 cells

To further investigate the anti-inflammatory effects of OxyR, we next examined its effect on the production of proinflammatory cytokines using a mouse cytokine array kit. Among the 40 cytokines measurable with this array kit, the production of IL-6 and GM-CSF was markedly decreased by OxyR treatment in cells treated with LPS (data not shown). We next conducted ELISAs for IL-6 and GM-CSF to confirm these results. Production of IL-6 and GM-CSF increased remarkably in LPS-stimulated RAW264.7 cells, and these increases were suppressed by OxyR treatment, dose-dependently (Figure 3(a) and (b)). In addition, the LPS-stimulated mRNA levels of IL-6 and GM-CSF were reduced in OxyR-treated cells, in a dose-dependent fashion (Figure 3(c) and (d)).

Figure 3.

Effects of OxyR on LPS-induced secretion of IL-6 and GM-CSF in RAW264.7 cells. RAW 264.7 cells were treated with 0–40 μmol/L of oxyresveratrol in the presence of 100 μg/L LPS or with LPS alone for 24 h. (a) and (b) The 24-h conditioned media were collected for ELISA. (c) and (d) Total RNA was isolated, reverse-transcribed, and RT-PCR was conducted. Each bar represents the mean ± SEM (n = 8). Means without a common letter differ, p < 0.05. OxyR: oxyresveratrol; LPS: lipopolysaccharide; IL-6: interleukin 6; GM-CSF: granulocyte macrophage-colony stimulating factor; ELISA: enzyme-linked immunosorbent assay; RT-PCR: real-time polymerase chain reaction.

OxyR inhibits LPS-induced NFκB signaling in RAW264.7 cells

In order to examine the mechanisms underlying the inhibition of LPS-induced expression of iNOS and COX-2, we examined the effect of OxyR on the nuclear translocation of NFκB. The cells were treated with 0–40 μmol/L OxyR in the presence of 100 μg/L LPS for 24 h, and we determined the steady state protein level and phosphorylation state of IκBα from cell lysates. And we determined NFκB p65 levels in the cytosolic and nuclear fractions of each cell and NFκB DNA binding activity. As shown in Figure 4(a), LPS induced the degradation of IκBα and the treatment with OxyR prevented LPS-induced IκBα degradation. LPS was shown to increase the levels of phospho-IκBα and OxyR treatment significantly prevented the LPS-induced increase in phospho-IκBα levels. The translocation of the p65 subunit of NFκB from the cytoplasm to the nucleus was also blocked by OxyR treatment (Figure 4(b)). Consistent with the nuclear NFκB p65 translocation, LPS-induced DNA-binding of NFκB was significantly suppressed in LPS-stimulated RAW264.7 cells exposed to OxyR (Figure 4(c)). These results suggest that the anti-inflammatory properties of OxyR may be correlated with the inhibition of inflammatory mediators through down-regulation of NFκB binding activity.

Figure 4.

Effect of OxyR on LPS-stimulated NFκB signaling in RAW264.7 cells. Cells were treated with 0–40 μmol/L of oxyresveratrol in the presence of 100 μg/L LPS or with LPS alone for 24 h. (a) Cell lysates and (b) cytosolic and nuclear fractions of each cell were analyzed via Western blotting with the indicated antibodies. Photographs of chemiluminescent detection of the blots, which are representative of three independent experiments, are shown. The relative abundance of each band to their own β-actin was quantified and the control levels were set at 100. The adjusted mean ± SEM (n = 3) of each band is shown above each blot. Means without a common letter differ, p < 0.05. (c) nuclear proteins were extracted, and 2 μg of nuclear protein were assayed for the ability to bind with the immobilized NFκB consensus site using TransAM^TM NFκB p65 Transcription Factor Assay kit. Each bar represents the mean ± SEM (n = 3). Means without a common letter differ, p < 0.05. OxyR: oxyresveratrol; LPS: lipopolysaccharide; NFκB: nuclear factor kappa-light-chain-enhancer of activated B cells.

