Production of metallo-beta-lactamase (MBL) is one of the main mechanisms for resistance in carbapenem antibiotics. Detection of MBL-producer Pseudomonas aeruginosa is crucial in preventing its spread to other gram-negative bacteria. The aim of this study was to evaluate combination disc (CD) for identification of MBL-producer P. aeruginosa by polymerase chain reaction (PCR). A total of 255 imipenem resistant P. aeruginosa were collected from burn patients. Antibiotic susceptibility testing was conducted after purification and identification. Double-disc synergy test (DDST) with EDTA and combination disc test (CDT) with dipicolinic acid were performed for phenotypic detection of MBL and the PCR was carried out for blaVIM, blaIMP, blaNDM-1, blaSPM-1 genes. DDST with EDTA was negative in all cases, but 161 isolates were positive in CDT with dipicolinic acid. Further, blaVIM and blaIMP were detected in five and four strains, respectively. None of the isolates were positive for BlaNDM-1 and blaSPM-1. The results of this study showed that the prevalence of MBL is low in imipenem resistance P. aeruginosa and that other mechanisms could be involved in resistance to imipenem in this bacterium.
Pseudomonas aeruginosa is an obligate aerobic, gram-negative opportunist pathogen, which is able to grow and survive in hospital environment. This bacterium also plays an important role in a lot of severe infections, especially in immunocompromised and burn patients admitted to the burns ward and contains acquired and intrinsic antibiotic resistant genes.1–3P. aeruginosa is the second leading cause of nosocomial infections in hospitalized burn patients. P. aeruginosa is a highly adaptable micro-organism that can rapidly develop resistance to different types of broad-spectrum antibiotics. It can grow in hospital environments characterized by heavy antimicrobial use, and consequently it can be transmitted rapidly among hospitalized burn patients.1–3
Carbapenems are often used as a final choice for antibiotic therapy in treating infectious diseases associated with extended spectrum beta-lactamase (ESBL) producing gram-negative bacteria such P. aeruginosa and Acinetobacter baumannii.4,5 The carbapenemases have been organized based on amino acid homology in the Ambler molecular classification system. Class A, C, and D beta-lactamases all share a serine residue in the active site, while Class B enzymes require the presence of zinc for activity (and hence are referred to as metallo-beta-lactamases). Classes A, B, and D are of greatest clinical importance among nosocomial pathogens. The main mechanism of resistance in carbapenems is the production of carbapenemase by gram-negative bacteria.4,6 Metallo-beta-lactamase (MBL) is a class B beta-lactamase, which can hydrolyze carbapenem and other beta-lactams apart from Monobactam.4,6,7
The first isolate of MBL producer P. aeruginosa was reported in Japan in 1991 and since it has been reported worldwide.8 The most common MBLs are IMP-type carbapenemase (IMP) and Verona integron-encoded metallo-β-lactamase (VIM) types.9 The blaVIM and blaIMP genes can spread from one Pseudomonas to another as well as Enter-obacteriacea, since they are inserted into a plasmid-born integron class 1 or 3.9 Various phenotypic methods for detection of MBL-producer isolates have been suggested such as using chelating agents (i.e. Ethylenediaminetetraacetic acid [EDTA]) and some MBL inhibitor like dipicokinic acid,10–16), nevertheless the specificity and sensitivity of these methods can be variable.11
DDST with imipenem-EDTA and CDT using imipenem and dipicolinic acid as MBL inhibitors are two of the most common methods utilized in various studies.10–12 The aim of this study was molecular and phonotypical detection of MBL in P. aeruginosa strains isolated from burn patients.
Materials and methods
Bacterial specimen
In this study, 255 P. aeruginosa were isolated from burn patients (with at least 1 week of hospitalization) in Motahari Hospital (a referral burns center), Tehran, Iran from June to December 2013. Bacteria were collected from wound infections of hospitalized burn patients. Specimens were collected from male and female wards in hospital. The samples were collected by swabbing burn wound exudates, and immediately transported in transport culture media under standard conditions to the central laboratory of the Antimicrobial Resistance Research Center. P. aeruginosa ATTCC27853 was used as the negative control. Isolated bacteria species were identified by specific biochemical and microbiological tests such as oxidase, TSI, and glatinase. Polymerase chain reaction (PCR) was used as a confirmatory test for identification of P. aeruginosa strains using specific primers for oprI for genus and oprL for the species. P. aeruginosa ATCC 27853 and Acinetobacter baumannii ATCC 19606 were used as positive and negative control, respectively.
