Sage Journals: Discover world-class research

Abstract

Objectives:

To investigate the effect of mechanistic target of rapamycin (mTOR)-specific small interfering RNA (siRNA) and rapamycin on tumour size and levels of hypoxia inducible factor 1α (HIF-1α), vascular endothelial growth factor (VEGF) and mTOR proteins, and mTOR mRNA, in a mouse xenograft model of human oesophageal carcinoma.

Methods:

Tumours were induced in BALB/c nude mice using the human oesophageal squamous cell carcinomacell line, EC1, injected subcutaneously. Animals were divided into four treatment groups (n = 5 per group) after 7 days:control (phosphate buffered saline, daily intraperitoneal [i.p.] injection); 50 μg/kg rapamycin, daily i.p. injection; 3 μg/kg mTOR siRNA, daily i.p. injection;combined mTOR siRNA and rapamycin, daily i.p. injections. Tumour volume was measured 21 days after xenograft. Levels of mTOR, VEGF and HIF-1α were assessed via immunohisto chemistry and in situ hybridization.

Results:

mTOR siRNA and/or rapamycin significantly decreased tumour volume and levels of HIF-1α, VEGF and mTOR protein, and mTOR mRNA. Combination treatment was significantly more effective than either treatment alone.

Conclusions:

mTOR siRNA and/or rapamycin inhibited the growth of oesophageal carcinoma in vivo. This may represent a novel and effective treatment strategy for oesophageal carcinoma.

Keywords

EC1 cells Hypoxia inducible factor 1a Mechanistic target of rapamycin Mouse xenograft model Oesophageal cancer Rapamycin Small interfering RNA Vascular endothelial growth factor

Introduction

The mechanistic target of rapamycin (serine/threonine kinase) (MTOR) gene encodes an evolutionarily conserved 289 kDa protein kinase that is involved in several physiological and pathological processes.¹ MTOR has important roles in normal cell growth and differentiation, as well as in cancer cell growth and proliferation.^2,3 The macrolide antibiotic rapamycin is a specific inhibitor of mTOR⁴ and has antineoplastic effects that may be useful in the treatment of kidney, breast, nonsmall cell lung cancers and other tumour types.^5–10 The use of rapamycin for oesophageal cancer treatment has not been reported, however.

Hypoxia inducible factor 1α (HIF-1α) is a key transcription factor in the cellular response to hypoxia and is closely associated with tumour angiogenesis.^11–13 This angiogenic effect may be mediated by the induction of vascular endothelial growth factor (VEGF) gene expression.¹⁴ RNA interference (RNAi) is a method of post-transcriptional gene silencing that uses short double-stranded RNA (siRNA) to inactivate specific gene sequences at the mRNA level.^15,16 RNAi represents a promising strategy for the treatment of viral infections or tumours.^17,18

The aim of the present study was to investigate the effect of a combination of rapamycin and mTOR siRNA on mTOR mRNA and mTOR, VEGF and HIF-1α proteins, in a mouse xenograft model of oesophageal cancer.

Materials and methods

Cell Culture

The human oesophageal squamous cell carcinoma cell line EC1 was kindly provided by Dr Shihua Cao, Department of Pathology, Hong Kong University, Hong Kong, China. Cells were cultured in RPMI 1640 medium (Sijiqing Company, Beijing, China) supplemented with 10% fetal bovine serum (Hyclone Laboratories, Logan, UT, USA), 100 IU/ml penicillin and 100 μg/ml streptomycin, at 37 °C, in 5% carbon dioxide in air.

Animals

Female BALB/c nude mice (20 mice, aged 4 weeks, 18 – 21 g; Slack Laboratory Animals, Shanghai, China) were housed in sterile conditions at 26 – 28°C and 40 – 60% relative humidity, with free access to food and water, in a 13-h light/11-h dark cycle. The study was carried out at the Department of Oncology and Department of Pathology, First Affiliated Hospital, Zhengzhou University, Zhengzhou, China, in strict accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.¹⁹ The study was also reviewed and approved by the Institutional Animal Care and Use Committee of Zhengzhou University.

