Sage Journals: Discover world-class research

Abstract

Background

The increasing prevalence of drug-resistant Neisseria gonorrhoeae (NG) infections has caused great concern. Ciprofloxacin remains the empiric antimicrobial recommended to treat NG infections in Peru disregarding the susceptibility profile of circulating NG strains. We report the prevalence of individuals infected with NG strains presenting mutations in the gyrA gene that confers ciprofloxacin resistance.

Methods

We conducted a descriptive study assessing extragenital swab samples collected from a cohort of men who have sex with men and transgender women in Lima, Peru. Anal and pharyngeal NG positive swabs for Aptima Combo 2 assay (Hologic Inc., USA) were used for DNA extraction. We performed TaqMan real time PCR assays to detect a point mutation at codon Ser91 of the gyrase A (gyrA) gene.

Results

From 156 individuals who had at least one positive sample for NG reported by the Aptima assay, 80 individuals had at least one amplified DNA for the gyrA gene. We found that 67 of them (84.0%) were infected with a gyrA-mutated NG strain at the Ser91 codon.

Conclusions

We report a high prevalence of gyrA mutation conferring ciprofloxacin resistance among individuals with extragenital NG infection. Empirical treatment of NG needs to be urgently updated in Peru in concordance with international guidelines.

Keywords

mutations antimicrobial resistance Peru

Introduction

Neisseria gonorrhoeae (NG), etiological agent of gonorrhea, is the second most common bacterial sexually transmitted infection (STI), with an estimated incidence of 82.4 million new cases among people aged 15–49 years worldwide in 2020.¹ Key populations such as men who have sex with other men (MSM) and transgender women (TW) have a disproportionate burden of gonorrhea globally.² In Peru, the prevalence of gonorrhea in general population was around 0.1%;³ while, prevalence of extragenital NG infections among MSM and TW is estimated at up to 9.6%.⁴

NG has developed resistance to most antimicrobials that have been used to treat it over the last 80 years.⁵ Because of the sustained increase of quinolone resistance, the CDC stopped recommending ciprofloxacin as the empiric treatment for NG infections more than 10 years ago.⁶ However, the use of ciprofloxacin is useful if the sensitivity of NG to this antibiotic is known through antimicrobial susceptibility testing.⁷ In Peru, ciprofloxacin remains the recommended treatment for NG infections, regardless of antibiogram test results.⁸ There have been few studies reporting the presence of NG ciprofloxacin resistance in Latin American countries,⁹ especially in Peru,^10–13 where recently a study reported that 66 (94.3%) of 70 culture isolate of NG infections from MSM were ciprofloxacin resistant.¹³ In addition, a systematic review confirmed that detection of the Ser91 codon mutation in the gyrase A (gyrA) gene, by molecular techniques like quantitative real-time polymerase chain reactions (qPCR), predicts NG susceptibility to ciprofloxacin (sensitivity and specificity >98%).¹⁴

Because NG infections among MSM and TW have frequently occurred in anal and pharyngeal locations, and most of these cases are asymptomatic, undiagnosed, and untreated, the high prevalence has continued among them.² Moreover, NG strains circulating in these populations were described as having increased antimicrobial resistance and rapid spread.¹⁵

In this study, we aimed to determinate the gyrA genotype in stored NG swabs samples to better document the prevalence of NG mutations conferring ciprofloxacin resistance among a cohort of MSM and TW in Lima, Peru.

Methods

Clinical swab specimens from pharyngeal and anal anatomic locations were collected quarterly during 24 months between June 2013 and July 2016, as part of the PICASSO cohort, a study that aimed to estimate the incidence and characterize the syphilis infection under social, diagnostic, immunological and molecular determinants, among MSM and TW in Lima, Peru. More details of the cohort methods were described previously.¹⁶ In summary, participants were recruited from two STI clinics and were included if they were ≥18 years old and had at least three of the following high-risk criteria for acquiring syphilis: (1) positive rapid test of syphilis in the last 2 years, (2) being HIV seropositive, (3) having a genital ulcer, (4) having any STI diagnosis in the last six months, (5) 5 years of sexual activity at minimum, (6) five or more sexual partners in the last 3 months, (7) five or more episodes of condomless anal intercourse in the last 6 months.¹⁷

