Sage Journals: Discover world-class research

Abstract

Objective:

Expression of the Cacna1c (calcium channel, voltage-dependent, Ltype, a1C subunit) gene was studied to investigate the relationship between oxidative stress and L-type calcium channels in the myocardium of seleniumdeficient mice.

Methods:

Selenium levels in liver and heart tissue samples from mice fed normal or selenium-deficientdiets were evaluated by fluorometry. In the same mice, glutathione peroxidase (GPx) and Cacna1c gene expression were analysed, malondialdehyde (MDA) content and superoxide dismutase (SOD) activity were measured, oxidoreductase gene expression profiles were analysed (by DNA microarray), and myocardial structural changes were studied.

Results:

In selenium-deficient versus control mice, GPx expression and SOD activity were decreased, and Cacna1c expression and MDA concentration were increased. Selenoprotein oxidoreductase and nonselenoprotein oxidoreductase gene expression differed significantly between selenium-deficient and control mice. In selenium-deficient mice, myocardial fibres were separated by loose collagenous tissue; electron microscopy showed shortened sarcomeres, dilated sarcoplasmic reticulum, scattered myofibril lysis and increased mitochondria with amorphous matrix densities.

Conclusion:

L-type calcium channels were involved in selenium deficiency-induced cardiomyocyte injury, which was positively related to oxidative stress.

Keywords

L-type calcium channels Mice Oxidative stress Selenium deficiency Ventricular myocardium

Introduction

Selenium is an essential trace element; low selenium levels in humans are linked to an increased risk of heart disease.¹ Selenium research has attracted tremendous interest because of the important role of antioxidant selenoproteins in providing protection against oxidative stress initiated by excess reactive oxygen species (ROS).² Daily requirements for selenium have been established in many countries because of the high potential for selenium-deficient disease. The L-type calcium channels play an important role in the normal physiological characteristics of cardiac myocytes, and alterations in the density or function of L-type calcium channels have been implicated in many cardiovascular diseases (including atrial fibrillation, heart failure and ischaemic heart disease).^3,4 Accordingly, there may be a relationship between cardiovascular disease and patho -physiological changes in calcium homeostasis modulated by oxidative stress. Research has shown that deregulation of calcium through L-type calcium channels plays a crucial role in the pathogenesis of cell death, which results in calcium overload and eventually leads to cardiomyocyte injury.⁵ Nevertheless, considerable uncertainty remains about whether L-type calcium channels are involved in cardiomyocyte damage induced by oxidative stress, and the degree to which the abundance and function of the L-type calcium channels are affected by oxidative stress. The present study assessed the relationship between oxidative stress and L-type calcium channel levels in the myocardium, using a selenium-deficient mouse model.

Materials and methods

Experimental Animal Model of Selenium Deficiency

The animal model of selenium deficiency was established according to the method of Vanderlelie et al.⁶, with slight modifications. The basal diet of the mice was low in selenium, containing 47% low-selenium yeast, 42% sucrose, 5% coconut oil, 5% premixed minerals and 1% premixed vitamins. Adult male and female C57BL/6 mice weighing 20 – 25 g (10 weeks old) were housed in a pathogen-free environment at room temperature (22 – 25 °C) and maintained on the basal diet and tap water ad libitum before the selenium-deficient state was achieved. Animals were divided into six groups (n = 6 per group). Mice in selenium-deficient groups were then fed a special mouse food that contained 4.5 μg/kg total selenium for 4, 12 or 24 weeks (groups SD-4w, SD-12w and SD-24w, respectively); control mice were fed standard mouse food containing 219 μg/kg total selenium for 4, 12 or 24 weeks (groups Ctr-4w, Ctr-12w and Ctr-24w, respectively). At 4, 12 or 24 weeks, mice were sacrificed by severing the spinal cord. The heart, liver, brain and kidneys were perfused with ice-cold physiological saline (0.9% NaCl) until the blood was sufficiently removed; These organs were retained (and stored in ice-cold conditions) for use in the following experiments.