MTOR SIRNA

The DNA templates were designed for the MTOR gene (NM-004958.3) and synthesized by Beijing Bioko Biotechnology, Beijing, China. The sequences were: 5′-GGATC CTAATACGACTCACTATAGGCAGATTTGCC AACATC-3′; 5′-AAGATAGTTGGCAAATCTGC CTATAGTGAGTCGTATTAGGATCC-3′; 5′-GG ATCCTAATACGACTCACTATAGACATCGCT GAAGTCAC-3′ and 5′-ACAAGTGTGACTTCA GCGATGTCTATAGTGAGTCGTATTAGGATCC -3′. These templates were used for the synthesis of two mTOR siRNA fragments with a T7 RiboMAX™ Express RNAi System (Promega, Madison, WI, USA). The length and concentration of siRNA were measured by agarose gel electrophoresis and spectrophotometric analysis, respectively, using template DNA as the reference.

siRNA selection

The siRNA with the greatest interference effect was selected via a preliminary experiment. Briefly, EC1 cells were transfected with one of two mTOR siRNAs using lipofection (Lipofecter liposome; Beyotime Biotech, Jiangsu, China), according to the manufacturer's instructions. Parallel nontransfected cultures were used as controls. After 24 h, cell proliferation was quantified via MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay. Cells were seeded into 96-well plates at 5 × 10³ cells (100 μl/well) and cultured for 24 h, after which the culture medium was replaced with an equal volume of serum-free medium. After a further 42 h, 10 μl of the culture medium was replaced with an equal volume of fresh medium containing 5 g/l MTT. Cultures were incubated for a further 6 h, then terminated by the addition of 20% sodium dodecyl sulphate (100 μl/well). The absorbance at 570 nm was determined using a microplate spectrophotometer, and cell proliferation was calculated as optical density_experimental _group/ optical density_control _group. The mTOR siRNA with the strongest growth inhibitory effect was selected for further experiments.

Mouse Model

The EC1 cells (0.2 ml; 1 × 10⁷ cells/ml) were injected subcutaneously into mice. After 1 week, the animals were divided into four groups (n = 5 per group): control (1 ml of 0.01 M phosphate-buffered saline [PBS], pH 7.2, daily intraperitoneal [i.p.] injection); rapamycin (50 μg/kg rapamycin daily i.p. injection); mTOR siRNA (3 μg/kg mTOR siRNA daily i.p. injection); combined treatment (3 μg/kg mTOR siRNA plus 50 μg/kg rapamycin daily i.p. injection); rapamycin treatment began on day 2 (combined treatment group only) and continued for 2 weeks. All i.p. injections were of equal volume (1 ml). Mice were sacrificed 2 weeks after treatment and tumours were dissected and measured using calipers. Tumour volume was calculated as 0.5 (length × width²).

Immunohistochemistry

Tissue samples were fixed in 10% formalin, embedded in paraffin wax and cut into 4-μm thick sections. Immunohistochemistry for mTOR, VEGF and HIF-1α protein was performed using the PV9000 immuno -histochemistry kit (Zhongshan Goldenbridge Biotechnology, Beijing, China), according to the manufacturer's instructions. Slides were incubated with mouse antihuman mTOR (1 : 100 dilution; Signalway Antibody, College Park, MD, USA), mouse antihuman HIF-1α (1 : 100 dilution; Zhongshan Goldenbridge Biotechnology) or rabbit antihuman VEGF (1 : 100 dilution; Zhongshan Goldenbridge Biotechnology) for 12 h at 4 °C, then washed three times with PBS (0.01 M, pH 7.2) for 5 min each wash. Slides were then incubated with polyperoxidase conjugated goat antimouse or rabbit immunoglobulin G (1 : 100 dilution; Zhongshan Golden Bridge Biotechnology) for 30 min at room temperature and washed three times with PBS (5 min each wash). The horseradish peroxidase–3,3′-diamino benzidine method was used to visualize staining (Zhongshan Golden Bridge Biotechnology). Slides were examined via light microscopy and staining was evaluated in 10 high-power fields (× 400 magnification). Extent of staining was scored as 0 (< 1% positive cells), 1 (1 – 25%), 2 (26 – 50%), 3 (51 – 75%) or 4 (76 – 100%). Staining intensity was scored as 0 (no staining), 1 (pale yellow), 2 (brown to yellow) or 3 (tan). The final score was calculated as the product of the two individual scores.

