A novel homozygous TREM2 c.257del variant in a Chinese family with Nasu–Hakola disease: A case study and literature review

Abstract

Nasu–Hakola disease is a rare autosomal recessive disorder characterized by progressive cognitive decline and bone cyst formation and is commonly associated with triggering receptor expressed on myeloid cells 2 (TREM2) variants. Herein, we report a novel TREM2 frameshift variant in a middle-aged man from a consanguineous Chinese family who presented with early-onset dementia and right ankle pain. Neuroimaging and skeletal examinations revealed cerebral atrophy and bone cystic lesions. Whole-exome sequencing followed by Sanger confirmation identified a homozygous TREM2 c.257del (p.D86Afs*103) variant. The patient was diagnosed with Nasu–Hakola disease, and his cognitive deterioration continued despite treatment with donepezil and memantine. Functional assays in human embryonic kidney 293T cells demonstrated preserved mRNA expression of the mutant construct but markedly reduced protein levels compared with that of wild-type. We also conducted a descriptive literature review of 54 previously reported cases of homozygous or compound heterozygous TREM2 variants to highlight the variability in neurodegenerative and skeletal phenotypes. To the best of our knowledge, this is the first report of a TREM2 c.257del variant in a Chinese family. Our findings expand the mutational spectrum of Nasu–Hakola disease and highlight substantial phenotypic heterogeneity, emphasizing the importance of early genetic testing in patients with unexplained early-onset dementia, even in the absence of bone lesions.

Keywords

Nasu–Hakola disease case study frontotemporal dementia bone cysts loss-of-function

Introduction

The triggering receptor expressed on myeloid cells 2 (TREM2) gene plays a crucial role in myeloid cells such as microglia and osteoclasts. Genetic variants of TREM2, both homozygous and heterozygous, are associated with an increased risk of neurodegenerative diseases, including Alzheimer’s disease (AD), frontotemporal dementia (FTD), and Nasu–Hakola disease (NHD).^1,2 Notably, biallelic loss-of-function mutations cause NHD, whereas heterozygous risk variants (e.g. R47H) are associated with an approximately threefold increased risk of AD.³ NHD, also known as polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL), is a rare autosomal recessive disorder characterized by progressive cognitive decline and cystic bone lesions.⁴ In this study, we report a novel TREM2 variant (c.257del, p.D86Afs*103) in a consanguineous Chinese family. Through integrated clinical, genetic, and molecular analyses and a literature review of reported TREM2 variants, we demonstrated the broad clinical spectrum spanning NHD, FTD, and AD and highlighted the importance of early genetic testing in patients with early-onset dementia.

Methods

Participants

The proband underwent a comprehensive clinical evaluation. Written informed consent was obtained. The study was approved by the Ethics Committee of The Second Affiliated Hospital, Zhejiang University School of Medicine (Approval Number: 2015-042) and conducted in accordance with the Declaration of Helsinki. This case report conforms to the Case Report (CARE) guidelines,⁵ and we have deidentified all patient details.

Genetic analysis

Genomic DNA was extracted from peripheral blood using a Blood Genomic Extraction Kit (Qiagen; Hilden, Germany). Whole-exome sequencing (WES) was performed using the Agilent SureSelect Human All Exome V6 kit (Agilent Technologies; Canada) on an Illumina HiSeq X Analyzer (Illumina; USA). Sequencing quality metrics showed a mean depth of coverage of 424.22×, with 98.86% of target bases covered at ≥20×. Sequencing reads were aligned to the human reference genome (UCSC hg19), and variants were annotated using ANNOVAR. Variants with a minor allele frequency <1% in dbSNP, the 1000 Genomes Project, ExAC, and gnomAD were considered. The functional impact of candidate variants was evaluated according to American College of Medical Genetics and Genomics (ACMG) guidelines.⁶ Segregation analysis was performed using Sanger sequencing with the following primers: TREM2 F: CACAGACGCCCAAAACATGAG; TREM2 R: TTAAGACCAAGTGCCTCCAGAA.

