Abstract
Sinonasal polyposis (SNP) is a chronic inflammatory disease of nasal and paranasal cavities. Human leukocyte antigen-G molecules (HLA-G) are non-classic HLA-I molecules with anti-inflammatory and tolerogenic properties. HLA-G production is mainly induced by interleukin (IL)-10. IL-10 is an anti-inflammatory cytokine that inhibits the production of proinflammatory cytokines and induces HLA-class II down-modulation. Recent studies suggest that HLA-G could play a role in SNP pathogenesis; in SNP patients physiological levels of IL-10 (produced by activated peripheral blood CD14+ monocytes) are not able to induce production of HLA-G. Different mechanisms could justify these findings: genomic or amino-acidic sequence alterations in IL-10 lower IL-10 receptor expression, lower IL-10 receptor affinity, or alterations of the intracellular signal transmission. This study analyzes nucleotidic sequence of IL-10 gene in SNP patients. Sequencing of IL-10 gene shows that the lack of HLA-G production by peripheral blood CD14+ monocytes is not related to alterations in IL-10 gene nucleotidic sequence.
Keywords
Sino-nasal polyposis (SNP) is a chronic inflammatory disease of the nose and paranasal sinuses. SNP affects about 2% of the population 1 and can appear alone or in association with other diseases like asthma or salicylic acid intolerance. The etiology of SNP is complex and still unclear. SNP frequently appears among relatives in the same family and the high association with asthma lead to consider common pathways between these chronic diseases.2–4
Recently some studies have focused on the role of human leucocyte antigen-(HLA) in SNP.5–8 HLA-G antigens are non-classic HLA-I molecules with low polymorphism and limited tissue distribution: alternative splicing mechanisms encode for membrane bound (HLA-G1-G4) and soluble (HLA-G5-G7) isoforms. HLA-G function was first studied on cytotrophoblast cells where it plays an important modulative action on mother T-cells, protecting fetal tissues during pregnancy. 9 Several reports have shown the ability of membrane and soluble HLA-G molecules to induce apoptosis in natural killer cells and CD8 T cells through a Fas-FasL-dependent mechanism. These molecules also inhibit the proliferation of allo-specific CD4 T cells, enhance suppressor CD4 T cells, and affect the differentiation of dendritic cells.10–12 These characteristics suggest HLA-G molecules as mediators of immunosuppressive functions against innate and adaptive cellular responses. HLA-G modulation has been observed in autoimmune diseases, solid tumors, virally infected cells, and transplanted organs.13–23 In a number of different diseases, a correlation between the levels of circulating soluble HLA-G molecules (soluble HLA-G1 produced by proteolytic shedding of HLA-G1 membrane bound and HLA-G5 isoform) in plasma and other biological fluids and the susceptibility or clinical outcome has been observed.14–17 The function of HLA-G molecules seems to be anti-inflammatory and tolerogenic. In physiological conditions, the modulation of HLA-G antigens was also observed in thymus cells and in activated peripheral blood CD14+ monocytes (PBMCs): when activated IL-10 induces HLA-G production by PBMCs.
Interleukin (IL)-10 cytokine represents, with interferons and hormones, the main inducer of soluble HLA-G (sHLA-G) molecule production by peripheral blood CD14 monocytes. IL-10 is an anti-inflammatory cytokine that inhibits the production of proinflammatory cytokines (TNF-, IL-1, IL-6, and IL-8), induces HLA-class II down-modulation, and affects the expression of accessory molecules as B7.1/B7.2 and CD23 necessary for T-cell activation. Moreover, IL-10 prevents antigen-presenting cell maturation.
A deficit in IL-10 secretion by lipopolysaccharide (LPS)-activated peripheral blood mononuclear cells (PBMCs) has been demonstrated in asthmatic patients.24,25 This mechanism could prevent an adequate production of sHLA-G molecules and maintain the inflammatory chronic conditions that characterize asthma disease.
Epidemiological association between asthma and SNP led us to verify the role of IL-10 and HLA-G molecules also in SNP patients and some noticeable findings emerged. In SNP patients we found an increase in circulating IL-10 levels despite a complete absence of sHLA-G. 26 sHLA-G production appeared only after addition of exogenous IL-10. This means that physiological levels of IL-10 in patients affected by SNP are not able to induce the production of HLA-G. Different mechanisms could justify these findings: amino acidic sequence alterations in IL-10 protein, low IL-10 receptor expression, low IL-10 receptor affinity, or alterations of the intracellular signal transmission. Due to the limited extension of IL-10 gene, we first decided to analyze the nucleotidic sequence of this gene.