Phosphate-buffered saline was used in place of primary antibody as a negative control, and human breast carcinoma tissue (from sections obtained from the Department of Pathology, First Affiliated Hospital, Zhengzhou University, Zhengzhou, China) was used as a positive control.

In Situ Hybridization

In situ hybridization was used to detect mTOR mRNA in formalin-fixed, paraffin-embedded tissue sections. Sections were deparaffinized in xylene, dehydrated in graded ethanol, then incubated in 3% hydrogen peroxide and 0.3% Triton™ X-100 (Sigma-Aldrich, St Louis, MO, USA) in PBS at room temperature for 20 min. Slides were heated at 60 °C for 1 h in 3% citrate buffer (pH 7.0) then incubated in 25% proteinase K for 2 – 3 min at room temperature. After proteinase K treatment, slides were incubated with 20 μl hybridization buffer (Boster Biological Technology, Wuhan, China) containing 6 – 12 ng of oligonucleotide probe against mTOR mRNA (5′-CTCAGCGGTAAAAGTGTCCCCTGCCA-3′; Beijing AuGCT DNA-SYN Biotechnology, Beijing, China) for 12 – 16 h at 42 °C. After hybridization, slides were washed four times with 0.1 M saline sodium citrate (SSC) buffer (pH 7.0) at 50 °C (15 min each wash), treated with 1% RNase A (Sigma-Aldrich) for 24 h at room temperature and washed four times with SSC at room temperature (15 min each wash). Slides were then incubated with alkaline phosphatase-conjugated rabbit antihuman digoxigenin antibody (1 : 100 dilution; Roche, Basel, Switzerland) for 10 min at 37 °C, followed by incubation with nitro blue tetra zolium/5-bromo-4-chloro-3-indolyl phosphate for 10 min at 37 °C. For the negative control, slides were incubated with 1% RNase A for 24 h at 37°C before proteinase K treatment. Breast carcinoma tissue (sections obtained from the Department of Pathology, First Affiliated Hospital, Zhengzhou University, Zhengzhou, China) was used as a positive control. Sections were examined using light microscopy and Image-Pro^® Plus software, version 5.1 (Media Cybernetics, Rockville, MD, USA). The mTOR mRNA was quantified as the mean integral optical density from five high power fields (× 400 magnification).

Statistical Analyses

Data were presented as mean ± SD and compared using factorial analysis of variance or Student's t-test, as appropriate. Statistical analyses were performed using SPSS^® version 11.0 software (SPSS Inc., Chicago, IL, USA) for Windows^®. A P-value < 0.05 was considered to be statistically significant.

Results

Injection of EC1 cells induced tumour development in BALB/c nude mice (Fig. 1). Treatment with rapamycin and/or mTOR siRNA significantly reduced tumour volume compared with the control group (P < 0.001 for each comparison; Table 1). Combination treatment resulted in a significantly greater inhibition of tumour growth than either active treatment administered as mono -therapy (P < 0.001 for both comparisons; Table 1).

FIGURE 1:

Effect of rapamycin and small interfering RNA (siRNA) on mechanistic target of rapamycin (mTOR) mRNA in human oesophageal cell line (EC1)-induced tumours in BALB/c nude mice 21 days after xenograft. (A) Untreated; (B) 50 μg/kg rapamycin daily intraperitoneal injection; (C) 3 μg/kg mTOR siRNA daily intraperitoneal injection; (D) combined rapamycin and mTOR siRNA treatment. All treatments initiated 7 days after xenograft

TABLE 1:

Effects of treatment with rapamycin and/or mechanistic target of rapamycin (mTOR)-specific small interfering RNA (siRNA) on the volume of human oesophageal cell line (EC1)-induced tumours in BALB/c nude mice, 21 days after xenograft

Treatment	Tumour volume mm³
Control, PBS	1045.3 ± 118.8
Rapamycin, 50 μg/kg^a	415.3 ± 75.8^c
mTOR siRNA, 3 μg/kg^b	398.6 ± 38.2^c
Rapamycin^a + mTOR siRNA^b	131.6 ± 20.4^c,^d

Data presented as mean ± SD.

