Sage Journals: Discover world-class research

Abstract

Tyrosine kinase 2 (TYK2) deficiency is a rare primary immunodeficiency disease (PID). Patients carry TYK2 gene mutations and suffer from recurrent infections by intracellular pathogens, including mycobacteria. Delayed diagnosis often hinders timely and effective treatment, resulting in poor prognosis. In this study, we report a newly discovered TYK2 deficiency patient with recurrent pulmonary infections. The patient, a 27-year-old Chinese man with a history of tuberculosis, presented with recurrent cough, phlegm, and purulent sputum. Lung CT scan showed bronchiectasis with concomitant infection. Next-generation sequencing (NGS) identified Mycobacterium gordonae and Mycobacterium chelonae in lung, along with heterozygous c.997G>A&c.10C>T (p.V333M&p.R4C) mutation in TYK2. Further pathogenicity prediction analysis via dbNSFP (v5.1a) suggested the potential pathogenicity of this genetic variant. Additionally, TYK2 mRNA expression in peripheral blood mononuclear cells (PBMCs) also decreased significantly. Following anti-infective treatment, the patient improved and was discharged with regular human immunoglobulin infusion. However, the patient unfortunately succumbed to disease exacerbation in October 2021, 15 months after diagnosis. Furthermore, a literature review was conducted on cases of TYK2 deficiency. Previous studies have identified 24 mutation sites within TYK2 gene, which impair immune function and lead to early-onset recurrent infections. These mutations contribute to clinical heterogeneity, with the most common manifestation being recurrent infections by opportunistic pathogens, particularly mycobacteria. Our discovery of a novel TYK2 mutation expands the gene’s mutation spectrum. Analyzing the characteristics of reported cases enhances understanding of TYK2 deficiency’s clinical manifestations and facilitates early diagnosis of this rare condition.

Keywords

TYK2 gene mutation TYK2 deficiency primary immunodeficiency disease mycobacteria

Introduction

Tyrosine kinase 2 (TYK2) deficiency is a rare primary immunodeficiency disease (PID) caused by mutations in the TYK2 gene, inherited as an autosomal recessive (AR) trait. As a member of the Janus kinase (JAK) family, TYK2 mediates the phosphorylation of signal transducer and activator of transcription (STAT) proteins, which regulate downstream immune-related genes and modulate immune responses.¹ TYK2 is crucial in cytokine signaling pathways involved in both innate and acquired immunity including IL-12, IL-23, IFN-α/β, IL-6, and IL-10 signaling.^1,2 Specifically, IL-12 and IL-23 drive the differentiation of T-helper cells into Th1 cells, which produce IFN-γ—a critical cytokine for macrophage activation and the clearance of intracellular bacteria.^3–6 Moreover, IFN-α/β are critical for the transcription of antiviral immune factors.⁷ The first case of TYK2 deficiency, defined as autosomal recessive hyper-IgE syndrome (AR-HIES), was reported by Minegishi et al. in 2006.⁸ Since then, reports of TYK2 gene mutations have increased, with studies linking these mutations to a spectrum of diseases, including autoimmune and inflammatory disorders, infections, and certain cancers.^9–12 To date, 41 TYK2-deficient patients and 24 pathogenic mutation sites have been reported.^13,14 These mutations dysregulate cytokine signaling pathways, impairing host defense mechanisms.^14–16 Clinically, TYK2-deficient patients commonly present with intracellular bacterial infections (e.g., mycobacterial infections) and viral infections. Some patients may appear fungal infections, allergic diseases (e.g., eczema or atopic dermatitis), and complications related to Bacillus Calmette-Guérin (BCG) vaccination.^17,18 In this study, we investigated a patient with non-tuberculous mycobacterial disease carrying a new TYK2 gene mutation and reviewed the literature related to cases of TYK2 deficiency.

Materials and methods

Subjects

Our patient was diagnosed at Xiangya Hospital, Central South University (China). The heathy control was recruited from the health examination center of Xiangya Hospital. Written informed consents were obtained from the subjects. This study was approved by the Ethics Committee of Xiangya Hospital, Central South University (No: 202103133).

Genetic testing

Whole blood samples from patients and their parents underwent comprehensive mutational analysis employing Next-generation sequencing (NGS) with confirmatory Sanger sequencing, performed at Zhenyuan Medical Laboratory (Hangzhou, China).