Antibiotic susceptibility testing
The antibiotic susceptibility testing was performed by disc diffusion method on Mueller–Hinton agar using cefotaxime (30 µg), ceftazidime (30 µg), aztreonam (30 µg), imipenem (10 µg), ticarcillin (75 µg), ticarcillin-clavulanic acid (75/10 µg), piperacillin (100 µg), piperacillin-Tazobactam (100/10 µg), ciprofloxacin (5 µg), gentamicin (10 µg), tobramycin (10 µg), kanamycin (30 μg), amikacin (30 µg), colistin (10 µg), tetracycline (30 µg), and trimethoprim (5 μg) according to clinical and laboratory standards institute (CLSI) 2011. Standard antibiotics discs used in this study were purchased from MAST Company (Mast Diagnostics, UK).
Phenotypic detection of metallo-beta-lactamase
Double-disc synergy test
At first, 0.5 M of EDTA was prepared by dissolving 186.1 g in 1 L of distilled water and pH 8 adjusted by NaOH. Then EDTA 750 µg/disc was prepared. Also, the inhibition zone of that was measured alone. In the next step, the DDST was conducted by imipenem (10 µg) and EDTA distinctly, which was placed with a distance of 20 mm center-to-center with imipenem (10 µg). The strain with increasing size in the imipenem (10 µg) inhibition zone towards EDTA is considered a MBL producer in DDST.11–14
Combination disc test
In the CDT, imipenem alone and imipenem (10 µg) impregnated with dipicolinic acid (1000 µg/disc) were examined. The strains with an increase of ⩾5 mm in the inhibition zone around the imipenem (10 µg) plus dipicolinic acid against imipenem (10 µg) alone were considered a MBL producer.10,16
PCR for detection of MBL genes
All strains were examined for detection of blaVIM, blaIMP. New Delhi metallo-beta-lactamase-1 (balNDM-1) and Sao Paulo metallo-beta-lactamase-1 (balSPM-1) by PCR with primers and PCR program were shown in Table 1.
Primer sequences and their amplicon sizes for metallo-beta-lactamase genes.
Genes
Sequence (5’→3’)
Amplicon size (pb)
Reference
oprl-F1
ATGAACAACGTTCTGAAATTCTCTGCT
249
14
oprl-R1
CTTGCGGCTGGCTTTTTCCAG
oprL-F1
ATGGAAATGCTGAAATTCGGC
504
oprL-R1
CTTCTTCAGCTCGACGCGACG
blaVIM−F
ATGTTAAAAGTTATTAGTAGT
801
15
blaVIM -R
CTACTCGGCGACTGAGCGAT
BlaIMP-F
GATGGTGTTTGGTCGCATA
139
16
BlaIMP-R
CGAATGCGCAGCACCAG
blaNDM-1-F
CCCGGCCACACCAGTGACA
129
blaNDM-1-R
GTAGTGCTCAGTGTCGGCAT
17
blaSPM-1-F
GGGTGGCTAAGACTATGAAGCC
447
blaSPM-1-R
GCCGCCGAGCTGAATCGG
PCR was performed for each sample with the following compounds: 1× concentration Specific PCR buffer, 0.4 mM of dNTPs mix, 0.7 mM of MgCl2, 1.6 M of each primer, one unit of Taq polymerase enzyme, 2 µL of DNA, and sterile distilled water to get 25 µL as a final volume. Finally, the PCR products were evaluated on a 1.5% agarose gel.
PCR (blaVIM, blaIMP genes) was performed in the following condition. The DNA thermocycle was programmed as follows: the first denaturation at 94°C for 5 and 10 min for VIM and IMP, respectively; 30 cycles of 94°C for 60 and 40 se for VIM and IMP, respectively; annealing at 55°C for 60 and 40 s VIM and IMP, respectively; extension at 72°C for 60 s; and at last the final extension at 72°C for 5 and 7 min for VIM and IMP, respectively.