Participants completed a computer-based survey assisted by a trained interviewer at baseline and at each follow-up visit. They reported socio-demographic characteristics, sexual behavior, history of previous and current STIs, and alcohol and substance use. After receiving HIV/STI pre-test counseling, they were referred to the laboratory to provide venous blood samples for HIV and syphilis testing, a pharyngeal swab specimen collected by the staff, and to receive instructions for self-collection of an anal swab specimen for Chlamydia trachomatis (CT) and NG testing. Screening for HIV and syphilis was performed at the clinic sites, using a third-generation rapid test (Alere Determine™ HIV 1/2, Alere Inc., USA), and a nontreponemal Plasma Reagin Rapid (RPR) test (BD Macro-Vue™ RPR Card Test Kit, Becton Dickinson, USA), respectively.

Aliquots of serum and swab specimens were transported maintaining cold chain to the Laboratory of Sexual Health at Universidad Peruana Cayetano Heredia in Lima and stored at −20°C until processing. Confirmatory HIV testing was performed using the EIA fourth generation test (Genscreen™ ULTRA HIV Ag-Ab, Bio-Rad, USA) and Western Blot test (NEW LAV BLOT I, Bio-Rad, USA). For syphilis confirmation, the Treponema pallidum particle agglutination (TPPA) test (Serodia, Fujirebio Diagnostics Inc., Japan) was used. A recent syphilis infection was considered if the RPR title was ≥1:16 and the TPPA test was positive. Finally, NG and CT detection was done using a transcription mediated amplification (TMA) assay (Aptima Combo 2 CT/NG, Hologic Inc., USA). All participants received the corresponding treatment if they tested positive for any STI, and were referred to the national HIV treatment program in case of confirmed HIV new infection.

The PICASSO study enrolled 401 participants.¹⁷ The prevalence of anal and pharyngeal NG infection at baseline was 9.0% and 6.2%, respectively, while the incidence rate of anal and pharyngeal was 28.1 and 21.3 cases per 100 person-years, respectively. For this estimate, incident cases were defined as a newly positive NG Aptima test during follow-up with no previous infection or documented treatment of a previous infection.¹⁸

Positive samples for NG infection were selected for DNA extraction using High Pure PCR Template Preparation Kit (Roche Inc, USA) according to manufacturer’s instructions. DNA was amplified using a TaqMan probe-based Real-time PCR assay to determine point mutations (i.e. Single nucleotide polymorphisms, SNPs) at the Ser91 codon of the gyrA gene. Primers and probes (Table 1) were used from Pond et al.¹⁹ Two NG strains phenotypically characterized for ciprofloxacin as Wild type (WT) (minimum inhibitory concentrations [MIC] = 0.015 μg/mL) and mutant (MIC = 16 μg/mL) were used as positive controls for PCR assays. The susceptibility testing of these strains was evaluated using the E-test (bioMérieux Inc., France), and the interpretation was performed according to CLSI criteria that establish a value ≥1 μg/mL for ciprofloxacin resistance (CLSI M100-S22).

Table 1.

Primers and probes.

Primers and probes	Oligonucleotide sequence 5′ to 3′	Fragment size (bp)
Primers
NG_gyrA_F	GCGACGTCATCGGTAAATACC
NG_gyrA_R	CGCCATACGGACGATGGT
Probes		77
NG_gyrA_WT_PR	CCCCCACGGCGATTTCGCAGTT
NG_gyrA_SNP_PR	CCCCACGGCGATTCCGCAGT

Master mix was prepared using iTaq™ universal probes supermix (Bio-Rad Laboratories, Inc., USA), with a concentration of 0.12 μmol for each primers, 0.15 μmol of WT probe, 0.10 μmol of SNP probe and 5 μL of DNA template for a final volume of 20 μL. Thermal cycler CFX96 (Bio-Rad Laboratories, Inc., USA) was used for amplification with the following conditions: 95°C for 5 min, 45 cycles of 95°C for 30 s and 60°C for 60 s; also, we used the fluorescent channel: FAM (510–530 nm) for WT probe and VIC (560–580 nm) for SNP probe. After amplification, probe curves were analyzed using Bio-Rad CFX Manager software version 2.0. Samples were considered to have the gyrA mutation if their cycle of quantification (Cq) were below 40 cycles and their value of relative fluorescence units (RFU) were higher than 480 and 380, which were the background fluorescence for both FAM and for VIC probe, respectively. For the analysis, an individual was considered NG–infected when there was at least one Aptima-positive sample (either anal or pharyngeal) in any follow-up visit, and was included for gyrA mutation assessment if follows the Cq and RFUs already describe criteria.