Bioinformatics analysis

To evaluate the functional impact of the identified variants, we performed comprehensive in silico analyses using dbNSFP (v5.1a), integrating multiple prediction algorithms. Variants were annotated with SIFT, Polyphen2-HDIV, Polyphen2-HVAR, FATHMM-XF, MutationTaster, MutationAssessor, CADD, and M-CAP. As previously reported, a variant was considered potentially deleterious if predicted as harmful by at least one algorithm.^19,20 Evolutionary conservation was assessed using GERP++ RS and phyloP100way vertebrate. The deleterious thresholds were as follows: SIFT < 0.05, Polyphen2-HDIV ⩾ 0.454, Polyphen2-HVAR ⩾ 0.447, FATHMM-XF > 0.5, MutationTaster > 0.5, MutationAssessor > 1.935, CADD ⩾ 20, M-CAP > 0.025, GERP++ RS > 2, and phyloP100way vertebrate > 2. Population frequencies of all variants were verified against the whole gnomAD genome samples (v4.1) (exclusion threshold: AF ⩾ 0.1%).

Real-time quantitative PCR analysis

RNA was extracted using TRIzol Reagent according to the manufacturer’s instructions (ECOTOP Biotechnology, GuangZhou, China). cDNA synthesis was performed with 2 × Hieff® PCR Master Mix (Yeasen Biotechnology, Shanghai, China). Quantitative RT-PCR was performed with Hieff® qPCR SYBR Green Master Mix (Yeasen Biotechnology, Shanghai, China). The relative interest mRNA expression was normalized to GAPDH using the ΔΔCt method. The primer sequences are: TYK2 forward primer GAGATGCAAGCCTGATGCTAT, reverse primer GGTTCCCGAGGATTCATGCC; GAPDH forward primer AGAAGGCTGGGGCTCATTTG, reverse primer GGGGCCATCCACAGTCTTC.

Literature review and data acquisition

To identify published cases on TYK2 deficiency, we conducted a systematic literature search in PubMed and Web of Science (WoS) databases. We searched the case reports published in English from 2006 to April 2024 using the following search terms: “TYK2 deficiency” or “TYK2 mutation”. We retrieved a total of 34 English literatures. After screening of titles and abstracts, 12 repetitive and 3 irrelevant ones were excluded. Then, we checked reference lists of retrieved articles for additional relevant reports. Finally, 42 relevant cases including our patient were included for this review.

Results

Case presentation

History

A 27-year-old Chinese man was admitted to our hospital in 2021 due to recurrent cough, phlegm, and purulent sputum for over 20 years. In 2011, the patient was diagnosed with tuberculosis because of pulmonary nodules and received anti-tuberculosis treatment for 7 months. During the next several years, he was hospitalized several times for coughing, exercise-induced dyspnea, skin erythema nodules, and fever. The patient had received multiple rounds of anti-infective and anti-tuberculosis treatments; however, the response was suboptimal. In 2021, the patient was referred to our hospital again due to cough, phlegm, and purulent sputum. The family history of the patient was not contributory.

Physical examination

After admission, physical examination revealed that the patient had an anemic appearance and cachexia. There were erythema nodosum and enlarged superficial lymph nodes. The lung auscultation found decreased bilateral breath sound and a lot of moist rales (crackles). Besides, we found shifting dullness indicating the presence of ascites. The remainder of the examination was normal.

Laboratory findings

These data were collected after the patient was hospitalized. Blood routine examination revealed the WBC count of 10.9 × 10⁹/L and the Hb value of 86 g/L. Urine and fecal routine examination showed no abnormalities. Biochemical routine test showed the albumin level was 30.2 to 34.6 g/L. Increased erythrocyte sedimentation rate (ESR), C-reactive protein (CRP) and procalcitonin (PCT). His immunological evaluations and lymphocytes subsets (TBNK) were normal. Lung CT scan revealed bronchiectasis with concurrent infection (Figure 1). No bacterial growth was found in multiple pathological examinations of the bronchial biopsy sample. However, NGS of the lung tissue suggested infection of Mycobacterium gordonae and Mycobacterium chelonae. Metagenomic next-generation sequencing (mNGS) of blood detected the presence of Epstein-Barr virus (EBV). Other examinations were normal.

Figure 1.

Lung CT findings of the patient. (a–f) The Lung CT scan revealed thickening of the bronchial walls, multiple scattered ground-glass nodules, and strip opacities within the lungs.

Gene mutation screening

We investigated the TYK2 gene mutation of the patient and his parents by NGS and Sanger sequencing. Results showed that the patient carried the heterozygous c.997G>A&c.10C>T (p.V333M& p.R4C) mutation in TYK2, which were respectively inherited from his mother and father (Figure 2).

Figure 2.