Animal protocols were reviewed and approved by the Animal Care and Ethics Committee of the Harbin Medical University, Harbin, China.

Measurement of Selenium Content

The selenium content of the heart and liver (300 mg tissue per sample) was measured by hydride generation atomic fluorescence spectrometry at 4, 12 and 24 weeks in the selenium-fed and control groups. Hydride was generated with a model 10.004 hydride generator (PS Analytical, Orpington, UK) according to the manufacturer's instructions. Signals from the spectrometer were acquired with a microcomputer using commercial software (Avalon 2.0; PS Analytical). All solutions were prepared with doubly deionized water with 18.2 MΩcm resistance. Selenium stock solutions (1000 mg/l) were prepared from selenite (Na₂SeO₃ 99%), selenate (Na₂ SeO₄ 99%), seleno-DL-cystine (SeCys), seleno-DL-methionine (SeMet) (all from Sigma-Aldrich, St Louis, MO, USA) and trimethylselenonium iodide (TMeSeI; Organometallics, Hampstead, NH, USA). SeCys and SeMet were weighed under nitrogen to prevent sample degradation and dissolved in 0.5% (v/v) hydrochloric acid.

Measurement of Sod Activity and MDA Content

Heart, liver, brain and kidney tissue (100 mg tissue per sample) were each homogenized with a 5-fold v/w of cell lysate in ice. The homogenates were centrifuged at 850 g for 15 min and their supernatants were stored at -80 °C until assayed for superoxide dismutase (SOD) activity. Determination of total (Cu/Zn and Mn) SOD activity was based on the inhibition of the rate of nitroblue tetrazolium (NBT) reduction, with the xanthine–xanthine oxidase system as a superoxide generator, using reagents from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) according to the manufacturer's instructions. SOD activity was assessed spectrophotometrically at 550 nm. For the determination of MDA content, homogenates were bathed in distilled water for 15 min at 100°C, then cooled to room temperature and centrifuged for 10 min at 1000 g . Then, 200 μl of supernatant was used to measure MDA levels using a commercially available kit (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's recommended protocol. Absorbance of the supernatant was measured at 532 nm.

Histopathology and Ultrastructural Analysis of Hearts

A portion of the heart, liver, brain and kidney (50 mg tissue samples of each) from each animal was frozen rapidly in liquid nitrogen (temperature –190 °C) for later enzyme and RNA analysis. One-half of the heart, cut longitudinally, was placed in formalin, embedded in paraffin wax, sectioned (6 μm) and stained with haematoxylin and eosin. Selected samples were fixed with 2.5% glutaraldehyde in 0.1 M phosphate-buffered saline (PBS; pH 7.4). Specimens were then rinsed in 0.1 M PBS, postfixed in PBS-buffered 1% osmium tetroxide for 1 – 2 h, stained en bloc in uranyl acetate, dehydrated in ethanol and embedded in epoxy resin using standard procedures. Ultrathin sections were electron-stained and observed under an electron microscope (JEM-1220; Jeol, Tokyo, Japan).

cDNA Microarray Analysis of Selenoprotein Oxidoreductase Genes

Heart tissue (300 mg per sample) from mice in selenium-fed and control groups sacrificed at 4, 12 and 24 weeks was used to carry out the cDNA microarray analysis at Shanghai Biochip Co. Ltd (Shanghai, China) according to the company's standard protocols. Expression of the selenoprotein oxidoreductase genes Selh (also known as 2700094K13Rik; selenoprotein H), Gpx1 (glutathione peroxidase 1) and Selw (selenoprotein W), and of the nonselenoprotein oxidoreductase genes Scd1 (stearoyl-Coenzyme A desaturase 1), Cdo1 (cysteine dioxidase 1), Ndufs6 (NADH dehydrogenase) and Cyp2e1 (cytochrome P450, family 2, subfamily e, polypeptide 1) was evaluated using a gene chip (Shanghai Biochip Co. Ltd) according to the manufacturer's instructions.