Bacterial load was estimated for each amplified anal sample by real time qPCR, according to the standard curves. These were estimated using five serial dilutions from 10⁵ to 10¹ genome copies/μL of WT and mutant strains by calculating the mass of the NG genome using: m = (n) (1.096 × 10⁻²¹ g/bp), according to Applied Biosystems protocol.²⁰ The genome size (n) of NG considered was 2′153,922 bp (NC_002946.2, NCBI). Standards were run in each qPCR assay (in triplicate) only with WT or mutant samples (in duplicate) using the corresponding probe and a correlation coefficient (R2) greater than 0.89.

For statistical analysis, we described the medians and proportions of socio-demographic characteristics, previous and current STIs diagnosed, antibiotic use prior to diagnosis (at baseline), and bacterial load of anal samples from individuals with an available PCR result for gyrA gene. We also compared these variables according to gyrA mutation pattern using Fisher exact test for categorical variables and Mann–Whitney U test for continuous variables. A p-value of less than 0.05 was considered statistically significant. All data analysis was conducted using the Stata software (version 15.0, Stata Corporation Inc., USA).

Results

Overall, 156 individuals had at least one positive NG swab sample tested using the Aptima Combo 2 assay (either at the baseline visit or at any follow-up visit of the Picasso study); 80 (51.3%) of whom had an amplified gyrA genotype (61 anal infections; 10, pharyngeal infections and nine for both infections). Of these individuals, the median age was 27 years (interquartile ranges [IQR]: 22–32), 65.0% (52/80) self-identified as cis-gender (gay or bisexual) and 35.0% (28/80) as transgender women. Also, 52.5% (42/80) were people living with HIV, 26.3% (21/80) were tested positive for CT and (11/80) 13.8% had a recent syphilis infection (Table 2).

Table 2.

Characteristics, gyrA mutation pattern, and bacterial load of MSM and TW infected with a gyrA wild type or Ser91codon mutant strain of Neisseria gonorrhoeae.

	Total n (%)	Wild type n (%)	Mutant at Ser91 codon n (%)	p-value
Total	80 (100)	8 (10.0)	67 (84.0)
Age (years)^b	27 (22–32)	32 (29–43)	27 (22–32)	0.046
Gender identity
Gay/homosexual	38 (47.5)	5 (62.5)	30 (44.8)	0.703
Bisexual	14 (17.5)	1 (12.5)	13 (19.4)
Transgender women	28 (35.0)	2 (25.0)	24 (35.8)
Previous STIs (in the last 6 months)^a	35 (43.8)	3 (37.5)	31 (46.3)	0.722
Recent ATB use (in the last 3 months)^a	26 (32.5)	1 (12.5)	23 (34.3)	0.341
Living with HIV	42 (52.5)	4 (50.0)	36 (53.7)	1.000
CT positive	21 (26.3)	3 (37.5)	16 (23.9)	0.410
Recent syphilis infection	11 (13.8)	0 (0.0)	10 (14.9)	0.587
Bacterial load (copies/μL)^b,c	2817.1 (432.3–8602.5)	1586.1 (415.1–1798.3)	3000.4 (543.3–11112.4)	0.267

Data of 5 individuals with both strain infections is not included.

CT, Chlamydia trachomatis; STIs, Sexually transmitted infections; ATB, Antibiotics.

^aAt baseline.

^bMedian (p25–p75).

^cOnly in anal samples.