Plasmid constructs, transfection, and expression analysis

The wild-type (WT) TREM2 coding sequence (NM_018965) was cloned into the vector. A mutant construct carrying the c.257del (p.D86Afs*103) variant was generated by polymerase chain reaction (PCR) mutagenesis. All constructs were validated using Sanger sequencing. Human embryonic kidney 293T (HEK-293T) cells were transiently transfected with these plasmids using Lipofectamine 3000. Total RNA was isolated and reverse-transcribed into complementary DNA (cDNA). Gene expression was then analyzed by quantitative real-time PCR (RT-qPCR) using the 2^−ΔΔCt method. Primer sequences were as follows: TREM2 F: CTTTGTCACAGAGCTGTCCG; TREM2 R: AGTCATAGGGGCAAGACACC; GAPDH F: AGATCCCTCCAAAATCAAGTGG; GAPDH R: GGCAGAGATGATGACCCTTTT. For protein analysis, total proteins were extracted, and lysates were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Membranes were probed with primary antibodies, including anti-TREM2 (1:500, Santa Cruz Biotechnology; USA). For immunofluorescence, cells were fixed, permeabilized, and blocked, followed by incubation with an anti-TREM2 antibody (1:100, Santa Cruz Biotechnology; USA). Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI), and images were captured using a confocal microscope.

Statistical analysis

Data were presented as mean ± SD. All experiments were performed with three independent biological replicates. Statistical significance was evaluated using Student’s t-test for normally distributed data and the Mann–Whitney U test for non-normally distributed data using GraphPad Prism 7. The following conventions were used: *p < 0.05; ns, not significant.

Results

Clinical features

This study describes the case of a man in his late 30s from a consanguineous Han Chinese family who presented to The Second Affiliated Hospital of Zhejiang University (Hangzhou, Zhejiang, China) in June 2021 with a 3-year history of progressive retrograde amnesia. He had completed a bachelor’s degree and previously managed a foreign trade company. The patient’s early symptoms included recent memory loss with confabulation and occupational impairment, without initial personality or language changes. He had no relevant medical history. The pedigree revealed consanguineous parents. His father and sister were asymptomatic, whereas his mother reported long-standing memory decline without formal evaluation, with further clinical assessment recommended but not completed. Neurological examination revealed brisk reflexes and bilateral Babinski signs. Cognitive testing demonstrated impairment, with a mini-mental state examination (MMSE) score of 24/30 (orientation, 8/10; registration, 3/3; attention/calculation, 4/5; recall, 0/3; and language, 9/9) and a Montreal cognitive assessment (MoCA) score of 16/30 (visuospatial/executive, 1/5; naming, 3/3; attention, 6/6; language, 0/3; abstraction, 2/2; delayed recall, 0/5; and orientation 4/6). The neuropsychiatric inventory (NPI) score was 0, indicating no significant neuropsychiatric symptoms. Given the patient’s age and university-level education, MMSE score <27 and MoCA score <26 indicated cognitive impairment, particularly in executive and memory function. Blood tests, including complete blood count, vitamin B12, syphilis serology, thyroid function, human immunodeficiency virus (HIV) testing, hepatic function, and renal function, were all within normal limits. Brain magnetic resonance imaging (MRI) revealed bilateral frontotemporal and hippocampal atrophy (Figure 1(a)) with localized T2 hyperintensities and hippocampal atrophy (Figure 1(b)), whereas 18 F-florbetapir positron emission tomography (18 F-AV45PET) demonstrated no β-amyloid deposition (Figure 1(c) and (d)).

Figure 1.

