Neonatal seizures associated with a rare familial 16p11.2 microduplication: A case report

Abstract

The human 16p11.2 BP4–BP5 region, composed of low-copy repeats, is prone to mediating recurrent copy number variations that increase the risk of neurodevelopmental disorders. Compared with 16p11.2 deletion variants, duplication variants have lower penetrance and higher phenotypic heterogeneity. Due to limited perinatal data, early phenotypes warrant further investigation. We report the case of a neonate with seizures, microcephaly, and neurodevelopmental delay whose parents were phenotypically normal. Whole-exome sequencing revealed a 200.15-kb duplication in 16p11.2 seq[GRCh38]dup(16)(p11.2-p11.2) (chr16:29,963,728-30,168,686) in the proband and his mother, which was confirmed via quantitative polymerase chain reaction. This case highlights the potential link between 16p11.2 duplications and neonatal neurodevelopmental disorders, emphasizing the need for genetic counseling in affected families.

Introduction

The 16p11.2 region, located near the centromere of the short arm of human chromosome 16, comprises low-copy repeats that are prone to nonallelic homologous recombination during chromosomal recombination, resulting in recurrent copy number variations (CNVs) at different breakpoints.^1–3 CNVs in this region are primarily divided into two segments: the proximal BP4–BP5 region (approximately 600 kb) and distal BP2–BP3 region (approximately 220 kb). The proximal region includes deletion (OMIM#611913) and duplication variants (OMIM#614671). ⁴ CNVs involving the 16p11.2 BP4–BP5 region are commonly associated with developmental delay, intellectual disability, and behavioral or psychiatric disorders. Individuals with deletion variants are at increased risk of epilepsy, obesity, and macrocephaly, while those with duplication variants more frequently exhibit low body weight, microcephaly, and a lower epilepsy incidence.^5–7 The estimated incidence of CNVs in the 16p11.2 BP4–BP5 region is approximately 1 in 2000 to 1 in 2500 individuals; however, many clinicians remain unfamiliar with the full spectrum of associated phenotypes and disease progression. ¹ Moreover, rare duplication variants in this region may present with diverse clinical phenotypes, further increasing the diagnostic challenge. Herein, we report the case of a patient who experienced neonatal seizures caused by a maternally inherited 16p11.2 BP4–BP5 microduplication, in which the mother exhibited a normal phenotype. This case provides further insights into the pathogenic mechanisms of these variants in neonatal seizures.

Materials and methods

Patients

Family members were recruited from Anhui Provincial Children’s Hospital in September 2024. Clinical data, imaging findings, and genetic information were obtained from the proband. The legal guardian of the proband provided written informed consent for the publication of the clinical and genetic data. The reporting of this study conforms to the Case Report (CARE) guidelines. ⁸ The study was approved by the Medical Ethics Committee of Anhui Provincial Children’s Hospital (EYLL-2025-002).

Whole-exome sequencing

Peripheral venous blood samples were collected from the proband and both parents. Genomic DNA was isolated using the genomic DNA Extraction Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. DNA samples were fragmented and processed through adapter ligation and amplification to construct a sequencing library. Target sequences were captured using xGen Exome Research Panel v2.0 (IDT, IA, USA). Paired-end sequencing (150 bp) of the target sequences was performed using the NovaSeq 6000 high-throughput sequencing platform (Illumina, San Diego, CA, USA). The distribution frequency of the variants was examined using population databases (dbSNP, ExAC, and 1000 Genomes), and the potential pathogenicity of the variants was analyzed using prediction software (SIFT, Polyphen-2, and MutationTaster). Pathogenicity of the variants was classified based on the guidelines of the American College of Medical Genetics and Genomics. ⁹ CNVs ≥100 kb were annotated against DECIPHER, dbVar, DGV, and OMIM databases.

Quantitative polymerase chain reaction (qPCR) validation

qPCR was performed for OMIM-listed genes within the 16p11.2 segment. Specific primers for the target region were designed (Table 1), with ALB used as a reference for normal copy numbers. The relative quantification of the target genes TLCD3B, ALDOA, and TBX6 in the tested samples was performed using the 2^−ΔΔCT method.

Table 1.

Primers and conditions required for qPCR.