Regarding gyrA gene NG pattern, we found that 67 individuals (84.0%) had at least one sample with a mutation at Ser91 codon of gyrA gene NG strain, 8 (10.0%) had a WT NG strain, and 5 (6.0%) alternated between WT and mutant NG infections during follow up in the same anatomical site (these infections were detected between 3 and 21 months apart). Among the 67 individuals infected only with mutant NG strains, 10 (14.9%) were diagnosed with a recent syphilis infection, 36 (53.7%) were people living with HIV, 31 (46.3%) reported previous STIs in the last 6 months, and 23 (34.3%) used antibiotics in the 3 months prior to their enrolment visit; however, there were no statistically significant differences compared to individuals with a WT NG strain. Additionally, the median bacterial load in subjects with mutant NG in any anal sample was higher than WT NG; however, it was not statistically significant (3000.4 copies/μL versus 1586.1 copies/μL, p = 0.267).

Discussion

We found an 84% prevalence of NG infections with mutations in the Ser91 codon of the gyrA gene of stored NG-positive specimens collected from extra-genital anatomic sites among MSM and TW in Lima, Peru. Sanchez et al. found that 24% of MSM diagnosed with NG between 2012 and 2013, were infected with an NG strain which had a mutation in the quinolone resistance-determining region of the gyrA gene.¹⁰ Differences could be explained by the differences in study populations. Our study was performed among a population at high-risk for syphilis, which may reflect similar higher risk for antimicrobial-resistant NG and these could explain why the presence of gyA-mutant NG strains is higher in our study. Recently, Jorge-Berrocal et al.¹³ reported a 95.2% prevalence of ciprofloxacin-resistant NG culture isolates as a part of a Peruvian NG sentinel surveillance system. Certainly, all of these estimates are sufficiently high to call into question the overall effectiveness of using ciprofloxacin as empiric therapy for management of NG infections in Peru.^21,22

In our study, recent antibiotic use was reported by 34.3% of individuals with mutant NG infection, compared with 12.5% of individuals with WT NG. Studies have shown that self-prescribed antibiotics and recent antibiotic use are associated with quinolone-resistant NG strains;^23,24 moreover, a high prevalence of self-prescribed antibiotics has been reported in our country.²⁵

In anal samples, we found that relative bacterial load in mutant NG infections was twice the value of WT NG, although it was not statistically significant. In vitro studies reported that bacterial fitness could be enhanced by point mutations related to quinolone resistance, increasing bacterial load;²⁶ which could facilitate the transmission of NG-resistant strains.²⁷

Our study reported no difference in the proportion of HIV-positive patients between gyrA profiles. Living with HIV has been associated with an NG resistance profile, although reports have been inconclusive.²⁸ However, screening for extragenital gonorrhea infections among high-risk groups should be implemented in the context of HIV transmission and acquisition.

The main limitation of this study was that almost half of the samples did not amplify by PCR assay, especially the samples from the pharyngeal location, since despite the high number of positive results by Aptima Combo 2 assay, we obtained few pharyngeal samples to assess for gyrA mutation analysis which may have affected our results, and may be caused by low NG bacterial load in this anatomical site, the buffer in which the sample was resuspended (might not be appropriate for the PCR assay) or other PCR inhibitors from commensal Neisseria species.^29,30 Importantly, prior studies have documented a higher prevalence of antimicrobial resistance among pharyngeal reservoirs;³¹ thus our findings may underestimate the prevalence of ciprofloxacin resistance.

In this study, we documented a high prevalence of gyrA mutations conferring ciprofloxacin resistance among extra-genital NG infections. This finding may warrant a change in the empirical treatment of NG infections. Recently, the Sentinel Surveillance Group of the Peruvian National Institute of Health (promoter of public health policies and norms) does not recommend the use of fluoroquinolones;¹³ however, the National Guidelines for STIs Management have not yet been updated since 2009. In addition, in key populations, extragenital screening and the use of molecular genetic markers to identify antimicrobial susceptibility should be considered in order to detect asymptomatic NG infection early, provide the correct treatment, and interrupt the chain of transmission.

Footnotes

Author Contributions

All authors listed on this manuscript certify that they have participated sufficiently in the work to take public responsibility for the content, including participation in the concept, design, analysis, writing, or revision of the manuscript.