Clinical and imaging characterization of the proband with a TREM2 c.257del variant. (a to d) Neuroimaging findings at onset; (a and b) brain MRI shows cerebral atrophy, localized white matter hyperintensities, and hippocampal atrophy; (c and d) 18 F-florbetapir positron emission tomography (18 F-AV45PET) demonstrates no significant β-amyloid deposition; (e and f) skeletal involvement; (e) CT scan of the right ankle shows multiple cystic bone lesions; (f) bone biopsy of the right ankle shows fractured bone tissue with degenerative necrosis of myeloid fat; (g and h) follow-up neuroimaging findings. Brain MRI shows worsening cortical atrophy, increased white matter hyperintensities, ventricular enlargement, and medial temporal lobe atrophy. TREM2: triggering receptor expressed on myeloid cells 2; CT: computed tomography; MRI: magnetic resonance imaging.

Approximately 4 years after the initial presentation, the patient developed severe right ankle pain without trauma. Computed tomography (CT) revealed multiple cystic lesions in the tibia, fibula, and foot bones (Figure 1(e)), with similar asymptomatic findings on the left. Bone biopsy confirmed fractured bone tissue with degenerative necrosis of myeloid fat (Figure 1(f)).

In his early 40s, cognitive function had severely deteriorated (MMSE, 7/30; normal ≥27 for individuals with university-level education), consistent with severe dementia, and resulted in complete functional dependency. The patient received long-term oral donepezil (5 mg daily) and memantine (5 mg daily), with dose adjustments over time; however no meaningful clinical improvement was observed despite treatment. Neuropsychiatric manifestations included incontinence, apathy, and anorexia. Follow-up MRI revealed worsening cortical atrophy, increased white matter hyperintensities, ventricular enlargement, and medial temporal lobe atrophy (Figure 1(g) and (h)).

Genetic analysis

The patient was initially considered to have early-onset cognitive impairment, and genetic testing was performed after a diagnosis of early-onset AD was excluded. WES identified a novel homozygous frameshift variant in TREM2 (c.257del, p.D86Afs*103). This deletion caused a frameshift, disrupting 103 downstream amino acids and introducing a premature stop codon in the C-terminal region. Sanger sequencing confirmed that the patient was homozygous, whereas both parents were heterozygous carriers (Figure 2(a) to (d)). Based on the clinical, radiological, and genetic findings, the patient was diagnosed with NHD.

Figure 2.

Genetic and functional characterization of the proband with a TREM2 c.257del variant. (a) Pedigree of the consanguineous family. Arrow indicates the proband. Filled black symbol indicate affected patient, whereas half-filled symbol indicate heterozygous carrier without symptoms. Genotypes are shown as follows: −/−, homozygous TREM2 c.257del; +/−, heterozygous carrier; +/+, wild-type. (b to d) Sanger sequencing confirming segregation of the TREM2 variant. Pedigree members shown include (b) IV-1 Continued.(proband), (c) III-1 (father), and (d) III-2 (mother). The proband is homozygous for the c.257del variant, and both parents are heterozygous carriers. (e to i) Functional analysis in HEK-293T cells; (e) RT-qPCR shows no significant difference in TREM2 mRNA expression between wild-type (WT) and mutant constructs (p = 0.99; ns, not significant); (f) representative western blot of TREM2 protein expression, with GAPDH as a loading control; (g) quantification of western blot showing significantly reduced TREM2 protein levels in the mutant group compared with than in WT (*p < 0.05); (h) immunofluorescence shows strong cell membrane localization of WT TREM2 (red), whereas mutant TREM2 protein was nearly absent. Nuclei were stained with DAPI (blue); enhanced green fluorescent protein (EGFP) tag (green); (i) quantification of mean fluorescence intensity per cell showing significantly reduced signal in the mutant group compared with WT (*p < 0.05). TREM2: triggering receptor expressed on myeloid cells 2; HEK-293T: human embryonic kidney 293T; RT-qPCR: quantitative real-time polymerase chain reaction; DAPI: 4′,6-diamidino-2-phenylindole.