Quantitative RT–PCR Analysis of Cacna1c Gene

Expression of the Cacna1c (calcium channel, voltage-dependent, L-type, α1C subunit) gene and the Gpx1 gene in mice from selenium-deficient and control groups was assessed using a quantitative reverse transcription– polymerase chain reaction (RT–PCR) to measure the abundance of mRNA relative to a housekeeping gene (glyceraldehyde 3-phosphate dehydrogenase [Gapdh]).

Total RNA from mouse ventricular myocardium (50 – 100 mg tissue per sample, n = 6 per diet group) was isolated using the guanidinium isothiocyanate method, with TRIzol^® Reagent (Invitrogen, Carlsbad, CA, USA), following the manufacturer's instructions. RNA (1 μg) was reverse-transcribed to cDNA using the high-capacity cDNA Reverse Transcription kit (Insert P/N4375222 REV B; Applied Biosystems, Foster City, CA, USA), following the manufacturer's instructions.

Gene-specific primers were designed to span an intron and the following oligonucleotide primers, designed using Primer 6.0 (PREMIER Biosoft International, Palo Alto, CA, USA) were used: Cacna1c, forward GTCCAGAAGCTTCCAGA, reverse GATGTTCACTGAGACCAAGA; Gpx1, forward CAGTTCGGACATCAGGAGAAT, reverse AGAGCGGGTGAGCCTTCT; Gapdh forward CGACCCCTTCATTGACCTCA, reverse TTGACTGTGCCGTTGAACTTG. The 20-μl real-time PCR reactions contained 10 ng cDNA, 0.2 mM gene-specific forward and reverse primers, and 1 × SYBR^® Green PCR Master Mix (Insert P/N4309158 REV B; Applied Biosystems). The PCR was performed using an ABI 9700 system (Applied Biosystems) with an initial stage of 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and elongation at 60 °C for 30 s. A dissociation curve was run for each plate to confirm the production of a single product. The amplification efficiency for each gene was determined using the DART (Data Analysis for Real-Time PCR, ABI 7500, Version 1.4.1; Applied Biosystems) program.⁷ The relative abundance of each mRNA was calculated as described by Pfaffl,⁸ accounting for gene-specific efficiencies, normalized to Gapdh levels, and expressed relative to the mean of the normal group.

Western Blot Analysis of L-Type Calcium Channel α1C

Protein levels of the L-type calcium channel α1C subunits in selenium-deficient and control groups were assessed using Western blot analysis. To isolate whole heart membrane protein fractions, ventricular myocardium (100 mg tissue per sample) was homogenized in radioimmunoprecipitation lysis buffer with a protease inhibitor, and the homogenized tissue was centrifuged at 4 °C (5 min, 1000 g ). The protein concentration was assayed with a bicinchoninic acid assay (BCA Kit; Beyotime Institute of Biotechnology, Jiangsu, China). Proteins were denatured in sodium dodecyl phosphate loading buffer: 80 mg protein was loaded on an 8% polyacrylamide running gel and a 5% stacking gel, which were then transferred to a polyvinylidine difluoride membrane (Millipore, Bedford, MA, USA). Membranes were blocked in 5% dry milk for 2 h at room temperature. For immuno -detection, membranes were incubated with a primary antibody (L-type Ca²⁺ CP 1C [A-20] antibody, sc-16230, 1:500 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, USA) or anti-Gapdh antibody (ab9485, 1:500 dilution; Abcam plc, Cambridge, UK) overnight at 4 °C, and with a secondary antibody (donkey antigoat immunoglobulin G–horseradish peroxidase, sc-2020, 1:10 000; Santa Cruz Biotechnology) for 2 h at room temperature. Membranes were washed three times at each stage for 10 min using 1x Tris-buffered saline (pH 7.6). Immunoreactive bands were visualized on X-ray film using a chemiluminescence method (Kodak [China] Ltd, Shanghai, China). Band densities in the selenium-deficient and control groups were quantified, relative to GAPDH levels, by densitometry using the Gel Doc™ XR Gel Documentation System and Quantity One^® software (Bio-Rad, Hercules, CA, USA).