Declaration of conflicts of interests

The author(s) declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: JDK reports consulting fees from Danaher, Cepheid, Talis Bio, Curative, Abbott, GSK, Roche, Chembio, and SpeeDx. KAK reports employment at both UPCH and UCLA. JQ, SKV, ME, FV, DD, LTAB, TJO, CFC.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Institute of Allergy and Infectious Diseases (NIAID; R01AI099727-01) and Team Klausner Saving Lives.

ORCID iDs

Jazmin Qquellon

Jeffrey D Klausner

References

World Health Organization . Global progress report on HIV, viral hepatitis and sexually transmitted infections. Geneva: WHO, https://www.who.int/publications-detail-redirect/9789240027077 (2021, accessed 21 July 2022).

Kirkcaldy

Weston

Segurado

, et al. Epidemiology of Gonorrhea: a global perspective. Sex Health 2019; 16: 401–411.

Cárcamo

Campos

García

, et al. Prevalences of sexually transmitted infections in young adults and female sex workers in Peru: a national population-based survey. Lancet Infect Dis 2012; 12: 765–773.

Leon

Segura

Konda

, et al. High prevalence of Chlamydia trachomatis and Neisseria gonorrhoeae infections in anal and pharyngeal sites among a community-based sample of men who have sex with men and transgender women in Lima, Peru. BMJ Open 2016; 6: e008245.

World Health Organization . Multi-drug resistant gonorrhoea. Geneva: WHO. https://www.who.int/news-room/fact-sheets/detail/multi-drug-resistant-gonorrhoea (2021, accessed 18 April 2022).

Bloomfield

. Update on emerging infections: news from the centers for disease control and prevention. Update to CDC’s sexually transmitted diseases treatment guidelines, 2006: fluoroquinolones no longer recommended for treatment of gonococcal infections. Ann Emerg Med 2007; 50: 232–235.

Klausner

Bristow

Soge

, et al. Resistance-guided treatment of Gonorrhea: a prospective clinical study. Clin Infect Dis Off Publ Infect Dis Soc Am 2020; 73: 298–303.

Ministerio de Salud del Peru (MINSA) . Directiva Sanitaria N° 030-MINSA/DGSP-V.01, Directiva Sanitaria para la atención médica periódica a las/os trabajadoras/es sexuales y HSH, https://www.gob.pe/institucion/minsa/normas-legales/246221-650-2009-minsa (2009, accessed 16 April 2020).

Starnino

GASP-LAC Working Group, Galarza

, et al. Retrospective analysis of antimicrobial susceptibility trends (2000–2009) in Neisseria gonorrhoeae isolates from countries in Latin America and the Caribbean shows evolving resistance to ciprofloxacin, azithromycin and decreased susceptibility to ceftriaxone. Sex Transm Dis 2012; 39: 813–821.

10.

Palencia

Cáceres

. Mutaciones en la región determinante de resistencia a quinolonas (QRDR) del gen gyrA de Neisseria gonorrhoeae presente en muestras clínicas de hombres que tienen sexo con hombres. Rev Peru Biol 2017; 24: 283–292.

11.

Jorge-Berrocal

Mayta-Barrios

Fiestas-Solórzano

. Resistencia antimicrobiana de Neisseria gonorrhoeae en Perú. Rev Peru Med Exp Salud Publica 2018; 35: 155–156.

12.

Siedner

Pandori

Leon

, et al. Detection of quinolone-resistant Neisseria gonorrhoeae in urogenital specimens with the use of real-time polymerase chain reaction. Int J STD AIDS 2008; 19: 69–71.

13.

Jorge-Berrocal

Vargas-Herrera

Benites

, et al. Antimicrobial susceptibility of Neisseria gonorrhoeae isolates from Peru 2018 and 2019. Sex transm dis, 2022; 49(10): 682–686. DOI: 10.1097/OLQ.0000000000001678

14.

Allan-Blitz

L-T

Wang

Klausner

. Wild-type gyrase a genotype of Neisseria gonorrhoeae predicts in vitro susceptibility to ciprofloxacin: a systematic review of the literature and meta-analysis. Sex Transm Dis 2017; 44: 261–265.

15.

Kirkcaldy

Zaidi

Hook

, et al. Neisseria gonorrhoeae antimicrobial resistance among men who have sex with men and men who have sex with women, the Gonococcal isolate surveillance project, 2005–2010. Ann Intern Med 2013; 158: 321–328.