Biological effect of the variant

To evaluate the functional consequences of the variant, WT and mutant TREM2 constructs were transfected into HEK-293T cells. RT-qPCR demonstrated no significant difference in mRNA levels between mutant and WT plasmids (p = 0.99) (Figure 2(e)). However, western blotting confirmed markedly reduced mutant protein expression compared with that of WT (*p < 0.05) (Figure 2(f) and (g)). Immunofluorescence revealed near-complete loss of detectable mutant protein, in contrast to the robust membrane localization of WT TREM2 (*p < 0.05) (Figure 2(h) and (i)).

Comparison with reported TREM2 variants

We identified reported TREM2 variants from the Alzforum database (https://www.alzforum.org/) and also conducted an extensive search through PubMed to identify additional cases. This descriptive literature summary included 54 patients with biallelic TREM2 variants (homozygous or compound heterozygous) and available full-text data. All patients developed dementia: 31 were diagnosed with NHD, 22 with FTD, and one with AD (Figure 3). Diagnostic classification was based on the presence of dementia in all patients: cases with skeletal changes were classified as NHD; cases without bone involvement but with AD pathology or biomarkers were classified as AD; and cases without bone involvement or AD pathology/biomarkers but with typical FTD features were categorized as FTD.

Figure 3.

Spectrum of homozygous or compound heterozygous TREM2 variants. Schematic of the TREM2 gene (five exons). Reported variants associated with Nasu–Hakola disease (NHD), frontotemporal dementia (FTD), and Alzheimer’s disease (AD) are indicated in orange, black, and red, respectively. Mutations shown in solid boxes are compound heterozygous; all others are homozygous. “M” indicates the transmembrane region, as defined by UniProt. TREM2: triggering receptor expressed on myeloid cells 2.

Clinical features and neuroimaging

Most patients showed frontal and temporal lobe atrophy with frontal-lobe syndrome characterized by personality changes and behavioral disturbances, consistent with the behavioral variant of FTD (bvFTD). Approximately half of the patients exhibited white matter hyperintensities and basal ganglia calcifications, although the latter were less common in patients with FTD. Notably, 22 patients diagnosed with FTD had no skeletal involvement. Even among pedigrees carrying identical variants (e.g. c.97C>T, p.Gln33Ter; c.113A>G, and p.Tyr38Cys), phenotypes varied between dementia with and without bone lesions.^7–12 Epileptic seizures and upper motor neuron signs were observed in approximately half of the cases.

Alzheimer’s association

The R47H variant was associated with AD, with affected patients displaying positive AD biomarkers.¹³ Notably, Aβ and tau deposition was identified in postmortem brain tissue from a patient with NHD carrying the Q33X variant.¹²

A detailed descriptive summary of clinical features is provided in Table 1 and Supplemental Table 1.

Table 1.

Descriptive summary of reported clinical features in 54 patients with homozygous or compound heterozygous TREM2 variants.

Category	NHD (n = 31)	FTD (n = 22)	AD (n = 1)
Early symptoms at onset
Early-onset dementia	31 (100%)	22 (100%)	1 (100%)
Behavior/personality change	29 (93.5%)	19 (86.4%)	1 (100%)
Memory decline	9 (29.0%)	12 (54.5%)	1 (100%)
Executive function decline	7 (22.6%)	11 (50.0%)	1 (100%)
Visual-spatial ability impairment	4 (12.9%)	4 (18.2%)	0 (0%)
Language deterioration	1 (3.2%)	6 (27.3%)	1 (100%)
Bone pain or fracture	21 (67.7%)	0 (0%)	0 (0%)
Epileptic seizures	15 (48.4%)	10 (45.5%)	0 (0%)
Physical sign
Abnormal deep reflexes/pathological signs	16 (51.6%)	3 (13.6%)	0 (0%)
Parkinsonism	4 (12.9%)	7 (31.8%)	0 (0%)
Brain examination
Cortical atrophy	28 (90.3%)	19 (86.4%)	1 (100%)
White matter hyperintensities	17 (54.8%)	13 (59.1%)	0 (0%)
Basal ganglia calcifications	17 (54.8%)	2 (9.1%)	0 (0%)
Aβ deposition	2 (6.5%)	0 (0%)	1 (100%)
Skeleton examination
Bone cysts	29 (93.5%)	0 (0%)	0 (0%)
Osteoporosis	2 (6.5%)	0 (0%)	0 (0%)

AD: Alzheimer’s disease; FTD: frontotemporal dementia; NHD: Nasu–Hakola disease; TREM2: triggering receptor expressed on myeloid cells 2.