The heterozygous mutations in exon7 and exon3 of the TYK2 gene in the patient. We identified the TYK2 gene mutation of the patient and his parents by NGS and Sanger sequencing. (a) The heterozygous TYK2 c.997G>A mutation that was inherited from his mother. (b) The heterozygous TYK2 c.10C>T mutation that was inherited from his father. (c) Pedigree of a family in our patient.

We also performed pathogenicity prediction analysis for the gene mutations. The c.10C>T (p.R4C) variant exhibited consistent deleterious predictions (Polyphen2 HDIV = 0.468, FATHMM-XF = 0.522963, M-CAP = 0.063591), high evolutionary conservation (GERP++ RS = 4.63, phyloP100way vertebrate = 4.287), and extreme rarity in gnomAD v4.1 joint data (AF = 0.00000309783). Similarly, the c.997G>A (p.V333M) variant was predicted as damaging (M-CAP = 0.02964), with elevated conservation scores (GERP++ RS = 2.28, phyloP100way vertebrate = 2.377) and an extremely low population frequency in gnomAD v4.1 joint data (AF = 0.0000782522).

Gene expression in vivo

We detected the TYK2 mRNA expression of the patient-derived peripheral blood mononuclear cells (PBMCs) by qRT-PCR. Unsurprisingly, compared with healthy control, the expression of TYK2 significantly decreased in the patient (Figure 3). This result revealed that the patient displayed defective TYK2 mRNA expression caused by gene mutation.

Figure 3.

The mRNA expression of TYK2 in PBMCs from our patient.

Literature review

The first TYK2-deficient patient (P1) was reported in 2006, which showed infections with intracellular bacteria and viruses, atopic dermatitis-like skin inflammation, and a high amount of serum IgE.⁸ In recent years, with the progress of immunology and gene detection technology, cases of TYK2 deficiency have been reported continuously. So far, including our patient, there were 42 patients reported with TYK2 deficiency caused by gene mutation. The clinical features and genetic information of 42 patients are shown in Table 1.

Table 1.

Clinical and genetic characteristics of 42 patients with TYK2 deficiency.