OxyR suppresses LPS-induced phosphorylation of Akt and MAPKs in RAW264.7 cells

Akt and MAPKs have been identified as important regulators of NFκB activation, and the subsequent expression of inflammatory mediators, including iNOS, COX-2, and various cytokines in RAW264.7 cells. ^19,22 Thus, we next investigated the influence of OxyR on LPS-induced activation of MAPKs (ERK, JNK, and p38) and Akt. As shown in Figure 5, LPS stimulation induced the phosphorylation of ERK, JNK, p38 MAPK, and Akt in RAW264.7 cells. However, OxyR suppressed the phosphorylation of Akt, JNK, and p38 MAPK in LPS-stimulated RAW264.7 cells. The phosphorylation of LPS-induced ERK was not altered by OxyR treatment (Figure 5). These results indicate that signal transduction by MAPK molecules and Akt may be blocked effectively by OxyR in activated macrophages.

Figure 5.

Effect of OxyR on LPS-stimulated phosphorylation of Akt and MAPKs in RAW264.7 cells. Serum-deprived cells were treated with 0–40 μmol/L of oxyresveratrol and/or 100 μg/L LPS for 24 h. Cell lysates were analyzed via Western blotting with the indicated antibodies. Photographs of chemiluminescent detection of the blots, which are representative of three independent experiments, are shown. The relative abundance of the phosphorylated band to its own total proteins was quantified and the control levels were set at 100. The adjusted mean ± SEM (n = 3) of each band is shown above each blot. Means without a common letter differ, p < 0.05. OxyR: oxyresveratrol; LPS: lipopolysaccharide; MAPK: mitogen-activated protein kinase.

Discussion

Despite previous studies reporting that OxyR has anti-inflammatory effects, little is known about its molecular targets or a signaling mechanism. Thus, in this study, we examined the effects of OxyR on the production of several inflammatory mediators and cytokines and the molecular mechanisms of action in LPS-induced RAW264.7 macrophages. We showed that OxyR inhibited the mRNA and protein expression of iNOS and COX-2, as well as production of NO and PGE₂. To determine the molecular mechanisms underlying the suppression of the inflammatory response, the effects of OxyR on LPS-induced activation of the NFκB, Akt, and MAPKs pathways were investigated. Our result demonstrated that the anti-inflammatory effects of OxyR are mediated through the inhibition of IκBα phosphorylation, nuclear translocation of the NFκB p65 subunit, Akt phosphorylation, and MAPKs (JNK and p38) phosphorylation.

Macrophages participate actively in inflammatory responses by releasing proinflammatory cytokines and inflammatory factors. ²³ The inflammatory response has been studied extensively in LPS-stimulated RAW264.7 macrophage cells, which are very sensitive to LPS-stimulation and respond by activation of proinflammatory transcription factors, such as, NFκB and activator protein-1 (AP-1) resulting in TNF-α, IL-1β, IL-6, IL-8, and NO production. ^24,25 LPS induces production of reactive oxygen species (ROS), which are capable of eliciting a variety of pathological changes, including the peroxidation of lipids, proteins, and DNA. An elevated level of ROS activates MAPKs and inflammatory transcription factors. ^26–28 LPS also induces the expression of phosphorylated MAPK ²⁷ and activation of the cytoprotective phosphatidylinositol 3-kinase (PI3K)-Akt pathway. ²⁹ All of these processes have significant roles in innate immunity during normal or severe inflammatory immune responses. ³⁰ Overproduction of inflammatory mediators, including NO and PGE₂, plays an important role in the pathophysiology of many inflammatory diseases. ²³ NO plays an important role in cell survival and death. High levels of NO, however, are cytotoxic in many inflammatory diseases. ³¹ PGE₂ is an inflammatory mediator generated in inflammatory distress by COX-2, also known as prostaglandin endoperoxide synthase, and induced by LPS, pro inflammatory cytokines, tumor promoters, oncogenes, and growth factors, and is involved primarily in the regulation of inflammation. ³² Thus, COX-2 inhibitors represent a major advance in the therapy of inflammatory processes and their use includes prevention or treatment of disorders associated with the induction of this enzyme, such as colon cancer. ³³ In our study, OxyR effectively decreased NO and PGE₂ production via suppressing mRNA and protein expressions of iNOS and COX-2 in LPS-stimulated RAW264.7 cells. These data suggest that the inhibition of NO and PGE₂ production by OxyR may be due to the suppression of iNOS and COX-2 upregulation in the activation of macrophages by LPS.