Primer name	Primer sequence	Size	Annealing temperature
ALB-F	CACACTTTCTGAGAAGGAGAGAC	102 bp	60°C
ALB-R	GCTTGAATTGACAGTTCTTGCTATC
ALB-F	TCTGCTCTCCTGCCTGTTCTTTAGC	137 bp	65°C
ALB-R	GCTGAAAAGCATGGTCGCCTGT
TLCD3B-exon2-F	AGATGTGGGGTCTTCCGGGAT	127 bp	65°C
TLCD3B-exon2-R	ACTGCCGGCTACATCGTCTC
ALDOA-exon3-F	CCCTGGTCATCGGGAGATGATG	162 bp	65°C
ALDOA-exon3-R	CCACGATGCGGTGAGCGATG
TBX6-exon5-F	ATGCGGGGTTGGTACTTGTG	128 bp	60°C
TBX6-exon5-R	TGGGACTCCAGGATAGGGTTG
KIF22-exon8-F	CCCCATCCTCCAATCATCTAGCC	196 bp	60°C
KIF22-exon8-R	ACATCAGGAAGGGGATACACCCAA
CORO1A-exon6-F	GACTGGCCCCGTAGGGTATGT	161 bp	65°C
CORO1A-exon6-R	ACCTGCCGCTCACTCATGC

qPCR: quantitative polymerase chain reaction.

Results

Case presentation

The patient was a 10-day-old male neonate with a head circumference of 31.2 cm (−2 SD), length of 48 cm (−1 SD), and weight of 3640 g. He was the first child and first delivery of his mother, born at 40⁺³ weeks of gestation with a birth weight of 3550 g. His Apgar score was 10 at both 1  and 5 min, with no adverse perinatal history. On the fourth day of life, the neonate developed limb twitching, presenting as bilateral upper limb tremors without significant loss of consciousness or other neurological symptoms. On the tenth day of life, the seizures worsened and were alleviated after treatment with oral phenobarbital at a dosage of 2.5 mg/kg, administered twice daily for 5 days. Amplitude-integrated electroencephalography (EEG) (aEEG) revealed discontinuity and mild amplitude abnormalities, with sleep–wake cycles lagging compared with those of age-matched controls (Figure 1). The neonatal behavioral neurological assessment score was 35, indicating a neurodevelopmental delay. Echocardiography revealed an atrial septal defect, and auditory brainstem response testing revealed failure of the left ear. Cranial magnetic resonance imaging and metabolic screening of blood and urine samples revealed no abnormalities. The father was in his late 20s and the mother was in her mid-20s; both were healthy, with no consanguinity or family history of neurodevelopmental disorders or seizures.

Figure 1.

aEEG of the patient showing that the sleep–wake cycle is delayed compared with that of age-matched controls, with an amplitude of 8–25 μV during quiet sleep and 7–20 μV during active sleep.

Genetic testing results

The results revealed a 200.15-kb copy number duplication in the 16p11.2 region in the patient and his mother, seq[GRCh38]dup(16)(p11.2-p11.2) (chr16:29,963,728-30,168,686) (Figure 2(a)). This region included three genes listed in the OMIM database (TLCD3B, ALDOA, and TBX6). To confirm the presence of this copy number duplication variant, qPCR experiments were performed, which revealed the presence of a single-copy duplication in TLCD3B, ALDOA, and TBX6 (Figure 2(b)).

Figure 2.

Variant information. (a) Schematic of the 16p11.2 copy number duplication region in the patient and (b) qPCR validation confirming the presence of a 16p11.2 duplication variant in the patient. qPCR: quantitative polymerase chain reaction.

Discussion

Rearrangements in the 16p11.2 region are primarily associated with neurodevelopmental and intellectual disabilities, behavioral abnormalities, autism spectrum disorders, psychiatric conditions, and epilepsy. ¹⁰ Although these rearrangements are linked to neurological phenotypes, duplication and deletion variants exhibit distinct differences and a “mirror effect.” ¹¹ The most notable difference is observed in the head circumference; individuals carrying duplication variants often present with microcephaly and low body weight, whereas those carrying deletion variants may present with macrocephaly and obesity.^1,12,13 In this study, we report the case of a neonate presenting with seizures and neurodevelopmental delay who carried a duplication variant in the 16p11.2 BP4–BP5 region inherited from a phenotypically normal mother.