Patients	Age	Sex	Country	Mycobacterial infections	Viral infections	Fungal infections	other infections	High IgE levels	Atopy/Dermatitis	TYk2 protein mutation	TYk2 gene mutation	BCG Vaccination	References
P1	22	Male	Japan	BCG	HSV, PIV3, Molluscum contagiosum	Candida albicans	S. aureus, Salmonella	Yes	Yes	C70HfsX21	c.550_553delGCTT	Yes	Minegishi et al., 2006
P2	17	Male	Turkey	BCG	VZV	No	Brucella	No	No	L767X	c.2303_2311del	Yes	Kreins AY et al., 2015
P3	14	Female	Morocco	M. tuberculosis	No	No	No	No	No	T1106HfsX4	c.3318_3319insC	Yes	Kreins AY et al., 2015
P4	14	Male	Morocco	unknown	unknown	No	No	No	No	T1106HfsX4	c.3318_3319insC	Yes	Kreins AY et al., 2015
P5	5	Male	Iran	BCG	No	No	No	No	No	E154X	c.462G>T	Yes	Kreins AY et al., 2015
P6	1	Female	Iran	BCG	Yes	No	No	No	No	E154X	c.462G>T	Yes	Kreins AY et al., 2015
P7	9	Female	Iran	M. tuberculosis	No	No	No	No	No	S50HfsX1	c.149delC	Yes	Kreins AY et al., 2015
P8	11	Male	Argentina	No	HSV	No	No	No	No	R638X	c.1912 C>T	Yes	Kreins AY et al., 2015
P9	8	Female	Kurdistan	No	No	No	No	Yes	Yes	Pro216Argfs*14	c.647delC	No	Fuchs et al., 2016
P10	15	Male	Japan	No	EBV	No	No	No	No	Cys70Serfs*21/R231W	c.209_212 delGCTT/c.691C > T	Yes	Nemoto et al., 2018
P11	14	Female	Japan	No	EBV	No	No	No	No	Cys70Serfs*21/R232W	c.209_212 delGCTT/c.691C > T	Yes	Nemoto et al., 2018
P12	1	Male	Sweden	Mycobacterium bovis BCG	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P13	1	Male	USA	M. avium complex	No	No	No	No	No	P1104A	unknown	No	Boisson-Dupuis et al., 2018
P14	2	Male	Iran	BCG-osis	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P15	6	Male	Brazil	M.tuberculosis	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P16	40	Female	Algeria	M.tuberculosis	Aspergillus	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P17	27	Male	Morocco	M.tuberculosis	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P18	15	Male	Turkey	M.tuberculosis	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P19	13	Male	Chile	M.tuberculosis	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P20	35	Male	Morocco	M.tuberculosis	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P21	33	Male	Chile	M.tuberculosis	No	No	No	No	No	P1104A	unknown	Yes	Boisson-Dupuis et al., 2018
P22	1	Male	Iran	Mycobacterium bovis BCG	HSV, VZV	No	No	No	No	P216Rfs*14	c.647delC	Yes	Sarrafzadeh et al., 2020
P23	2	Male	China	Mycobacterium bovis BCG	Influenza virus	No	Mycoplasma pneumonia	No	No	G799R	c.2395G>A	Yes	Wu et al., 2020
P24	24	Male	China	M. intracellulare	No	No	No	No	No	N1028S/R864C	c.3083A>G/c.2590C>T	Yes	Guo et al., 2020
P25	17-mo-old	Female	Iran	No	RSV, CMV, AV	No	No	No	No	C70Hfs*21	c.208_211:GCTTdel	Yes	Ogishi et al., 2022
P26	5	Female	Iran	BCG	HSV	Candida	Leishmania	No	Yes	E19_25del	g.10467969_10459969del	Yes	Ogishi et al., 2022
P27	5	Male	Iran	BCG	HSV	Candida	No	No	No	R864C	c.2590C>T	Yes	Ogishi et al., 2022
P28	31	Female	Malaysia	M. fortuitum	No	Candida	Nocardia, Enterobacteriaceae	No	No	G634E	c.1901G>A	unknown	Ogishi et al., 2022
P29	24	Female	Morocco	M. tuberculosis	No	No	No	No	No	G996R	c.2986G>C	Yes	Ogishi et al., 2022
P30	8	Male	Saudi Arabia	No	HSV	Candida	No	No	No	unknown	c.2466+1G>T	unknown	Ogishi et al., 2022
P31	9	Female	Turkey	No	RSV, coronavirus 229	No	No	No	No	G1010D	c.3029G>A	unknown	Ogishi et al., 2022
P32	22	Female	Chile	M. tuberculosis	No	No	No	No	No	A928V/P1104A	g.2783C>T	unknown	Ogishi et al., 2022
P33	3	Female	Turkey	No	Influenza A, VZV, RSV	No	No	No	No	P216Hfs*14	c.647delC	Yes	Ogishi et al., 2022
P34	6	Male	Turkey	No	Influenza A, COVID-19	No	No	No	No	P216Hfs*15	c.648delC	Yes	Ogishi et al., 2022
P35	2	Male	Iran	BCG	No	Candida	No	No	No	E154*	c.460G>T	Yes	Ogishi et al., 2022
P36	4	Female	Turkey	No	MMR, COVID-19	No	No	No	No	P216Hfs*15	c.648delC	Yes	Ogishi et al., 2022
P37	16	Female	Turkey	M. tuberculosis	No	No	No	No	No	L767*	c.2303_2311del	unknown	Ogishi et al., 2022
P38	11	Male	Turkey	No	COVID-19	No	No	No	No	P216Hfs*15	c.648delC	Yes	Ogishi et al., 2022
P39	?	Male	Pakistan	No	COVID-19	No	No	No	No	unknown	c.466-1G>A	No	Ogishi et al., 2022
P40	7	Female	Turkey	No	CMV, HSV, COVID-19, EBV	No	C. difficile, Campylobacter	No	No	P216Hfs*15	c.648delC	unknown	Ogishi et al., 2022
P41	4	Female	Canada	No	influenza B, Enterovirus, Rhinovirus, Coronavirus OC43/HKU1, rotavirus, norovirus, SARS-CoV-2, Jamestown Canyon virus	No	No	No	No	p.(R249*)	c.745C>T	No	Roussel et al., 2023
P42 (this patient)	27	Male	China	M. tuberculosis M. gordonae, M .chelonae	EBV	No	No	No	No	V333M/R4C	c.997G>A/c.10C>T	Yes	this report

BCG, Bacillus Calmette-Guerin; HSV, herpes simplex virus; PIV3, human parainfluenza virus type 3; VZV, varicella-zoster virus; EBV, Epstein-Barr virus; RSV, respiratory syncytial virus; MMR, Measles, Mumps, and Rubella; COVID-19, Corona Virus Disease 2019; CMV, Cytomegalovirus; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.

