Abstract
Aim:
To investigate whether lycopene can modulate adiponectin levels and SIRT1 and FoxO1 gene expression in the adipose tissue of diet-induced obese rats.
Methods:
Male Wistar rats were first fed with hypercaloric diet (HD, n = 12) for 6 weeks, and afterward, these rats were randomly assigned to receive HD (n = 6) or HD with lycopene-rich tomato oleoresin (equivalent to lycopene 10 mg/kg body weight (BW)/day, HD + L, n = 6) by gavage for additional 6 weeks. Plasma lycopene and adiponectin levels were analyzed by high-performance liquid chromatography and immunoassay, respectively. The messenger RNA (mRNA) expressions of adiponectin, Sirtuin 1 (SIRT1), Forkhead box O 1 (FoxO1), fatty acid translocase/cluster of differentiation 36 (FAT/CD36), and PPARγ in adipose tissues were determined by quantitative polymerase chain reaction.
Results:
Lycopene was detected in the plasma of rats in HD + L group but not in the HD group. Although both BW and adiposity were not different between the two groups, there was a significant increase in both plasma concentration and mRNA expression of adiponectin in the adipose tissue of the HD + L group. In addition, the lycopene supplementation upregulated mRNA expressions of SIRT1, FoxO1, and FAT/CD36 but downregulated PPARγ in adipose tissue of obese rats.
Conclusion:
These data suggest that lycopene, in the concentration used, is not toxic and also its health benefits in adipose tissue may play a role against obesity-related complications.
Introduction
Adiponectin, one of the biologically active adipokines, is produced and secreted by adipose tissue. This adipose-derived protein acts locally, in autocrine and paracrine fashion, and also mediates endocrine effects through the systemic circulation. 1 Adiponectin plays an important role in lipid and carbohydrate metabolism. 2 It stimulates fatty acids oxidation, suppresses hepatic gluconeogenesis, and increases insulin sensitivity. 3 Also it displays anti-atherogenic, 4 antidiabetic, 5 and anti-inflammatory 6 functions. Adiponectin serum levels are negatively correlated with obesity and insulin resistance. 3 The decreased levels of adiponectin may play an important role in the progression of obesity-related complications. 7 However, the underlying mechanism of adiponectin levels is not fully understood.
Sirtuin 1 (SIRT1), a nicotine adenine dinucleotide-dependent protein deacetylase, has been examined for its role in caloric restriction, in preventing aging-related diseases, and in maintenance of metabolic homeostasis. 8 SIRT1 is increasingly referred to as a master metabolic regulator due to its ability to modify and control numerous transcription factors involved in the body’s metabolic homeostasis, including the function and regulation of adipocyte generation. 9 Activation of SIRT1 has been shown to protect against high-fat diet-induced obesity and metabolic disarrangements. 10 Forkhead box O 1 (FoxO1) is a transcriptional factor involved in the regulation of adipocyte differentiation and in transcription of adiponectin. 11 The protein levels of FoxO1 are greatly reduced in fat tissues from high-fat diet-induced obesity and type 2 diabetic mouse models. 7 It has been shown that SIRT1 and FoxO1 are involved in the transcriptional regulation of adiponectin. 12,13
Lycopene, an acyclic carotenoid containing 11 conjugated double bonds, is a nonprovitamin A carotenoid 14 found in red fruits and vegetables, especially tomatoes. 15 It is one of the most potent antioxidants among dietary carotenoids mainly due to its many conjugated double bonds, 16 and it also has the strongest singlet oxygen-quenching ability compared to other carotenoids. 17 Besides quenching singlet molecular oxygen and peroxyl radicals, 18 lycopene has been demonstrated to present anti-inflammatory effects. 19 –21 Obese patients present a chronic low-grade inflammatory state, 22,23 which is associated with lower plasma carotenoids. 24 A clinical study showed that lycopene-rich food reduces the inflammatory mediators that are associated with overweight and obesity in females. 25 In addition, it has been shown that lycopene is taken up by adipocytes and adipose tissue via a facilitated process that involves fatty acid translocase/cluster of differentiation 36 (FAT/CD36) 26 and modulates cytokines in adipose tissue in vitro and ex vivo studies. 27 Since lycopene has been shown to display anti-inflammatory effects in adipose tissue, 27,28 we tested the hypothesis whether lycopene modulates adiponectin levels in obesity. Also we evaluated the effect of lycopene on gene expressions of SIRT1 and FoxO1 in adipose tissue from obese rats. Thus, the aim of this study is to test whether lycopene-rich tomato oleoresin may modulate adiponectin expression and secretion by affecting SIRT1 and FoxO1 messenger RNA (mRNA) levels in obese rats.