PBS, phosphate buffered saline (0.01 M, pH 7.2).

50 μg/kg daily intraperitoneal injection beginning 7 days after xenograft.

3 μg/kg daily intraperitoneal injection beginning 7 days after xenograft.

P < 0.001 versus control group mice; factorial analysis of variance.

P < 0.001 versus rapamycin alone and mTOR siRNA alone; factorial analysis of variance.

TABLE 2:

Effects of treatment with rapamycin and/or mechanistic target of rapamycin (mTOR)-specific small interfering RNA (siRNA) on mTOR, vascular endothelial growth factor (VEGF) and hypoxia inducible factor 1α (HIF-1α) protein^a and mTOR mRNA^b in human oesophageal cell line (EC1)-induced tumours in BALB/c nude mice, 21 days after xenograft

Treatment	mTOR protein	VEGF protein	HIF-1α protein	mTOR mRNA
Control, PBS	18.0 ± 0.9	16.3 ± 0.7	13.6 ± 0.7	19.4 ± 1.9
Rapamycin^c	13.5 ± 0.3^e	10.4± 0.2^e	8.3 ± 0.8^e	12.2 ± 1.3^e
mTOR siRNA^d	13.7± 0.4^e	11.8± 0.3^e	8.3 ± 0.7^e	12.1 ± 1.3^e
Rapamycin^c + mTOR siRNA^d	7.4 ± 0.6^e,^f	5.4 ± 0.4^e,^f	5.4 ± 0.7^e,^f	8.0 ± 0.8^e,^f

Data presented as mean ± SD.

PBS, phosphate-buffered saline (0.01 M, pH 7.2).

Assessed via immunohistochemistry. Staining was evaluated in 10 light microscope fields (× 400 magnification). Extent of staining was scored as 0 (< 1% positive cells), 1 (1 – 25%), 2 (26 – 50%), 3 (51 – 75%) or 4 (76 – 100%). Staining intensity was scored as 0 (no staining), 1 (pale yellow), 2 (brown to yellow) or 3 (tan). The final score was calculated as the product of the two individual scores.

Assessed via in situ hybridization and quantified as the mean integral optical density in five high-power fields (× 400 magnification).

50 μg/kg daily intraperitoneal injection beginning 7 days after xenograft.

3 μg/kg daily intraperitoneal injection beginning 7 days after xenograft.

P < 0.001 versus control group mice; factorial analysis of variance.

P < 0.05 versus rapamycin alone and mTOR siRNA alone; factorial analysis of variance.

Treatment with rapamycin or mTOR siRNA significantly reduced mTOR, VEGF and HIF-1α protein, and mTOR mRNA, compared with the control group (P < 0.001 for all comparisons; Table 2). Combination treatment significantly reduced mTOR, VEGF and HIF-1α proteins and mTOR mRNA compared with either treatment alone (P < 0.05 for all comparisons; Table 2).

Discussion

Oesophageal carcinoma is one of the most common malignant tumours in China.²⁰ As the majority of oesophageal carcinoma cases are not diagnosed until they reach advanced stages, surgical treatment is not usually possible; instead, radiotherapy and chemotherapy are usually required.²¹ However, chemotherapy cannot bring about satisfactory outcomes, even at high doses, because of the development of drug-resistance after long-term treatment.²¹ In addition, increasing the dose of chemotherapeutic drugs may lead to severe side-effects or death.²² The identification of a susceptible treatment target and the development of effective drugs, with mild side-effects are, therefore, required.