Of all 42 cases, 25 (60%) patients were male. All patients were under 40 years old. And juvenile patients aged less than 18 years were 31 (74%). All patients had recurrent infections. Mycobacterial infections were found in 27 (64%) cases, including 12 cases of mycobacterium tuberculosis, 11 cases of BCG, and 4 cases of non-tuberculous mycobacteria infection (Mycobacterium avium complex, Mycobacterium intracellulare, Mycobacterium fortuitum, Mycobacterium gordonae, and Mycobacterium chelonae). Viral infections were identified in 22 (52%) patients. There were 7 (17%) patients with fungal infections, most commonly Candida, and 6 (14%) patients had other infections. In addition, a small proportion of patients had signs of eczema or atopic dermatitis. In all 24 reported mutation sites, P1104A mutation was found in 10 patients (42%), all of whom suffered with mycobacterial infections (7 with M. tuberculosis, 2 with BCG, and 1 with M. avium complex). This result shows that P1104A may be an important reminder of mycobacterial infections in TYK2-deficient patients.

Unsurprisingly, the role of TYK2 mutations in various diseases has also attracted significant attention in recent years. For instance, Motegi et al. identified the rs201917359 variant (TYK2Arg231Trp) as a gain-of-function mutation in the Japanese population, which could enhance TYK2 signaling and contribute to the pathogenesis of Rheumatoid Arthritis.²¹ Similarly, in a newly report by Yang et al., the TYK2 gene mutations (rs2304256, rs280519, and rs12720270) may be associated with a reduced risk of microscopic polyangiitis (MPA) in the male population in Guangxi, China.²² Moreover, genome-wide association studies (GWAS) have found that loss-of-function mutations in TYK2 were associated with a reduced risk of immune diseases including multiple sclerosis, inflammatory bowel disease, ankylosing spondylitis, and psoriasis.²³ Beyond autoimmune and inflammatory conditions, TYK2 mutations have been found in various cancers. In 2013, the first TYK2 GOF point mutations were found in T-cell acute lymphoblastic leukemia (T-ALL) cell lines²⁴; two GOF TYK2 germline mutations (p.Pro760Leu and p.Gly761Val) were found in pediatric patients with primary acute lymphoblastic leukemia.²⁵ These reports underscored the diverse impact of TYK2 mutations on disease susceptibility and hinted at the potential of TYK2 as a therapeutic target across multiple conditions.

Discussion

We identified a novel heterozygous TYK2 mutation (c.997G>A&c.10C>T) in a patient with recurrent lung infections. Subsequently, we performed pathogenicity prediction of the mutation site through bioinformatics analysis and found that the mutation exhibited potential pathogenicity. Furthermore, we isolated PBMCs from the patient and used RT-qPCR to demonstrate a significant decrease in TYK2 mRNA. To the best of our knowledge, this heterozygous mutation of TYK2 has not been previously reported.

Firstly, the patient reported in this study had the same young age of onset as the previously reported cases. It hints that a younger age of onset is one of the clinical features of TYK2 deficiency. Based on this characteristic, it is important to distinguish TYK2 deficiency from other PID with similar young onset features, such as severe combined immunodeficiency (SCID) and X-linked agammaglobulinemia.^26,27 Given the unique immunological profiles and clinical implications of these disorders, recognizing the distinctions among them is crucial for accurate diagnosis and tailored treatment strategies.

Except common tuberculous mycobacteria, our patient was also infected with non-tuberculous mycobacteria, a condition previously reported in 3 other patients (P13, P24, and P28).^18,28,29 Analysis of all cases revealed that the most common symptom of TYK2 deficiency is susceptibility to opportunistic pathogens, especially intracellular bacteria like mycobacteria. TYK2 deficiency significantly contributes to impaired immune responses in mycobacterial infections.^28,30 It has been reported that TYK2 mutation can weaken Natural Killer (NK) cell and T cell responses to IL-12 and IL-23 and lead to insufficient IFN-γ production, thereby increasing susceptibility to mycobacteria.^31–33 Furthermore, the common pathogenic TYK2 variant (P1104A) has been proven to be associated with mycobacterial infections.^18,34 As for the potential association between the c.997G>A & c.10C>T mutation and mycobacterial infection, it requires further experimental validation and additional case studies for confirmation in future, which is a limitation of this study. In a word, when encountering young patients with recurrent mycobacterium infections in clinical practice, we should consider the possibility of TYK2 deficiency and conduct genetic testing promptly.

It is also worth noting that BCG-related mycobacterial infections were found in 11 patients, as shown in Table 1. These patients quickly developed BCG-related adverse reactions following vaccination in infancy. Most of them showed lymphadenitis that was the main adverse event after BCG vaccination.³⁵ A smaller subset (only four patients) displayed more severe disseminated BCG disease. According to reported literature, disseminated BCG disease can be more pronounced in individuals with primary immunodeficiencies, leading to complications such as uncontrolled mycobacterial replication and a high incidence of fatal outcomes.^36–38 Therefore, infants who quickly develop infections or severe disseminated BCG disease after vaccination should be vigilant for PID like TYK2 deficiency.