Materials and methods
Animal care
Male Wistar rats (10 weeks old, weighing approximately 350 g), from Animal Center of Botucatu Medical School, São Paulo State University (Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP)), Botucatu, São Paulo, Brazil), were housed in individual cages for 12 weeks in the animal facility at Internal Medicine Experimental Laboratory, UNESP, Brazil. The rats consumed water and high-fat diet ad libitum and were maintained in a controlled ambient temperature (22–26°C) and lighting (12-h light/12-h dark cycle). Dietary consumption was measured daily, and body weight (BW) was assessed weekly. The experiment was conducted in accordance with the Guidelines for the Care and Use of Experimental Animals, and the protocol was approved by the local ethical committee for animal research (protocol # 930-2012).
Experimental protocol
The rats (n = 12) received hypercaloric diet (HD; 49.7% kcal from fat) plus sugar in drinking water (300 g/L) to mimic obesity from Western occidental dietary habits, as previously described, 29 for 6 weeks. At week 6, the rats were randomly assigned to two groups, namely HD (n = 6) or HD supplemented with lycopene-rich tomato oleoresin (6% Lyc-O-Mato, LycoRed Natural Products Industries, Beer-Sheva, Israel, HD + L, n = 6). The tomato oleoresin was mixed with corn oil (equivalent to 10 mg lycopene/kg BW/day), 30,31 and was given daily by gavage every morning for a 6-week period. 32,33 To avoid differences in the energy provided, both groups received the same corn oil volume (approximately 2 mL/kg BW/day). In order to confirm obesity in HD-fed rats, additional rats of the same age, fed with a chow diet (12% kcal from fat), were used as the control group. Animals were killed by decapitation under deep sodium pentobarbital, injected intraperitoneally (50 mg/kg), anesthesia. Plasma and epididymal adipose tissue were collected at week 12 and stored at −80°C until required for analyses.
Lycopene preparation
Tomato oleoresin, containing 6% lycopene and small amounts (<2.5%) of other substances, such as γ-tocopherol, α-tocopherol, β-carotene, phytofluene, and phytoene, 34 was mixed with corn oil and stored at 4°C in the dark until use as previously described. 35 The tomato oleoresin–corn oil mixture was stirred for 20 min in a water bath at 54°C before being fed to the animals. Each milliliter of solution contained 5 mg of total lycopene. The stability of lycopene was monitored at 450 nm and confirmed by diode-array spectra, as previously described. 36 Lycopene was stable in the tomato oleoresin–corn oil mixture for 9 weeks at −20°C.
Adiposity index
The sum of epididymal, retroperitoneal, and visceral fat deposits divided by BW multiplied by 100 37 was used to calculate the adiposity index, which confirms obesity in the animals.
HPLC analysis
Lycopene analysis was previously described by Luvizotto et al. 29 Briefly, 400 μL aliquot of plasma samples were extracted with 3 mL of chloroform:methanol (2:1) followed by 3 mL of hexane. Samples were dried under nitrogen atmosphere, and the residue was redissolved in 100 μL ethanol, of which 25 μL was injected into the high-performance liquid chromatography (HPLC) system (Waters Alliance, Waters Instruments Inc., Milford, Massachusetts, USA). A C30 carotenoid column (3 μm, 150 × 4.6 mm, YMC, Wilmington, North Carolina, USA) and a 450 nm detector were used. The HPLC mobile phase consisted of methanol:methyl-tert-butyl ether:water (83:15:2, vol:vol:vol, with 1.5% ammonium acetate in water; solvent A) and methanol:methyl-tert-butyl ether:water (8:90:2, vol:vol:vol, with 1% ammonium acetate in water; solvent B). Results were adjusted using an internal standard containing echinenone. The inter-(n = 3) and intraassay (n = 8) coefficient of variation was 9%. The recovery of the added internal standard was consistently >90%. All sample processing and analysis was carried out under red light.