Internal positive controls were considered in this study. The first positive strain is sequenced and used for positive control in all tested strains.
Multiplex PCR (balNDM-1 and balSPM-1 genes) was performed in the following condition. The DNA thermocycle was programmed as follows: the first denaturation at 94°C for 60 s for set; 30 cycles of 94°C for 30 s; annealing at 55°C for 60 s; extension at 72°C for 60 s; and at last the final extension at 72°C for 60 s.
Results
Two hundred and fifty-five strains were confirmed as P. aeruginosa by specific biochemical tests and subsequently by PCR. The results were interpreted according to CLSI 2011 AST guidelines. All tested strains were resistant to imipenem. The antibiotic resistant patterns were shown in Table 2.
Antibiotic resistance patterns of P. aeruginosa isolates.
Patterns
Antibiotic resistance patterns
n (%)
1
CTX CAZ AT CEF IMI PTZ PYR TC TC-C GM AK TO K TM CI
112 (49.9)
2
CTX CAZ AT CEF IMI PTZ PYR TC TC-C GM AK TO K TM CI T
Antibiotic resistance pattern 1 (resistant to all tested antibiotics except colistin) was the most observed patterns in both two studied wards.
The first five antibiotics prescribed that were consided as a first line of treatment were: cefepime, ciprofloxacin, amikacin, meropenem, imipenem, piperacillin-Tazobactam, and gentamicin. In total, 161 (63%) of imipenem-resistant strains were shown increasing the diameter of the inhibition zone by at least 5 mm with imipenem-dipicolinic acid compared with imipenem alone in CDT. Simultaneously, dipicolinic acid alone increased the inhibition zone to 12 mm (Figure 1).
The inhibition zone of dipicolinic acid disc alone.
None of them maintained synergistic effects between EDTA alone and imipenem alone. Direct sequencing of PCR amplified products was carried out using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Republic of Korea). Sequence analysis showed that blaVIM and blaIMP genes were detected in five and four tested strains, respectively (Figures 2 and 3).
PCR amplification fragments for detection of vim gene among P. aeroginosa isolates. Lanes 1–5: negative VIM1; lane 6: Negative control for VIM1 gene; lanes 7–10: positive VIM1 strains; lane 11: positive control; M: 1 kb marker.
PCR amplification fragments for detection of imp gene among P. aeroginosa isolates Lane 1: negative control; lane 2: positive control for imp gene; lanes 3 and 4: positive imp strains; M: 1 kb marker.
All of these nine strains which were confirmed by PCR as MBL producers, had positive results in CDT. None of the CDT negative strains had MBL genes, but 152 out of 161 which were CDT positive have not shown the specific band for MBL-tested genes after PCR and gel electrophoresis. blaNDM-1and blaSPM-1 have been not detected.
Discussion
Prevalence of carbapenem resistance P. aeruginosa is increasing mainly due to potential MBL production, which ultimately can cause high morbidity and mortality, particularly among hospitalized burn patients.21 The results of the study in 2014 in Colombia indicated that 60% of carbapenem resistant P. aeruginosa was a VIM producer and none of them was positive for IMP and NDM.22 In this study, as in our results, NDM-producer P. aeruginosa has been not detected, but the prevalence of VIM is higher than in our study. On the other hand, IMP has shown less prevalence in comparison to our results. Overall 60% of imipenem resistant P. aeruginosa in Colombia has been confirmed as a MBL producer, but 3.5% of imipenem resistant P. aeruginosa in the our study were MBL producers. This differentiation of MBL prevalence can relate to a kind of antibiotic therapy in two different countries and may be associated with a specific mechanism which is prevalent in various countries. It can be considered that in 2010 in Iran 23% of non-susceptible imipenem P. aeruginosa had blaVIM and blaIMP genes23 and this prevalence higher compared to our tested isolates in 2013. These different results in two different time frames but in the same country can indicate the change of carbapenem resistant mechanism in P. aeruginosa and could be related to the existence of another resistant mechanism.