Discussion

In this study, we identified a novel homozygous TREM2 variant (c.257del, p.D86Afs*103) in a consanguineous Chinese family that co-segregated with the classic NHD phenotype. Mechanistically, TREM2 encodes a transmembrane receptor that signals through the adaptor protein DNAX-activating protein of 12 kDa (DAP12), which recruits and activates spleen tyrosine kinase (SYK), thereby regulating microglial activation and osteoclast differentiation.^1,14 Biallelic mutations in DAP12 cause a phenotype indistinguishable from that of TREM2-related NHD.¹ The TREM2 c.257del variant truncates the protein, disrupting its transmembrane domain. In an overexpression system, the c.257del variant markedly reduces TREM2 protein levels. This loss-of-function impairs debris clearance in the brain and bone remodeling, thereby explaining the combined neuro-skeletal phenotype.

Our review suggests that homozygous and compound heterozygous TREM2 variants are associated with NHD, FTD, and, rarely, AD. Affected individuals typically presented between 30 and 50 years of age and progressed to severe dementia. Behavioral and personality changes, cortical atrophy, and white matter hyperintensities characterize TREM2-associated FTD, whereas the addition of basal ganglia calcifications and bone cysts defines the predominant features of TREM2-related NHD. A minority of patients exhibited language-variant FTD, seizures, or parkinsonism.^8,10,15–25 This clinical overlap with other dementias complicates diagnosis and should be recognized by clinicians. Recent work by Swain et al.,²⁶ using experimental structural information, demonstrated that TREM2 variants differentially affect protein stability and interactions, providing insight into disease mechanisms and prediction of novel variants.

Bone involvement in TREM2-related disorders is variable and incompletely penetrant. Despite identical variants, some patients develop dementia without skeletal abnormalities,^7–10 and the timing of bone pathology varies relative to cognitive onset. Swain et al.²⁶ attributed phenotypic variability of identical TREM2 variants to protein structural effects, whereas bone damage may be influenced by modifier genes, environmental factors, or stochastic processes. In our review of 22 patients classified as FTD, 10 had imaging studies without bone cysts, 9 had no reported bone-related symptoms, and 3 lacked documentation of skeletal findings despite typical FTD features, suggesting that subclinical bone cysts may be underdetected in some patients diagnosed with FTD. Given that patients without bone-related symptoms may be diagnosed with FTD, TREM2 testing and skeletal survey are warranted in patients with early-onset dementia and supportive features such as white matter changes, seizures, or basal ganglia calcifications.

This study has several limitations. First, the analysis is based on a single proband, and incomplete clinical data from potentially affected family members precluded robust genotype–phenotype correlation. Notably, the proband’s mother did not undergo formal neurological evaluation, neuroimaging, or assessment for bone lesions, thereby limiting interpretation of her reported cognitive decline. Second, the use of HEK-293T cells for functional assays does not recapitulate the native microglial or osteoclast environment, and functional studies in patient-derived cells (e.g. monocytes or induced microglia) were not conducted. Although mRNA expression of the mutant was detectable in our assay, we did not directly assess nonsense-mediated mRNA decay (NMD) and therefore cannot exclude the possibility that the mutant transcript may undergo NMD in physiological contexts. Third, high-throughput sequencing data were not deposited in a public database because of patient privacy considerations and local data-sharing regulations. Finally, the literature review was descriptive and may not encompass the entire TREM2 phenotypic spectrum.