Materials and methods
Subjects
We enrolled 10 patients (5 men, 5 women; mean age 35.4 years) affected by SNP. The patients were affected by SNP at stages 2 and 3 according to Kastenbauer’s classification. 27 Twenty healthy subjects matched for sex and age were used as control. Informed consent for blood sampling was obtained from both patients and controls.
PBMC cultures
PBMC obtained by Ficoll centrifugation (Cederlane, Hornby, ON, Canada) of peripheral whole blood was resuspended in Iscove’s medium (Biochrom, Berlin, Germany) + 10% fetal calf serum at the concentration of 1’106/mL and cultured for 48 h. Activated cultures were obtained by 10 ng/mL of LPS (Calbiochem, La Jolla, CA, USA). 26
sHLA-G determination
sHLA-G was assayed in PBMC culture supernatants in triplicate as reported in Essen Workshop for sHLA-G quantification 28 using as capture antibody the MoAb MEM-G9 (Exbio, Praha, Czech Republic), which recognizes HLA-G molecule, in beta2-microglobulin-associated form, at the concentration of 20 mg/mL. As detecting antibody, an anti-beta 2 microglobulin MoAb – HRP conjugate was used (Dako, Glostrup, Denmark). Transfected HeLa-G5 cells (kindly provided by Prof. E Weiss, Institut fur Anthropologie und Genetik, LMU, Munchen, Germany) were cultured in CD hybridoma AGtmedium (GIBCO, Auckland, New Zealand) added with 1% FCS and antibiotics. Culture supernatants were collected at cell confluence and concentrated by lyophilisation procedure. Following depletion of albumin by Albumin depletion kit (Enchant Life Science kit, Pall Corporation, MI, USA), the purification of the sHLA-G proteins was carried out as previously reported. 29 The sHLA-G molecules obtained were used as standard at different dilutions. The intra-assay coefficient of variation (CV) was 1.4%, the inter-assay CV was 4.0%. The limit of sensitivity is 1.0 ng/mL.
IL-10 concentrations
IL-10 concentrations were determined in triplicate of undiluted samples using the commercially available Human IL-10 BioSource Immunoassay Kit (Human IL-10 US; BioSource, Camarillo, CA, USA) with a detection limit of 0.2 pg/mL.
IL-10 sequencing
Genomic DNA was extracted from epithelial cells of the oral cavity by ‘DNA IQ kit’ (Promega, USA) and amplified by Taq 0.4 uL (2 U each specimen) (Taq Platinum, Invitrogen USA), Buffer 10X 5 uL, dNTPs 10 mM 1 uL, MgSO4 50 mM 2 uL, Primer I 10 uM 1 uL, Primer II 10 uM 1 uL, extracted DNA 6 uL, H2O to reach 50 uL (33.6 uL).
Primer sequences used are listed as follows: IL10-Short2-Rev6 CAGCCACCTCCGCCAATC IL10-Short2-For3 GCCTTGATGTCTGGGTCTTG IL 10-Short2-Rev5 CAACACCTATTCCCCCAAACTTA IL10-Short1-Rev3 TGGGGAGAGTGACAAAGGAA IL10-Short1-For3 CGAGACACTGGAAGGTGAAT IL10-Rev2 AGAATGCCTCGCTCAGCACT IL10-For2 TCCCAGAGAGAACTGAGCCC IL10-Rev1_bis AAGGAGCCTGGAACACATCC IL10-For1_bis TCTCCCCGTTAGCCTTGAAA IL10-Rev1 ACCAATCATTTTTGCTTACG IL10-For1 TTCACCCACTCTCTTTTGTC.
PCR was then performed for 2 min at 94°C (35 cycles), denaturation for 40 s at 94°C, annealing for 45 s at 60°C, and extension for 3.5 min at 68°C. PCRs were purified with magnetic beads in Agencourt Ampure XP PCR purification system (Beckman Coulter; USA).
Complete sequencing of IL-10 gene (esonic and intronic regions of 4.89 Kb) was then performed by two PCR. These PCRs were overlying for 200 base pairs (bp). For the first PCR, four sequences – two forward and two reverse – were prepared. The second PCR was more complex so we needed to prepare five sequences to achieve a complete sequencing. Specimens were examined by BMR Genomics s.r.l., Padova, Italy.