Statistical Analyses

Statistical analyses were performed using the GraphPad Prism^® 5.0 (GraphPad Software, La Jolla, CA, USA). Data were presented as mean ± SD. Statistical significance was determined using Student's t-test. To compare treatments, the statistical significance was calculated by one-way analysis of variance followed by Tukey's multiple comparison test. The expression difference score (DiffScore) was calculated to take into account background noise and sample variability.⁹ A P-value < 0.05 was considered to be statistically significant.

Results

Selenium concentrations in the liver for the selenium-deficient groups were 50, 56 and 81% lower (Fig. 1A), and in ventricular myocardium were 37, 40 and 48% lower (Fig. 1B), than their corresponding controls (P < 0.01, each comparison). Levels of Gpx1 mRNA in the selenium-deficient groups were ∼30 (P < 0.05), ∼60 (P < 0.01) and ∼70% (P < 0.01) lower than in their corresponding controls (Fig. 1C). MDA concentrations in heart, liver, brain and kidney were significantly higher (Fig. 1D), and SOD activity significantly lower (Fig. 1E), in the selenium-deficient groups compared with their corresponding controls (P < 0.05 or P < 0.01 for all comparisons).

FIGURE 1:

Selenium status, Glutathione peroxidase (GPx) 1 mRNA level and oxidative stress in mice fed selenium-deficient diets (4.5 μg total selenium per kg mouse food) for 4 (SD-4w), 12 (SD-12w) or 24 weeks (SD-24w) and control mice fed normal diets (219 μg total selenium per kg mouse food) for 4 (Ctrl-4w), 12 (Ctrl-12w) or 24 weeks (Ctrl-24w). Selenium concentrations in (A) liver and (B) ventricular myocardium of selenium-deficient and control mice. (C) Gpx1 mRNA in ventricular myocardium relative to the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (Gapdh). (D) Malondialdehyde (MDA) concentration in the heart, and (E) superoxide dismutase (SOD) activity in heart, liver, brain and kidney tissue from selenium-deficient and control mice. Data presented as mean ± SD; *P < 0.05, **P < 0.01, Student's t-test and one-way analysis of variance followed by Tukey's multiple comparison test

DiffScore data indicated differences between selenium-deficient and control groups in the expression of selenoprotein oxidoreductase (Selh, Gpx1 and Selw) and nonselenoprotein oxidoreductase (Scd1, Cdo1, Ndufs6, Cyp2e1) genes (Table 1).

TABLE 1:

DiffScores for genome-wide expression profile analysis of selenoprotein and oxidoreductase genes in mice fed selenium-deficient diets for 4 (group SD-4w) or 12 weeks (group SD), compared with control mice fed normal diets for 4 or 12 weeks

	Selenoprotein oxidoreductase genes				Nonselenoprotein oxidoreductase genes
Group	Selh	Gpx1	Selw	Scd1	Cdo1	Ndufs6	Cyp2e1
SD-4w	-6.68	-5.72	-19.78	-7.04	0.40	-5.74	-26.30
SD-12w	-55.91	-31.04	-65.89	-71.08	-54.40	-31.57	-60.30

DiffScores > 20 represent upregulation of the gene in SD group compared with corresponding control group; DiffScores ≤ 20 represent downregulation.

Compared with their normal-diet counterparts, myocardial fibres were separated by loose collagenous tissue in the selenium-deficient groups, as shown by haematoxylin and eosin staining (Fig. 2). Transmission electron microscopy showed shortened sarcomeres, a dilated sarcoplasmic reticulum, scattered myofibril lysis and increased numbers of mitochondria with amorphous matrix densities in selenium-deficient groups (Fig. 3). Compared with control groups, selenium-deficient groups showed significantly greater levels of Cacna1c mRNA (P < 0.05) and protein (P < 0.01) (Fig. 4).