In conclusion, to the best of our knowledge, we report the first case of a Chinese family carrying a homozygous TREM2 c.257del (p.D86Afs*103) variant causing NHD. Functional evidence supports a loss-of-function effect. Our findings broaden the TREM2 mutational spectrum and highlight the importance of early genetic testing in patients with unexplained early-onset dementia, even in the absence of skeletal manifestations.

Supplemental Material

sj-pdf-1-imr-10.1177_03000605261456056 - Supplemental material for A novel homozygous TREM2 c.257del variant in a Chinese family with Nasu–Hakola disease: A case study and literature review

Supplemental material, sj-pdf-1-imr-10.1177_03000605261456056 for A novel homozygous TREM2 c.257del variant in a Chinese family with Nasu–Hakola disease: A case study and literature review by Qian Liu, Rong-Rong Lin, Pei-Rong Gao, Dian-Fu Chen and Hong-Lei Li in Journal of International Medical Research

Footnotes

Acknowledgments

We thank the patient and family members for their cooperation and participation in this study. The authors used ChatGPT AI tool for grammar and language editing during manuscript preparation.

Author contributions

Study design: Hong-Lei Li. Acquisition of data: Qian Liu, Rong-Rong Lin, Pei-Rong Gao, Dian-Fu Chen, and Hong-Lei Li. Analysis of data and drafting of the manuscript: Qian Liu. Critical revision of the manuscript: Hong-Lei Li. Study supervision: Hong-Lei Li.

Consent for publication

Written informed consent was obtained from the patient for publication of clinical information and images.

Data availability statement

The datasets generated and analyzed in this study are available from the corresponding author upon reasonable request.

Declaration of conflicting interest

The authors declare no competing interests.

Declaration of funding

None.

Ethics approval and informed consent

This study was approved by the Ethics Committee of The Second Affiliated Hospital, Zhejiang University School of Medicine (Approval No. 2015-042) and conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from the patient.

ORCID iD

Hong-Lei Li

Supplemental material

Supplemental material for this article is available online.

References

Xing

Titus

Humphrey

MB.

The TREM2-DAP12 signaling pathway in Nasu-Hakola disease: a molecular genetics perspective. Res Rep Biochem 2015; 5: 89–100.

Yeh

Hansen

Sheng

TREM2, microglia, and neurodegenerative diseases. Trends Mol Med 23: 512–533.

Lill

Rengmark

Pihlstr

; SLAGEN Consortiumet al. The role of TREM2 R47H as a risk factor for Alzheimer’s disease, frontotemporal lobar degeneration, amyotrophic lateral sclerosis, and Parkinson’s disease. Alzheimers Dement 2015; 11: 1407–1416.

Verloes

Maquet

Sadzot

, et al. Nasu-Hakola syndrome: polycystic lipomembranous osteodysplasia with sclerosing leucoencephalopathy and presenile dementia. J Med Genet 34: 753–757.

Gagnier

Kienle

Altman

; CARE Groupet al. The CARE guidelines: consensus-based clinical case reporting guideline development. Headache 2013; 53: 1541–1547.

Richards

Aziz

Bale

; ACMG Laboratory Quality Assurance Committeeet al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015; 17: 405–424.

Ghezzi

Carandini

Arighi

, et al. Evidence of CNS beta-amyloid deposition in Nasu-Hakola disease due to the TREM2 Q33X mutation. Neurology 2017; 89: 2503–2505.

Guerreiro

Lohmann

Bras

, et al. Using exome sequencing to reveal mutations in TREM2 presenting as a frontotemporal dementia-like syndrome without bone involvement. JAMA Neurol 70: 78–84.

Klunemann

Ridha

Magy

, et al. The genetic causes of basal ganglia calcification, dementia, and bone cysts: DAP12 and TREM2. Neurology 2005; 64: 1502–1507.

10.