Our patient did not exhibit a high level of IgE or atopic dermatitis, which were reported in the first TYK2 deficiency case with Hyper IgE syndrome (HIES).⁸ Apart from the initial case, these HIES-related phenotypes were also observed in P9 (eczema and highly elevated IgE) and P26 (allergic dermatitis).^14,39 Researchers found impaired IL-6-mediated STAT3 phosphorylation in P1, but not in other reported patients.^8,14,31 It was also observed that response to IL-6 was independent of TYK2. And studies have revealed that abnormalities in the IL-6 pathway can lead to elevated IgE levels and atopic dermatitis.⁴⁰ Therefore, those HIES-phenotype may not be associated with TYK2 but rather with other undetected mutations affecting IL-6 signaling. Overall, the underlying reasons and mechanisms of these phenotypes remain undetermined and require further study.

Based on reported cases of TYK2 deficiency, we summarize the main characteristics of TYK2 deficiency as follows: (A) TYK2 gene mutation and autosomal recessive inheritance; (B) young age of onset; (C) susceptibility to opportunistic pathogens, especially intracellular bacteria; (D) prone to adverse reactions following BCG vaccination. Therefore, in young patients suffering from recurrent mycobacterial or other opportunistic pathogen infections, congenital immunodeficiency diseases, including TYK2 deficiency, should be considered.

Conclusion

In this study, we identified a new patient with TYK2 mutation. The pathogenic mutation of c.997G>A& c.10C>T (p.V333M&p.R4C) in the TYK2 gene is novel, which enlarges the mutation spectrum of the TKY2 gene. Also, we analyzed the clinical manifestations and genetic information of previously reported cases to enhance understanding of the clinical characteristics of TYK2 deficiency and to promote the early diagnosis of this rare disease.

Footnotes

Acknowledgements

None.

Author Contributions

LX and HW collected the data. XH contributed to verification experiment. XG conducted the bioinformatics analysis. LX wrote the draft of the manuscript. JF conducted the study. RH conducted the study and edited the manuscript. All authors contributed to the article and approved the submitted version.

Data Availability

All datasets presented in the study are included in the article.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Natural Science Foundation of Hunan Province (Grant numbers: 2023JJ30882).

Ethics Approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Xiangya Hospital, Central South University (No: 202103133).

Informed consent

Written informed consent was obtained from all subjects before the study.

Consent to Participate

The human research participants in Xiangya Hospital provided written informed consent to participate in the study.

Consent to Publication

The authors affirm that the participants provided written informed consent for the publication of any potentially identifiable images or data included in this article.

Trial registration

Not applicable.

ORCID iDs

Lei Xie

Hejing Wang

Juntao Feng

Ruoxi He

References

Stark

Darnell

Jr (2012) The JAK-STAT pathway at twenty. Immunity 36(4): 503–514. DOI: 10.1016/j.immuni.2012.03.013.

Ghoreschi

Laurence

O’Shea

(2009) Janus kinases in immune cell signaling. Immunological Reviews 228(1): 273–287. DOI: 10.1111/j.1600-065X.2008.00754.x.

Gopal

Lin

Obermajer

, et al (2012) IL-23-dependent IL-17 drives Th1-cell responses following Mycobacterium bovis BCG vaccination. European Journal of Immunology 42(2): 364–373. DOI: 10.1002/eji.201141569.

Martínez-Barricarte

Markle

, et al (2018) Human IFN-γ immunity to mycobacteria is governed by both IL-12 and IL-23. Science Immunology 3(30): 6759. DOI: 10.1126/sciimmunol.aau6759.

Rosain

Neehus

Manry

, et al (2023) Human IRF1 governs macrophagic IFN-γ immunity to mycobacteria. Cell 186(3): 621–645. DOI: 10.1016/j.cell.2022.12.038.

Kerner

Rosain

Guérin

, et al (2020) Inherited human IFN-γ deficiency underlies mycobacterial disease. Journal of Clinical Investigation 130(6): 3158–3171. DOI: 10.1172/jci135460.

Zhang

Boisson-Dupuis

Chapgier

, et al (2008) Inborn errors of interferon (IFN)-mediated immunity in humans: insights into the respective roles of IFN-alpha/beta, IFN-gamma, and IFN-lambda in host defense. Immunological Reviews 226: 29–40. DOI: 10.1111/j.1600-065X.2008.00698.x.