FIGURE 2:

Haematoxylin and eosin staining of myocardia in mice fed selenium-deficient diets (4.5 μg total selenium per kg mouse food) for 4 (SD-4w), 12 (SD-12w) or 24 weeks (SD-24w) and control mice fed normal diets (219 μg total selenium per kg mouse food) for 4 (Ctrl-4w), 12 (Ctrl-12w) or 24 weeks (Ctrl-24w). (A) Ctrl-4w, (B) Ctrl-12w, (C) Ctrl-24w, (D) SD-4w, (E) SD-12w, (F) SD-24w

FIGURE 3:

Myocardial damage revealed by transmission electron microscopy in mice fed selenium-deficient diets (4.5 μg total selenium per kg mouse food) for 4 (SD-4w), 12 (SD-12w) or 24 weeks (SD-24w) and control mice fed normal diets (219 μg total selenium per kg mouse food) for 4 (Ctrl-4w), 12 (Ctrl-12w) or 24 weeks (Ctrl-24w). Ultrastructure of myocardium in: (A) Ctrl-4w, (B) Ctrl-12w, (C) Ctrl-24w, (D) SD-4w, (E) SD-12w, (F) SD-24w. Thick arrows indicate significantly increased numbers of mitochondria with amorphous matrix densities; intermediate arrows indicate shortened sarcomeres; thin arrows indicate dilated sarcoplasmic reticulum

FIGURE 4:

Cacna1c (calcium channel, voltage-dependent, L-type, α1C subunit) mRNA and protein levels in mice fed selenium-deficient diets (4.5 μg total selenium per kg mouse food) for 4 (SD-4w), 12 (SD-12w) or 24 weeks (SD-24w) and control mice fed normal diets (219 μg total selenium per kg mouse food) for 4 (Ctrl-4w), 12 (Ctrl-12w) or 24 weeks (Ctrl-24w). (A) Cacna1c mRNA shown as a ratio relative to the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (Gapdh). (B) Western blot analysis of Cacna1c protein (left) and quantitative analysis of Cacna1c protein ratio relative to Gapdh band optical intensities determined by densitometry. Data presented as mean ± SD; *P < 0.05, **P < 0.01, Student's t-test and one-way analysis of variance followed by Tukey's multiple comparison test

Discussion

The present study demonstrated that selenium deficiency increased ROS levels in the mouse myocardium: an effect that was positively related to upregulation of genes and proteins involved in the L-type calcium channels. Moreover, myocardial damage was apparent in selenium-deficient groups, as revealed by histopathological and ultrastructural studies. These results suggested that ROS and the L-type calcium channels are involved in cardiomyocyte injury induced by selenium deficiency.

The known functions of selenium as an essential element in animals have been attributed to a number of mammalian selenoproteins.^10,11 Keshan disease (a dilated cardiomyopathy endemic in China, characterized by heart failure and severe cardiomyopathy, usually with arrhythmia, congestive heart failure and varying degrees of pathological change) was found to be closely related to a selenium-deficient diet.^12,13 Voltage-gated calcium channels are thought to control a large number of calcium-dependent responses in electrically excitable cells.¹⁴ Studies have shown that alterations in the density or function of the L-type calcium channels and increases in cellular ROS are involved in a variety of cardiovascular diseases.^15,16

A selenium-deficient diet can induce oxidative injury, which may lead to myocardial injury and subsequent cardiac dysfunction,¹⁷ and evidence shows that selenium deficiency can increase calcium overload.^18,19 Furthermore, myocardial calcium overload may cause myocardial failure.^20,21 Oxidative stress leads to lipid peroxidation, and sulphydryl group oxidation seems to be among the mechanisms that may produce membrane defects, causing intracellular calcium overload and cardiac contractile dysfunction in the myocardium.²² A change in the properties of the L-type calcium channel may be related directly to the structure of the channel or to the number of channels, both of which are regulated by Cacna1c, although this remains to be determined. There are no reports of a correlation between selenium deficiency and L-type calcium channels in the hearts of people with Keshan disease or selenium-deficient experimental animals. Thus, we surmised that calcium overload may lead to a myocardial disease in mice that is similar to Keshan disease in humans, which may be caused by upregulation of the Cacna1c gene.