Statistical analysis
Statistical analysis was carried out using Stata 8.0 (Stata Corporation, College Station, TX, USA) package. The comparisons between variables were calculated by Mann-Whitney U test. Statistical significance was assumed for P <0.05 (two-tailed). Single nucleotide polymorphisms and reference sequences were compared by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The analysis for splicing variants was performed with the toll http://www.fruitfly.org/seq_tools/splice.html.
Results
All SNP patients showed similar IL-10 levels in unstimulated PBMC cultures in comparison with controls (P = NS, Mann Whitney U test) (Figure 1a), while LPS activation induced an IL-10 production in SNP patients higher than in healthy subjects (P = 0.02, Mann Whitney U test) (Figure 1b). No detectable sHLA-G amounts were observed in the culture supernatants of unstimulated PBMC from SNP patients and controls (Figure 2a). LPS activation induced sHLA-G production in healthy subject PBMC whereas lower detectable molecules were observed in SNP patients (Figure 2b) (P = 0.003, Mann-Whitney U test). These data confirm our previous results in SNP patients: 26 IL-10 (produced after LPS stimulation) could not induce HLA-G expression. For this reason we hypothesized the presence of possible mutations in IL-10 gene that could lead to a protein with a defective functionality.

IL-10 levels in peripheral blood CD14+ monocytes (PBMC) cultures of sinonasal polyposis patients (SNPo) in comparison with controls (CTR) before (a) and after LPS stimulation (b).

sHLA in unstimulated peripheral blood CD14+ monocytes (PBMC) from sinonasal polyposis patients (NSP) and controls (CTR) before (a) and after LPS activation (b).
We analyzed the sequence of the IL-10 gene, including both exon and intron regions. We observed the presence of single nucleotide polymorphisms in the different samples in comparison with the reference sequence for IL-10 gene (NG_012088;http://www.ncbi.nlm.nih.gov) (Table 1).
Single nucleotide polymorphisms in sinonasal polyposis samples.
Single nucleotide polymorphisms offsets were calculated taking the A of the IL-10 ATG start codon as position 1 based on the NG_012088 sequence. Ref. seq. gives the offset of the single nucleotide polymorphism in the consensus reference assembly sequence NG_012088 available from http://www.ncbi.nlm.nih.gov/. Two (2571, 3644) of the four exonic single nucleotide polymorphisms have been already reported as rs149143243 and rs374619208 (http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?geneId=3586), with a missense function. They are present in samples 1 and 9, respectively.
We observed the presence of three kinds of single nucleotide polymorphisms present in more than 30% of the samples analyzed (Table 2). These single nucleotide polymorphisms were all intronic (1498, 1833, 3166, and 3582), and the analysis for splicing variants (http://www.fruitfly.org/seq_tools/splice.html) did not recognize an effect on splicing mechanisms.
Single nucleotide sequence polymorphisms frequencies in sinonasal polyposis samples.
The complete IL-10 gene sequence of 10 SNP patients is too big to be displayed in this article. If needed, the complete sequence can be requested directly to authors.
Discussion
The complete analysis of IL10 gene in patients affected by SNP revealed the presence of different kinds of single nucleotide polymorphisms. Only three of these with an intronic localization were present in more than 30% of patients, but they did not present any effect on splicing mechanisms. This excludes the lower induction of sHLA-G after LPS activation of PBMCs 26 due to an altered IL-10 genome sequence.
Due to the evident normality of findings and in order to avoid useless leakage of resources we decided to stop examination of more patients. Any further study, in our opinion, should involve promoter and control region sequence analysis and IL-10 receptorial mechanisms both in peripheral blood and nasal polyps.
Despite SNP being commonly considered as a local disease, our studies strongly suggest it is a local disease associated with systemic abnormalities of important immuno-suppressive mediators like HLA-G and IL-10. It will be also of interest to evaluate the expression of IL-10 receptor in this pathological condition, in order to identify possible differences that could explain the peculiar unresponsiveness to IL-10 increase in SNP.
Even if genetic and environmental mechanisms underlying nasal chronic inflammation in SNP are still unknown, we suggest that IL-10 and HLA-G could play a role in the pathogenesis of this annoying and expensive disease.
Footnotes
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