Soragna

Papi

Ratti

, et al. An Italian family affected by Nasu-Hakola disease with a novel genetic mutation in the TREM2 gene. J Neurol Neurosurg Psychiatry 2003; 74: 825–826.

11.

Koseoglu

Tepgeç

Yetkin

, et al . Nasu-Hakola disease: a rare cause of dementia and cystic bone lesions, report of a new Turkish family. Noro Psikiyatr Ars 2018; 55: 98–102.

12.

Maderna

Visonà

Bolcato

, et al. Neuropathological Alzheimer’s disease lesions in Nasu-Hakola disease with TREM2 mutation: atypical distribution of neurofibrillary changes. J Alzheimers Dis 2021; 79: 25–30.

13.

Slattery

Beck

Harper

, et al. R47H TREM2 variant increases risk of typical early-onset Alzheimer’s disease but not of prion or frontotemporal dementia. Alzheimers Dement 2014; 10: 602–608.e4.

14.

Deczkowska

Weiner

Amit

The physiology, pathology, and potential therapeutic applications of the TREM2 signaling pathway. Cell 2020; 181: 1207–1217.

15.

Guerreiro

Bilgic

Guven

, et al. A novel compound heterozygous mutation in TREM2 found in a Turkish frontotemporal dementia-like family. Neurobiol Aging 2013; 34: 2890.e1–2891.e5.

16.

Giraldo

Lopera

Siniard

, et al. Variants in triggering receptor expressed on myeloid cells 2 are associated with both behavioral variant frontotemporal lobar degeneration and Alzheimer’s disease. Neurobiol Aging 2013; 34: 2011–2077.

17.

Le Ber

De Septenville

Guerreiro

, et al. Homozygous TREM2 mutation in a family with atypical frontotemporal dementia. Neurobiol Aging 2014; 35: 2419.e23–2423.e25.

18.

Sun

Gong

, et al. A novel homozygous mutation in TREM2 found in a Chinese early-onset dementia family with mild bone involvement. Neurobiol Aging 2020; 86: 201.e1–201.e7.

19.

Numasawa

Yamaura

Ishihara

, et al. Nasu-Hakola disease with a splicing mutation of TREM2 in a Japanese family. Eur J Neurol 2011; 18: 1179–1183.

20.

Paloneva

Manninen

Christman

, et al. Mutations in two genes encoding different subunits of a receptor signaling complex result in an identical disease phenotype. Am J Hum Genet 2002; 71: 656–662.

21.

Soares

IFZ

Christofolini

Silva

, et al. Novel variants in POLH and TREM2 genes associated with a complex phenotype of xeroderma pigmentosum variant type and early-onset dementia. Mol Genet Genomic Med 2020; 8: e1491.

22.

Barczak

Berdyński

Gabryelewicz

, et al. Behavioral variant of frontotemporal dementia in carriers of biallelic TREM2 variants: cases study. Folia Neuropathol 2024; 62: 113–119.

23.

Gilani

Bitarafan

Ozaslan

, et al. Homozygous TREM2 c.549del; p.(Leu184Serfs*5) variant causing Nasu-Hakola disease in three siblings in a consanguineous Iraqi family: case report and review of literature. Mol Genet Genomic Med 2024; 12: e2476.

24.

Sarkar

Alam

Chaudhari

Nasu-Hakola disease presenting as rapidly progressive dementia with seizures: a TREM2 mutation case without skeletal involvement. Cureus J. Med Science 2025; 17: e98664.

25.

Rashid Nezhad

Olfati

Shoeibi

, et al. Nasu-Hakola disease with stroke-like attack: a case report. Alzheimer Dis Assoc Disord 2023; 37: 168–170.

26.

Swain

Panda

Pati

, et al. Computational saturation mutagenesis to explore the effect of pathogenic mutations on extra-cellular domains of TREM2 associated with Alzheimer’s and Nasu-Hakola disease. J Mol Model 2023; 29: 360.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.26 MB