Mice in selenium-deficient groups in the present study had significantly lower concentrations of selenium in the liver and heart compared with control groups (receiving the normal mouse diet). It is hoped that this model of selenium deficiency, established in C57BL/6 mice, will help researchers to obtain detailed information about heart disease in people with selenium deficiency: gene sequences of the C57BL/6 mouse are believed to be relatively close to the corresponding human gene sequences.

Myocardial damage indicative of severe and general heart damage was observed in histopathological and ultrastructural studies in selenium-deficient mice, in the present study. SOD activity and MDA concentrations were measured as indicators of oxidative stress. Severe oxidative stress was found in several organs in the selenium-deficient groups, indicating that this constituted a good animal model of oxidative stress: one that could be useful in investigating the relationship between selenium deficiency and the L-type calcium channels. Subjecting mice to a long period (24 weeks) of low-selenium supply intensified oxidative stress, and this effect was accompanied by upregulation of the Cacna1c gene. We plan to investigate whether there is link between myocardial injury in selenium-deficient mice and heart disease in patients with Keshan disease.

One possible explanation for the mechanism by which selenium deficiency induces cardiac dysfunction is that selenium is a component of selenium-dependent Gpx, which catalyses the reduction of hydrogen and lipid peroxides.^23,24 It is possible that selenium deficiency might lead to low selenoprotein and oxidoreductase activity, as a result of the downregulation of selenoprotein and oxidoreductase genes (see Table 1), and may lead to the accumulation of lipid peroxides. In the hearts of experimental animals, selenium deficiency is known to increase the accumulation of lipid peroxidation products²⁵ and oxygen exposure.²⁶ Secondly, selenium deficiency enhances lipid peroxidation, which may be involved in cell membrane damage. Lipid peroxidation could lead to cardiac dysfunction and an increase in intracellular free-calcium concentration (calcium overload) by impairment of the calcium transport system. Calcium overload induces irreversible cardiac injury.²⁷ Thus, the balance of ROS and the cell redox state appear to be important in the mechanism of heart failure. ROS appears to be elevated in heart failure and this increase is accompanied by significant impairments in the number and function of calcium-related proteins.²⁸ During a state of high oxidative stress induced by a low-selenium diet, the antioxidant defence function may decline. An excess of oxygen free radicals can damage the membrane of myocardial cells.²⁹ A low-selenium status in mice was a significant contributory factor to the development of oxidative stress caused by compromised selenium-dependent Gpx expression. A depressed circulating level of selenium affects antioxidant defence systems in humans and also results in high oxidative stress.²

In conclusion, the change in the expression pattern of the Cacna1c gene observed in the present study might be caused mainly by the accumulation of ROS under oxidative stress in a selenium-deficient mouse model.

Footnotes

Acknowledgements

This work was supported by grants from the National Nature Science Foundation of China (Nos 30771863, 81172616) and the Science & Technology Innovation Foundation of Harbin (No. 2008RFXXS019).

The authors had no conflicts of interest to declare in relation to this article.

References

Fleming

, Lie

, McCall

: Selenium deficiency and fatal cardiomyopathy in a patient on home parenteral nutrition. Gastroenterology 1982; 83: 689–693.

Fryer

: Rationale for clinical trials of selenium as an antioxidant for the treatment of the cardiomyopathy of Friedreich's ataxia. Med Hypotheses 2002; 58: 127–132.

, Kogan

, Gergen

: Vitamin-mineral supplement use among preschool children in the United States. Pediatrics 1997; 100: E4.

Aggarwal

, Boyden

: Diminished Ca2+ and Ba2+ currents in myocytes surviving in the epicardial border zone of the 5-day infarcted canine heart. Circ Res 1995; 77: 1180–1191.

Eefting

, Rensing

, Wigman

: Role of apoptosis in reperfusion injury. Cardiovasc Res 2004; 61: 414–426.

Vanderlelie

, Venardos

, Perkins

: Selenium deficiency as a model of experimental pre-eclampsia in rats. Reproduction 2004; 128: 635–641.

Peirson

, Butler

, Foster

: Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res 2003; 31: e73.

Pfaffl

: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001; 29: e45.