Minegishi

Saito

Morio

, et al (2006) Human tyrosine kinase 2 deficiency reveals its requisite roles in multiple cytokine signals involved in innate and acquired immunity. Immunity 25(5): 745–755. DOI: 10.1016/j.immuni.2006.09.009.

Danese

Peyrin-Biroulet

(2021) Selective tyrosine kinase 2 inhibition for treatment of inflammatory bowel disease: New hope on the rise. Inflammatory Bowel Diseases 27(12): 2023–2030. DOI: 10.1093/ibd/izab135.

10.

Xiang

, et al (2022) TYK2 correlates with immune infiltration: A prognostic marker for head and neck squamous cell carcinoma. Frontiers in Genetics 13: 1081519. DOI: 10.3389/fgene.2022.1081519.

11.

Krueger

McInnes

Blauvelt

(2022) Tyrosine kinase 2 and Janus kinase–signal transducer and activator of transcription signaling and inhibition in plaque psoriasis. Journal of the American Academy of Dermatology 86(1): 148–1457. DOI: 10.1016/j.jaad.2021.06.869.

12.

Miranda

Lassnig

Schmidhofer

, et al (2024) Lack of TYK2 signaling enhances host resistance to Candida albicans skin infection. Nature Communications 15(1): 10493. DOI: 10.1038/s41467-024-54888-6.

13.

Roussel

Pham-Huy

, et al (2023) A Novel Homozygous Mutation Causing Complete TYK2 Deficiency, with severe respiratory viral infections, EBV-driven lymphoma, and jamestown canyon viral encephalitis. The Journal of Clinical Immunology 43(8): 2011–2021. DOI: 10.1007/s10875-023-01580-x.

14.

Ogishi

Arias

Yang

, et al (2022) Impaired IL-23-dependent induction of IFN-γ underlies mycobacterial disease in patients with inherited TYK2 deficiency. Journal of Experimental Medicine 219(10): 94. DOI: 10.1084/jem.20220094.

15.

Sohn

Barrett

Van Abbema

, et al (2013) A restricted role for TYK2 catalytic activity in human cytokine responses revealed by novel TYK2-selective inhibitors. The Journal of Immunology 191(5): 2205–2216. DOI: 10.4049/jimmunol.1202859.

16.

Wöss

Simonović

Strobl

, et al (2019) TYK2: An upstream kinase of STATs in cancer. Cancers 11(11): 728. DOI: 10.3390/cancers11111728.

17.

Sun

, et al (2022) Novel mutations of TYK2 leading to divergent clinical phenotypes. Pediatric Allergy and Immunology 33(1): e13671. DOI: 10.1111/pai.13671.

18.

Boisson-Dupuis

Ramirez-Alejo

, et al (2018) Tuberculosis and impaired IL-23-dependent IFN-γ immunity in humans homozygous for a common TYK2 missense variant. Science Immunology 3(30): 7814. DOI: 10.1126/sciimmunol.aau8714.

19.

Dong

Wei

Jian

, et al (2015) Comparison and integration of deleteriousness prediction methods for nonsynonymous SNVs in whole exome sequencing studies. Human Molecular Genetics 24(8): 2125–2137. DOI: 10.1093/hmg/ddu733.

20.

Shoda

Kaufman

Wen

, et al (2021) Desmoplakin and periplakin genetically and functionally contribute to eosinophilic esophagitis. Nature Communications 12(1): 6795. DOI: 10.1038/s41467-021-26939-9.

21.

Motegi

Kochi

Matsuda

, et al Identification of rare coding variants in TYK2 protective for rheumatoid arthritis in the Japanese population and their effects on cytokine signalling. The Annals of the Rheumatic Diseases (2019) 78(8): 1062–1029. DOI: 10.1136/annrheumdis-2019-215062.

22.

Yang

Chu

Feng

, et al (2024) Association of tyrosine kinase 2 polymorphisms with susceptibility to microscopic polyangiitis in a Guangxi population. PeerJ 12: e18735. DOI: 10.7717/peerj.18735.

23.

Dendrou

Cortes

Shipman

, et al (2016) Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity. Science Translational Medicine 8(363): 363ra149. DOI: 10.1126/scitranslmed.aag1974.

24.

Sanda

Tyner

Gutierrez

, et al (2013) TYK2-STAT1-BCL2 pathway dependence in T-cell acute lymphoblastic leukemia. Cancer Discovery 3(5): 564–577. DOI: 10.1158/2159-8290.Cd-12-0504.

25.

Waanders

Scheijen

Jongmans

, et al (2017) Germline activating TYK2 mutations in pediatric patients with two primary acute lymphoblastic leukemia occurrences. Leukemia 31(4): 821–828. DOI: 10.1038/leu.2016.277.