Adiponectin measurement
Adiponectin plasma concentration was measured by immunoassay (Millipore, St Charles, Missouri, USA) and determined using a microplate reader (Spectra Max 190; Molecular Devices, Sunnyvale, California, USA).
Total RNA isolation and reverse transcription
Whole RNA was extracted from epididymal adipose tissue using the TriPure reagent (Roche Applied Science, Germany). The primer Random p(dN)6 and Moloney murine leukemia virus RT (Invitrogen, Carlsbad, California, USA) were utilized for the synthesis of 20 μL of complementary DNA (cDNA) from 400 ng of whole RNA.
Real-time PCR
The mRNA levels of adiponectin (NCBI reference sequence: NM_144744.3; forward: 5′ AAACTTGTGCAGGTTGGATGG 3′ and reverse: 5′ AAGAACACCTGCGTCTCCCTT 3′), SIRT1 (NCBI reference sequence: XM_003751934.1; forward: 5′ TCCTCCACCTGAGTTGGATGA 3′ and reverse: 5′ CACAGGAAACAGAAACCCCAG 3′), FoxO1 (NCBI reference sequence: NM_001191846.2; forward: 5′ AGGATAAGGGCGACAGCAAC 3′ and reverse: 5′ CGGGGTGATTTCCCACTCTT 3′), peroxisome proliferator-activated receptor gamma (PPARγ; NCBI reference sequence: NM_013124.1; forward: 5′ GGAAAAAACCCTTGCATCCTTC 3′ and reverse: 5′ TTCAAACTCCCTCATGGCCA 3′), and FAT/CD36 (NCBI reference sequence: AF072411.1; forward: 5′ GAATTAGTTGAACCAGGCCACA 3′ and reverse: 5′ AATGAGCCCACAGTTCCGA 3′) were determined by real-time polymerase chain reaction (PCR). Quantitative measurements were made with the SYBR Green quantitative PCR kit (Invitrogen) in the detection system 7500 Applied Biosystems. Cycling conditions were as follows: enzyme activation at 50°C for 2 min, denaturation at 95°C for 10 min, the cDNA products were amplified for 40 cycles of denaturation at 95°C for 15 s, and annealing/extension at 60°C for 1 min. Product purity was confirmed by dissociation curve analysis. Gene expression was quantified in relation to the values of the C group after normalization using an internal control (β-actin—NCBI reference sequence: NM_031144.3; forward: 5′ CAACCGTGAAAAGATGACCCAG 3′ and reverse: 5′ AGCGCGTAACCCTCATAGATGG 3′) by the method 2 − ΔΔCt, as previously described. 38
Statistical analysis
Results were expressed as the mean ± SD, and significance of differences were calculated by the Student’s t test, using SigmaStat version 3.5 for Windows (Systat Software, Inc. San Jose, California, USA). A p level of 0.05 was used to determine the significance.
Results
BW and adiposity index
There were no differences in BW among the groups at the beginning of the study (on average 348 ± 36 g). At the time of killing, the mean BWs of the HD-fed animals were significantly higher than the control animals (C: 489 ± 58 g vs. HD: 579 ± 71 g, p < 0.05). The adiposity index was also significantly higher in the HD-fed rats (C: 5.3 ± 1.2% vs. HF: 9.5 ± 1.7%, p < 0.001) as compared to the control rats, indicating obesity in the HD group. There were no significant differences in the BW and adiposity index between the HD group and the HD + L group (Table 1).