Fan

, Chee

, Gunderson

: Highly parallel genomic assays. Nat Rev Genet 2006; 7: 632–644.

10.

Rayman

: The importance of selenium to human health. Lancet 2000; 356: 233–241.

11.

Zeng

, Combs

Jr : Selenium as an anticancer nutrient: roles in cell proliferation and tumor cell invasion. J Nutr Biochem 2008; 19: 1–7.

12.

Hou

, Wang

, Liu

: Suboptimal selenium supply - a continuing problem in Keshan disease areas in Heilongjiang province. Biol Trace Elem Res 2011; 143: 1255–1263.

13.

Oster

, Prellwitz

: Selenium and cardiovascular disease. Biol Trace Elem Res 1990; 24: 91–103.

14.

Striessnig

, Koschak

, Sinnegger-Brauns

: Role of voltage-gated L-type Ca2+ channel isoforms for brain function. Biochem Soc Trans 2006; 34: 903–909.

15.

Sabri

, Hughie

, Lucchesi

: Regulation of hypertrophic and apoptotic signaling pathways by reactive oxygen species in cardiac myocytes. Antioxid Redox Signal 2003; 5: 731–740.

16.

Nakagami

, Takemoto

, Liao

: NADPH oxidase-derived superoxide anion mediates angiotensin II-induced cardiac hypertrophy. J Mol Cell Cardiol 2003; 35: 851–859.

17.

Spallholz

: Selenium and glutathione peroxidase: essential nutrient and antioxidant component of the immune system. Adv Exp Med Biol 1990; 262: 145–158.

18.

Chareonpong-Kawamoto

, Yasumoto

: Selenium deficiency as a cause of overload of iron and unbalanced distribution of other minerals. Biosci Biotechnol Biochem 1995; 59: 302–306.

19.

Zhang

, Tan

, Yu

: Effect of selenium and iodine levels on calcium overload and actin expression in rat liver. Acta Nutrimenta Sinica 2007; 29: 27–30.

20.

Kondratiev

, Wold

, Aasum

: Myocardial mechanical dysfunction and calcium overload following rewarming from experimental hypothermia in vivo. Cryobiology 2008; 56: 15–21.

21.

Sugishita

, Asakawa

, Usui

: A case of iron overload cardiomyopathy: beneficial effects of iron chelating agent and calcium channel blocker on left ventricular dysfunction. Int Heart J 2009; 50: 829–838.

22.

Dhalla

, Golfman

, Takeda

: Evidence for the role of oxidative stress in acute ischemic heart disease: a brief review. Can J Cardiol 1999; 15: 587–593.

23.

Handy

, Zhang

, Loscalzo

: Homocysteine down-regulates cellular glutathione peroxidase (GPx1) by decreasing translation. J Biol Chem 2005; 280: 15518–15525.

24.

Diplock

: Antioxidant nutrients and disease prevention: an overview. Am J Clin Nutr 1991; 53 (suppl): 189S–193S.

25.

Ferrari

, Ceconi

, Curello

: Oxygen-mediated myocardial damage during ischaemia and reperfusion: role of the cellular defences against oxygen toxicity. J Mol Cell Cardiol 1985; 17: 937–945.

26.

Garlick

, Davies

, Hearse

: Direct detection of free radicals in the reperfused rat heart using electron spin resonance spectroscopy. Circ Res 1987; 61: 757–760.

27.

Choudhary

, Dudley

Jr : Heart failure, oxidative stress, and ion channel modulation. Congest Heart Fail 2002; 8: 148–155.

28.

Loguercio

, Federico

: Oxidative stress in viral and alcoholic hepatitis. Free Radic Biol Med 2003; 34: 1–10.

29.

Abul

, Mathew

, Dashti

: Level of superoxide dismutase, glutathione peroxidase and uric acid in thioacetamide-induced cirrhotic rats. Anat Histol Embryol 2002; 31: 66–71.

Correlation between Oxidative Stress and L-type Calcium Channel Expression in the Ventricular Myocardia of Selenium-deficient Mice