DDST methods with imipenem and EDTA and CDT with imipenem and dipicolinic acid are used as two ordinary phenotypic methods for detection of MBLs.11 In a previous study in Iran, the DDST test was used for the detection of MBL in Pseudomonas spp., which showed that 23% of non-susceptible imipenem isolates have blaVIM and blaIMP genes.23 In 2011 in Norway, the sensitivity and specificity of CDT with dipicolinic acid were 100% in K. pneumoniae strains.10
In 2013 in Iran, 87.8% of tested imipenem resistant isolates were confirmed to be MBL producer based on DDST. blaIMP and blaVIM were detected in 24.4% and 56% of strains, respectively. This differention in the results of this study and the current study can be associated with the location of sampling in patients. On the other hand, these two studies were conducted in two different hospitals in two different cities with different antibiotic therapy policies.24
It can be noted that one antibiotic-resistant pattern was the most observed pattern in the two studied wards and it can indicate the spread of one bacterial clone in the two wards.
In the present study, no synergistic effect was observed using the DDST techniques, but the CD test was positive in 63% of imipenem resistant P. aeruginosa. Our findings also showed that dipicolinic acid alone tested for Pseudomonas strains had an inhibition zone up to 12 mm. Thus, an increase of 5 mm in the inhibition zone around imipenem with dipicolinic acid against imipenem alone cannot explain the synergistic effect of these two materials. In this regard, the specificity of dipicolinic acid was 81% for the detection of MBL in study of Pasteran et al.16
On the other hand, molecular tests for the presence of genes blNDM and blaSPM were negative and only 3.5% of isolates had blaVIM and blaIMP genes. It can explain the other carbapenem resistant mechanisms among P. aeruginosa like the efflux pump25 and over-expression of AmpC combined with porin loss.
Footnotes
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
This study was supported by a grant from the Department of Medical Microbiology, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran.
References
1.
LambertPA (2002) Mechanisms of antibiotic resistance in Pseudomonas aeruginosa. Journal of the Royal Society of Medicine41: 22–26.
2.
AghazadehMHojabriZMahdianR, et al. (2014) Role of efflux pumps: MexAB-OprM and MexXY(-OprA), AmpC cephalosporinase and OprD porin in non-metallo-β-lactamase producing Pseudomonas aeruginosa isolated from cystic fibrosis and burn patients. Infection, Genetics and Evolution24: 187–192.
3.
FarshadzadehZKhosraviADAlaviSM, et al. (2014) Spread of extended-spectrum β-lactamase genes of blaOXA-10, blaPER-1 and blaCTX-M in Pseudomonas aeruginosa strains isolated from burn patients. Burns40: 1575–1580.
4.
AsadollahiPAkbariMSoroushS, et al. (2012) Antimicrobial resistance patterns and their encoding genes among Acinetobacter baumannii strains isolated from burned patients. Burns38: 1198–1203.
5.
VahdaniMAzimiLAsghariB, et al. (2012) Phenotypic screening of extended-spectrum ß-lactamase and metallo-ß-lactamase in multidrug-resistant Pseudomonas aeruginosa from infected burns. Annals of Burns and Fire Disasters7: 78–81.
6.
SoroushSHaghi-AshtianiMTTaheri-KalaniM, et al. (2010) Antimicrobial resistance of nosocomial strain of Acinetobacter baumannii in children’s medical center of Tehran: A 6-year prospective study. Acta Medica Iranica48: 178–184.
7.
NordmannPPoirelL (2012) Emerging carbapenemases in Gram-negative aerobes. Clinical Microbiology and Infection8: 321–331.
8.
PeymaniANahaaeiMRFarajniaS, et al. (2011) High prevalence of metallo-beta-lactamase-producing Acinetobacter baumannii in a teaching hospital in Tabriz, Iran. Japanese Journal of Infectious Disease64: 69–71.
9.
WalshTRTolemanMAAPoirelL, et al. (2005) Metallo-lactamases: The quiet before the storm?Clinical Microbiology Reviews18: 306–325.