Uncontrolled production of proinflammatory mediators, such as inflammatory cytokines and chemokines, by activated macrophages can result in tissue damage, endotoxemia, cancer, and inflammatory disease. ^34,35 In this study, OxyR effectively inhibited the production of IL-6 and GM-CSF by suppressing their mRNA expressions in LPS-stimulated RAW264.7 cells. GM-CSF, originally discovered as a major cytokine governing the functions of granulocyte and macrophage, also involves in inflammatory disease. ³⁶ Under normal physiological conditions, GM-CSF serves as a bona fide growth factor for hematopoietic cells promoting the proliferation and maturation of multiple myeloid cell lineages. ³⁷ In neoplastic settings, GM-CSF has been shown to be have the potential to exert both pro- and anti-tumorigenic effects by suppressing or enhancing tumor immunity, respectively. ³⁶ The GM-CSF gene is a novel cytokine gene the expression of which is controlled by binding of the NFκB transcription factor to a high-affinity binding site in the GM-CSF promoter. ³⁸ In vitro studies on immune cells, including monocytes, macrophages, and neutrophils, treated with GM-CSF illustrated that it could activate these cell types with better survival, releasing certain inflammatory mediators and killing certain organisms and tumors. ³⁶ It was also found that macrophages could be primed with GM-CSF to respond more strongly to a second stimulus, such as LPS. ³⁹ Mice are quickly primed by GM-CSF so that they can produce more circulating proinflammatory cytokines following a subsequent challenge with LPS and TNF-α. ⁴⁰ From these accumulating data, GM-CSF could contribute to inflammation through cell recruitment, increased cell survival, and/or priming for activation. IL-6, originally identified as a B-cell differentiation factor, is now known to be a multifunctional cytokine that regulates the immune response, hematopoiesis, inflammation, and the acute-phase response. ³⁴ Inflammatory cytokines suppressed by OxyR are known to include TNF-α, IL-1β, and IL-6. ^33,41,42 This study clarified that OxyR inhibited LPS-induced GM-CSF expression. From this result, it seems feasible that OxyR may affect inflammation by inhibiting the secretion of LPS-induced IL-6 and GM-CSF.

NFκB, a transcription factor, is known to play a critical role in the regulation of cell survival genes and to induce the expression of inflammatory enzymes and cytokines, such as iNOS, COX-2, TNF-α, IL-1β, and IL-6. ^38,43–47 Under quiescent conditions, NFκB is sequestered in the cytosol, bound to the inhibitory protein IκB-α. Exposure of cells to LPS triggers phosphorylation cascades that ultimately lead to phosphorylation and degradation of IκBα. Once IκBα dissociates from the complex, NFκB translocates into the nucleus where binding to specific DNA motifs in promoter region occurs, leading to increased transcription of target genes. ⁴⁸ Moreover, NFκB can regulate the expression of proinflammatory cytokines in response to several different signals. ⁴⁹ From these results, it can be suggested that it is via NFκB that OxyR inhibits NO, IL-6, and GM-CSF production.

One of the LPS-induced pathways involves the MAPKs. MAPK family, which includes ERK, JNK, and p38 subgroups, regulates cellular responses to different extracellular stimuli and acts as a multi-functional mediator of signaling pathways including cell death, differentiation, proliferation, migration, and inflammation. ^50,51 MAPKs have been implicated in the regulation of iNOS and COX-2 genes because specific MAPK inhibitors suppress their expression. ⁵² Akt has been shown to be the primary downstream mediator of the effects of PI3K and regulates a variety of cellular process through the phosphorylation of a wide spectrum of downstream substrates. ⁵³ In this study, we demonstrated that the activation of Akt, JNK, and p38 with LPS stimulation were significantly reduced by OxyR treatment, but not ERK. These results demonstrated that OxyR inactivates JNK and p38, as well as Akt. This inactivation, then, of MAPKs and the Akt signaling pathway results in the anti-inflammatory response.

Conclusion

OxyR significantly inhibited the productions of NO, PGE₂, IL-6, and GM-CSF in LPS-stimulated RAW264.7 cells. OxyR suppressed the mRNA and protein expressions of iNOS, COX-2, IL-6, and GM-CSF in LPS-stimulated RAW264.7 cells. The molecular mechanism of OxyR-mediated attenuation in RAW264.7 cells apparently involves suppressing the phosphorylation of Akt, JNK, and p38 MAPKs, and the translocation of NFκB p65 subunit into the nucleus. These results indicate that OxyR inhibits LPS-stimulated inflammatory response though the blocking of the Akt, MAPK, and NFκB signaling pathways in macrophages, and suggest that OxyR possesses anti-inflammatory effects.