26.

Boisson

Wang

Bosompem

, et al (2013) A recurrent dominant negative E47 mutation causes agammaglobulinemia and BCR(-) B cells. The Journal of Clinical Investigation 123(11): 4781–4785. DOI: 10.1172/jci71927.

27.

Justiz-Vaillant

Gopaul

Akpaka

, et al (2023) Severe combined immunodeficiency-classification, microbiology association and treatment. Microorganisms 11(6): 1859. DOI: 10.3390/microorganisms11061589.

28.

Guo

Feng

Yang

, et al (2020) Mycobacterium intracellulare infection associated with TYK2 deficiency: A case report and review of the literature. Infection and Drug Resistance 13: 4347–4353. DOI: 10.2147/idr.S279438.

29.

Ojuawo

Allen

Hagan

, et al (2022) Disseminated tuberculosis associated with deficient interleukin-23/tyrosine kinase 2 signalling. BMJ Case Reports 15(8): 479. DOI: 10.1136/bcr-2022-250479.

30.

Chen

, et al (2020) A TYK2 Gene Mutation c.2395G>A Leads to TYK2 deficiency: A case report and literature review. Frontiers in Pediatrics 8: 253. DOI: 10.3389/fped.2020.00253.

31.

Kreins

Ciancanelli

Okada

, et al (2015) Human TYK2 deficiency: Mycobacterial and viral infections without hyper-IgE syndrome. Journal of Experimental Medicine 212(10): 1641–162. DOI: 10.1084/jem.20140280.

32.

Meyts

Casanova

. (2021) Viral infections in humans and mice with genetic deficiencies of the type I IFN response pathway. European Journal of Immunology 51(5): 1039–1061. DOI: 10.1002/eji.202048793.

33.

van de Vosse

Ottenhoff

. (2006) Human host genetic factors in mycobacterial and Salmonella infection: lessons from single gene disorders in IL-12/IL-23-dependent signaling that affect innate and adaptive immunity. Microbes Infection 8(4): 1167–1173. DOI: 10.1016/j.micinf.2005.10.032.

34.

Kerner

Ramirez-Alejo

Seeleuthner

, et al (2019) Homozygosity for TYK2 P1104A underlies tuberculosis in about 1% of patients in a cohort of European ancestry. Proceedings of the National Academy of Sciences of the United States of America 116(21): 10430–10434. DOI: 10.1073/pnas.1903561116.

35.

Goraya

Virdi

. (2002) Bacille calmette-guérin lymphadenitis. Postgraduate Medical Journal 78(920): 327–329. DOI: 10.1136/pmj.78.920.327.

36.

Canarutto

Oltolini

Barzaghi

, et al (2023) Outcome of BCG vaccination in ADA-SCID patients: A 12-patient series. Biomedicines 11(7): 1809. DOI: 10.3390/biomedicines11071809.

37.

Chen

Zhu

, et al (2019) Disseminated Bacille Calmette-Guérin infection in a patient with severe combined immunodeficiency caused by JAK3 gene mutation. Pediatric Dermatology 36(5): 672–676. DOI: 10.1111/pde.13884.

38.

Tabatabaei

Amanati

Karimi

, et al (2015) Diffuse hyper pigmented subcutaneous nodules as a primary manifestation of disseminated bacillus calmette-guerin disease in young infants. Archives of Pediatric Infectious Diseases 3(4): 24744. DOI: 10.5812/pedinfect.24744.

39.

Fuchs

Kaiser-Labusch

Bank

, et al (2016) Tyrosine kinase 2 is not limiting human antiviral type III interferon responses. European Journal of Immunology 46(11): 2639–2649. DOI: 10.1002/eji.201646519.

40.

Spencer

Köstel Bal

Egner

, et al (2019) Loss of the interleukin-6 receptor causes immunodeficiency, atopy, and abnormal inflammatory responses. Journal of Experimental Medicine 216(9): 1986–1998. DOI: 10.1084/jem.20190344.

A new heterozygous TYK2 gene mutation: Case report and review of the literature

Abstract

Keywords

Introduction

Materials and methods

Subjects

Genetic testing

Bioinformatics analysis

Real-time quantitative PCR analysis

Literature review and data acquisition

Results

Case presentation

History

Physical examination

Laboratory findings

Gene mutation screening

Gene expression in vivo

Literature review

Discussion

Conclusion

Footnotes

Acknowledgements

Author Contributions

Data Availability

Declaration of conflicting interests

Funding

Ethics Approval

Informed consent

Consent to Participate

Consent to Publication

Trial registration

ORCID iDs

References