10.
GiskeCGGezeliusLSamuelsenØ, et al. (2011) A sensitive and specific phenotypic assay for detection of metallo-β-lactamases and KPC in Klebsiella pneumoniae with the use of meropenem disks supplemented with aminophenyl boronic acid, dipicolinic acid and cloxacillin. Clinical Microbiology and Infection17: 552–556.
11.
J FiettABaraniakAMro’wka, et al. (2006) Molecular epidemiology of acquired-metallo-β lactamase producing bacteria in Poland. Antimicrobial Agents and Chemotherapy50: 880–886.
12.
Pica~oRCAndradeSSNicolettiAG, et al. (2008) Metallo-β-lactamase detection: Comparative evaluation of double-disc synergy versus combined disc tests for IMP-, GIM-, SIM-, SPM-, or VIM-producing isolates. Journal of Clinical Microbiology46: 2028–2037.
13.
LucenaADalla CostaLMNogueira KdaS, et al. (2014) Comparison of phenotypic tests for the detection of metallo-beta-lactamases in clinical isolates of Pseudomonasaeruginosa. Enfermedades Infecciosas y Microbiologia Clinica32: 625–630.
14.
MishraSKAcharyaJKattelHP, et al. (2010) Metallo-beta-lactamase producing gram-negative bacterial isolates. Journal of Nepal Health Research Council10: 208–213.
15.
YongDLeeYJeongSH, et al. (2012) Evaluation of double-disk potentiation and disk potentiation tests using dipicolinic acid for detection of metallo-β-lactamase-producing pseudomonas spp. and Acinetobacter spp. Journal of Clinical Microbiology50: 3227–3232.
16.
PasteranFVelizOFacconeD, et al. (2011) A simple test for the detection of KPC and metallo-β-lactamase carbapenemase-producing Pseudomonasaeruginosa isolates with the use of meropenem disks supplemented with aminophenylboronic acid, dipicolinic acid and cloxacillin. Clinical and Microbiological Infection17: 1438–1441.
17.
VosDDLimAPirnayJP, et al. (1997) Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two outer membrane lipoprotein genes, oprI and oprL. Journal of Clinical Microbiology35: 1295–1299.
18.
ShibataNDoiYYamaneK, et al. (2003) PCR typing of genetic determinants for metallo-β-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron. Journal of Clinical Microbiology41: 5407–5413.
19.
DallenneCCostaADDecre’D, et al. (2010) Development of a set of multiplex PCR assays for the detection of genes encoding important b-lactamases in Enterobacteriaceae. Journal of Antimicrobial Chemotherapy65: 490–495.
20.
VoetsGMFluitACScharringaJ, et al. (2011) A set of multiplex PCRs for genotypic detection of extended-spectrum-lactamases, carbapenemases, plasmid-mediated AmpC _lactamases and OXA_-lactamases. International Journal of Antimicrobial Agents37: 356–359.
21.
SalimiHOwliaPYakhchaliB, et al. (2009) Drug susceptibility and molecular epidemiology of Pseudomonas aeruginosa isolated in a burn unit. American Journal of Infectious Disease5: 301–306.
22.
SaavedraSYDuarteCGonzálezMN, et al. (2014) Characterization of isolates of carbapenemase-producing Pseudomonas aeruginosa from seven Colombian provinces. Biomedica34: 217–223.
23.
YousefiSFarajniaSNahaeiMR, et al. (2010) Detection of metallo-β-lactamase-encoding genes among clinical isolates of Pseudomonas aeruginosa in northwest of Iran. Diagnostic Microbiology and Infectious Disease68: 322–325.
24.
DoostiMRamazaniAGarshasbiM (2013) Identification and characterization of metallo-β-lactamases producing Pseudomonas aeruginosa clinical isolates in University Hospital from Zanjan Province, Iran. Iranian Biomedical Journal17: 129–133.
25.
KohlerTMichea-HamzehpourMEppSF, et al. (1999) Carbapenem activities against Pseudomonas aeruginosa: respective contributions of OprD and efflux systems. Antimicrobial Agents and Chemotherapy43: 424–427.