16.

Deiss

Leon

Konda

, et al. Characterizing the syphilis epidemic among men who have sex with men in Lima, Peru to identify new treatment and control strategies. BMC Infect Dis 2013; 13: 426.

17.

Kojima

Park

Konda

, et al. The PICASSO cohort: baseline characteristics of a cohort of men who have sex with men and male-to-female transgender women at high risk for syphilis infection in Lima, Peru. BMC Infect Dis 2017; 17: 255.

18.

Allan-Blitz

L-T

Konda

Calvo

, et al. High incidence of extra-genital gonorrheal and chlamydial infections among high-risk men who have sex with men and transgender women in Peru. Int J STD AIDS 2018; 29: 568–576.

19.

Pond

Hall

Miari

, et al. Accurate detection of Neisseria gonorrhoeae ciprofloxacin susceptibility directly from genital and extragenital clinical samples: towards genotype-guided antimicrobial therapy. J Antimicrob Chemother 2016; 71: 897–902.

20.

Applied Biosystems . Creating standard curves with genomic DNA or plasmid DNA templates for use in quantitative PCR, https://tools.thermofisher.com/content/sfs/brochures/cms_042486.pdf (2003, accessed 28 April 2022).

21.

Xiridou

Lugnér

De Vries

HJC

, et al. Cost-effectiveness of dual antimicrobial therapy for gonococcal infections among men who have sex with men in the Netherlands. Sex Transm Dis 2016; 43: 542–548.

22.

Unemo

Lahra

Cole

, et al. World health organization global gonococcal antimicrobial surveillance program (WHO GASP): review of new data and evidence to inform international collaborative actions and research efforts. Sex Health 2019; 16: 412–425.

23.

Klausner

Aplasca

Mesola

, et al. Correlates of gonococcal infection and of antimicrobial-resistant Neisseria gonorrhoeae among female sex workers, republic of the Philippines, 1996–1997. J Infect Dis 1999; 179: 729–733.

24.

Bauer

Mark

Samuel

, et al. Prevalence of and associated risk factors for fluoroquinolone-resistant Neisseria gonorrhoeae in California, 2000–2003. Clin Infect Dis Off Publ Infect Dis Soc Am 2005; 41: 795–803.

25.

Rojas-Adrianzén

Pereyra-Elías

Mayta-Tristán

. Prevalencia y factores asociados a la compra de antimicrobianos sin receta médica. Perúrev Peru Med Exp Salud Publica 2016 2018; 35: 400–408.

26.

Kunz

Begum

, et al. Impact of fluoroquinolone resistance mutations on gonococcal fitness and in vivo selection for compensatory mutations. J Infect Dis 2012; 205: 1821–1829.

27.

Fingerhuth

Bonhoeffer

Low

, et al. Antibiotic-resistant Neisseria gonorrhoeae spread faster with more treatment, not more sexual partners. Plos Pathog 2016; 12: e1005611.

28.

Abraha

Egli-Gany

Low

. Epidemiological, behavioural, and clinical factors associated with antimicrobial-resistant gonorrhoea: a review. F1000Research 2018; 7: 400.

29.

de Korne-Elenbaas

Pol

Vet

, et al. Simultaneous detection of Neisseria gonorrhoeae and fluoroquinolone resistance mutations to enable rapid prescription of oral antibiotics. Sex Transm Dis 2020; 47: 238–242.

30.

Allan-Blitz

L-T

Ellis

Wee

, et al. Improved determination of Neisseria gonorrhoeae gyrase a genotype results in clinical specimens. J Antimicrob Chemother 2019; 74: 2913–2915.

31.

Lahra

Ndowa

, et al. Antimicrobial resistance in Neisseria gonorrhoeae: global surveillance and a call for international collaborative action. Plos Med 2017; 14: e1002344.

Extra-genital Neisseria gonorrhoeae infections with genetic mutations conferring ciprofloxacin resistance among men who have sex with men and transgender women in Lima,Peru

Abstract

Background

Methods

Results

Conclusions

Keywords

Introduction

Methods

Results

Discussion

Footnotes

Author Contributions

Declaration of conflicts of interests

Funding

ORCID iDs

References