BW, adiposity index, and plasma levels of lycopene.a
HD: hypercaloric diet-fed rats; HD + L: HD-fed rats supplemented with lycopene for 6 weeks; ND: not detected; BW: body weight.
aValues are mean ± SD, n = 6.
bTotal lycopene includes both cis and all-trans isomers. Student’s t test was used to compare groups.
Plasma concentration of lycopene
As previously shown by Luvizotto et al., 29 total lycopene, including both cis and all-trans isomers, was analyzed in plasma. No lycopene was detected in the plasma of HD group. However, after 6 weeks of lycopene supplementation, lycopene was detected in plasma and the concentration of lycopene reached 23.6 ± 10.4 nmol in the plasma of HD + L group (Table 1).
Plasma concentration of adiponectin
Lycopene supplementation significantly increased adiponectin plasma concentration (Figure 1(a); HD: 9.6 ± 1.4 μg/mL vs. HD + L: 13.4 ± 1.8 μg/mL, p < 0.005).

Effect of lycopene supplementation on adiponectin plasma concentration (a) and adiponectin mRNA levels in adipose tissue (b). Values are mean ± SD, n = 6. The groups include HD and HD + L rats. Dotted line represents mean values of control group. Student’s t test was used to compare groups, HD versus HD + L. HD: hypercaloric diet; L: lycopene.
Gene expressions
Lycopene supplementation was able to upregulate gene expressions of adiponectin (Figure 1(b)), SIRT1 (Figure 2(a)), FoxO1 (Figure 2(b)), and FAT/CD36 (Figure 3) in the adipose tissue. In contrast, lycopene supplementation downregulated PPARγ mRNA levels (Figure 2(c)) in the adipose tissue.

Effect of lycopene supplementation on SIRT1 mRNA levels (a), FoxO1 mRNA levels (b), and PPARγ mRNA levels (c) in adipose tissue. Values are mean ± SD, n = 6. The groups include HD and HD + L rats. Dotted line represents mean values of control group. Student’s t test was used to compare groups, HD versus HD + L. HD: hypercaloric diet; L: lycopene; SIRT1: sirtuin 1.

Effect of lycopene supplementation on FAT/CD36 mRNA levels in adipose tissue. Values are mean ± SD, n = 6. The groups include HD and HD + L rats. Dotted line represents mean values of control group. Student t test was used to compare groups, HD versus HD + L. HD: hypercaloric diet; L: lycopene; FAT: fatty acid translocase; CD36: cluster of differentiation 36.
Discussion
Adiponectin is expressed in the functional adipocytes from lean organisms, while it is downregulated in the dysfunctional adipocytes that are associated with obesity. 39 This obesity-induced downregulated expression has been linked to the pathogenesis of various diseases. 40 –43 In this study, for the first time, we demonstrated in vivo that lycopene was able to increase adiponectin mRNA levels in diet-induced obesity (Figure 1(b)), independent of the adiposity index in the rats (Table 1). The increase in mRNA levels by lycopene was accompanied by an increase in plasma concentration of adiponectin (Figure 1(a)), indicating that the increase in adiponectin plasma concentration could be due an increased adiponectin mRNA synthesis in the adipose tissue. Several studies have shown that the upregulation of adiponectin has antiobesity effects, 3 –6 and lycopene can decrease inflammatory markers 19 –21,25,27 and reduce obesity-related complications, such as nonalcoholic steatohepatitis. 33 Thus, this study suggests that the upregulating adiponectin may contribute to the beneficial effects of lycopene.
One of the interesting findings of our study was that lycopene, besides modulating adiponectin expression and secretion, induced SIRT1 mRNA levels in the adipose tissue (Figure 2(a)). Although previous study showed that lycopene metabolite apo-10′-lycopenoic acid can induce SIRT1 expression in the livers of ob/ob mice, 44 in this study, we demonstrated for the first time that lycopene can upregulate SIRT1 mRNA levels in adipose tissue of HD-fed rats. SIRT1 is involved in a variety of biological processes such as fatty acid mobilization in adipose tissue, a stimulus of mitochondrial biogenesis, and prevention of metabolic syndrome. 45 Resveratrol, as an SIRT1 activator, 46 has been found to have many effects, such as improving insulin sensitivity, inhibiting tumor growth, suppressing inflammation, promoting cardiovascular health, and protecting against neurodegenerative diseases. 47,48 Although we did not observe any effects of lycopene on BW or adiposity index, which could be due to a short period of time of lycopene treatment, we provided evidences that SIRT1 expression can be induced by lycopene.