The pathogenic mechanisms of 16p11.2 duplication variants may involve gene dosage effects on neurodevelopment and epilepsy. The BP4–BP5 region contains 26 genes (based on the DECIPHER database), of which PRRT2, KCTD13, CDIPT, SEZ6L2, ASPHD1, DOC2A, and FAM57B are highly expressed in the brain. Variations in PRRT2 expression can affect neuronal excitability and synaptic functions. Loss-of-function variants of PRRT2 are associated with three distinct autosomal dominant disorders: familial infantile convulsions with paroxysmal choreoathetosis (OMIM#602066), episodic kinesigenic dyskinesia type 1 (OMIM#128200), and benign familial infantile seizure type 2 (OMIM#605751). ¹⁴ KCTD13 expression levels may be a key factor influencing head circumference. Studies in zebrafish and mouse embryonic models have shown that the overexpression of Kctd13 leads to reduced proliferation and increased apoptosis of neuronal progenitors, resulting in microcephaly, whereas Kctd13 deficiency leads to macrocephaly. ¹⁵ This indicated that KCTD13 regulates head circumference by modulating the proliferation and apoptosis of neuronal progenitors. However, there is currently a lack of human genotype–phenotype correlation studies for this gene. Additionally, deletion of KIF22 and TBX6 in the 16p11.2 region is associated with spondyloepimetaphyseal dysplasia with joint laxity type 2 (OMIM#603546) and spondylocostal dysostosis type 5 (OMIM#122600).^1,16,17 In contrast, only a few studies have reported on arthritic or skeletal deformities in individuals with 16p11.2 duplication variants, highlighting the unique pathogenic mechanisms of these duplications.^5–7

Although 16p11.2 rearrangements are significantly associated with epilepsy, with approximately 15% of duplication and 18% of deletion variant carriers experiencing at least one seizure, neonatal-onset seizures require special attention. ⁵ In this patient, the neonate exhibited focal seizures at 10 days of age, accompanied with microcephaly. Bedoyan et al. also reported the case of a patient with neonatal seizures on the first day of life, with a de novo microduplication of approximately 598 kb in the 16p11.2 region, which later progressed to spastic paraplegia, refractory epilepsy, severe global developmental delay, hypotonia, and microcephaly. ¹⁸ The clinical features of neonatal seizures can be classified as focal (e.g. unilateral limb twitching and eye deviation), multifocal (twitching in multiple alternating sites), generalized (tonic–clonic seizures), or subclinical (only EEG abnormalities). ¹⁹ Video EEG (vEEG) is the gold standard for disease monitoring that distinguishes epileptic from nonepileptic events. However, vEEG requires specialized equipment and analysts, and many neonatal intensive care units cannot perform 24-hour monitoring. aEEG can serve as an alternative technique for monitoring high-risk neonates. ²⁰ In this study, although aEEG indicated an abnormal amplitude in the neonate, its resolution was low and it could not provide detailed EEG features. Therefore, it is necessary to combine the data on clinical progression and vEEG monitoring to further clarify the disease characteristics.

The phenotypic heterogeneity of 16p11.2 rearrangements poses challenges for treatment and genetic counseling.^1,5,10 In terms of treatment, the seizures in this patient were controlled with phenobarbital; however, it is important to note that traditional antiepileptic drugs may be limited in the treatment of epilepsy associated with 16p11.2 rearrangements. Early initiation of a ketogenic diet (KDT) may be an alternative option for patients with refractory epilepsy. Armeno et al. showed that 73.7% of infants aged <3 months had a ≥50% reduction in seizures after 1 month of KDT treatment. ²¹ However, close monitoring for adverse effects such as hyperlipidemia and metabolic acidosis is necessary. ²² In genetic counseling, de novo variants occur in approximately 93% of 16p11.2 BP4–BP5 deletions, while this rate is approximately 25% for duplications. Parents carrying duplication variants may exhibit mild or no phenotypic manifestations; however, their offspring may present with severe symptoms. For example, the neonate inherited a 16p11.2 BP4–BP5 duplication variant from his phenotypically normal mother.^1,12,13,23 This suggests that the offspring of asymptomatic carrier parents should be considered at high risk for neurodevelopmental disorders, and baseline screening with vEEG or aEEG should be strengthened in clinical practice.

In summary, we reported the case of a Chinese family with a 16p11.2 BP4–BP5 duplication variant, in which the proband exhibited seizures and reduced head circumference during the neonatal period. Our findings highlight the importance of considering 16p11.2 rearrangements in early-life neurodevelopmental disorders.