It has been shown that SIRT1 and FoxO1 are involved in transcriptional regulation of adiponectin. 12,13 Interestingly, in addition to the induction of SIRT1 mRNA, we found that lycopene induced FoxO1 mRNA levels in adipose tissue (Figure 2(b)). It has been identified that FoxO1 regulates adiponectin transcription, showing that FoxO1 haploinsufficiency decreases adiponectin levels. 11 In addition, FoxO1 knockdown decreases adiponectin levels. 49 FoxO1 is a substrate of SIRT1, and both are involved in adipogenesis. 9,11 SIRT1 regulates FoxO1 by deacetylating three lysine residues within the DNA-binding domain of FoxO1 and promotes FoxO1 nuclear translocation. 50 In the nucleus, FoxO1 forms a complex with CCAAT/enhancer-binding protein α through the forkhead domain, stimulated by SIRT1, resulting in adiponectin promoter activation. 12 Taken together, the data of this study suggest that lycopene upregulated both SIRT1 and FoxO1, which might mediate adiponectin gene expression in the adipose tissue.
PPRAγ is a central regulator of adipogenesis and plays an important role in adipose tissue development. 51 We demonstrated reduced PPARγ mRNA levels in the HD group with lycopene supplementation (Figure 2(c)). The lycopene modulation of PPARγ mRNA levels in adipose tissue is still unknown; however, it has been shown that SIRT1 promotes fat mobilization by repressing PPARγ in mice adipocytes. 9 Also, FoxO1 represses PPARγ gene expression in primary adipocytes. 52
Moreover, we found that mRNA expression of FAT/CD36, a transporter that facilitates uptake of long-chain fatty acid in adipocytes, 53 was increased in the adipose tissue of the lycopene-supplemented group, as compared to the nonsupplemented group (Figure 3). Indeed, we detected lycopene in the adipose tissue (unpublished data). These results are in agreement with FAT/CD36 involvement in the uptake 26 and storage of lycopene 54 in adipose tissue.
We need to point out that we cannot exclude the potential contribution of other compounds in the tomato oleoresin to the observations of the study, while there are small amounts of γ-tocopherol, α-tocopherol, β-carotene, phytofluene, and phytoene in the tomato oleoresin. 34 However, since phytofluene and phytoene were not detected in both plasma and adipose tissue of rats fed with the tomato oleoresin and we did not observe any significant difference in the levels of tocopherols and β-carotene between the HD and HD + L groups by HPLC analysis (data not shown), we believe that the effects of tomato oleoresin supplementation were due to lycopene, the major compound in tomato oleoresin.
In conclusion, the present data show that the 10 mg/kg BW of lycopene did not present toxic effects; also this study provides new information regarding the benefits of lycopene. Lycopene had the ability to upregulate mRNA levels and plasma concentration of adiponectin, which was associated with the upregulation of SIRT1 and FoxO1 in adipose tissue from obese rats. Since adiponectin is considered to be a protective adipokine and displays anti-inflammatory functions, the upregulation of adiponectin by lycopene may play a role against obesity and its related complications.
Footnotes
Acknowledgments
We thank Kang-Quan Hu, Mario B Bruno, and José Carlos Georgette for their technical support. We also are grateful to LycoRed Natural Products Industries, Beer-Sheva, Israel, for supplying the tomato oleoresin.
Conflict of interest
The authors declared no conflicts of interest.
Funding
We thank Sao Paulo Research Foundation for financial support (FAPESP #10/06100-9, #10/19746-4, #11/19934-8, #11/22786-0) and U.S. Department of Agriculture, under agreement No. 1950-51000-056.