Widely used in the specific inhibition of gene expression, RNAi is a useful approach for gene function studies.²³ RNAi is characterized by higher speed and efficiency than traditional approaches (such as gene knockout),²⁴ and may represent a novel strategy for cancer therapy.²⁵

Rapamycin is a specific inhibitor of mTOR²⁶ that has been used as an immunosuppressant in clinical settings.²⁷ Rapamycin blocks cell cycle progression from G₁ to S phase, resulting in cancer-cell apoptosis.²⁸ Studies have shown that rapamycin and its derivatives (such as CCI-779, RAD001 and AP23573) have good antitumour activities, and can exert positive treatment effects in prostate and breast cancers.^29,30

The transcription factor HIF-1α is involved in regulating the response of cancer cells to hypoxia.³¹ Tumour angiogenesis is accelerated by VEGF,³² which is known to be induced by HIF-1α.¹⁴ Several chemical, physical and biological factors exist that regulate HIF-1α protein levels by activating the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)/protein kinase B (Akt)/mTOR signalling pathway in hypoxic or normoxic conditions.^33,34 In some tumours, the level of mTOR is positively correlated with that of HIF-1α.^33–35

The present study demonstrated that mTOR siRNA and/or rapamycin inhibited the growth of oesophageal carcinoma xenografts in BALB/c nude mice, and reduced levels of mTOR, VEGF and HIF-1α proteins, and mTOR mRNA. The combination of mTOR siRNA and rapamycin had a significantly greater inhibitory effect than either treatment alone. This may represent a novel and effective treatment strategy for oesophageal carcinoma.

Footnotes

The authors had no conflicts of interest to declare in relation to this article.

References

Gingras

, Raught

, Sonenberg

: Regulation of translation initiation by FRAP/mTOR. Genes Dev 2001; 15: 807–826.

Sugatani

, Hruska

: Akt1/Akt2 and mammalian target of rapamycin/Bim play critical roles in osteoclast differentiation and survival, respectively, whereas Akt is dispensable for cell survival in isolated osteoclast precursors. J Biol Chem 2005; 280: 3583–3589.

Wang

, Chen

: Expression of leptin and p-mTOR and their clinico -pathological significance in human colon carcinoma. Zhong Nan Da Xue Xue Bao Yi Xue Ban 2012; 37: 233–237 [in Chinese, English abstract].

Huang

, Houghton

: Targeting mTOR signaling for cancer therapy. Curr Opin Pharmacol 2003; 3: 371–377.

Cho

, Signoretti

, Regan

: The role of mammalian target of rapamycin inhibitors in the treatment of advanced renal cancer. Clin Cancer Res 2007; 13: 758s–763s.

Chang

, Miron

: Rapamycin inhibits proliferation of estrogen-receptor-positive breast cancer cells. J Surg Res 2007; 138: 37–44.

Nathan

, Amirghahari

, Rong

: Mammalian target of rapamycin inhibitors as possible adjuvant therapy for microscopic residual disease in head and neck squamous cell cancer. Cancer Res 2007; 67: 2160–2168.

Gridelli

, Maione

, Rossi

: The potential role of mTOR inhibitors in non-small cell lung cancer. Oncologist 2008; 13: 139–147.

Pópulo

, Soares

, Lopes

: Insights into melanoma: targeting the mTOR pathway for therapeutics. Expert Opin Ther Targets 2012; 16: 689–705.

10.

Ekman

, Wynes

, Hirsch

: The mTOR pathway in lung cancer and implications for therapy and biomarker analysis. J Thorac Oncol 2012; 7: 947–953.

11.

Talks

, Turley

, Gatter

: The expression and distribution of the hypoxia-inducible factors HIF-1α and HIF-2α in normal human tissues, cancers, and tumor-associated macrophages. Am J Pathol 2000; 157: 411–421.

12.

Zagzag

, Zhong

, Scalzitti

: Expression of hypoxia-inducible factor 1α in brain tumors: association with angiogenesis, invasion, and progression. Cancer 2000; 88: 2606–2618.

13.

Maxwell

, Pugh

, Ratcliffe

: Activation of the HIF pathway in cancer. Curr Opin Genet Dev 2001; 11: 293–299.

14.

Giatromanolaki

, Koukourakis

, Sivridis

: Relation of hypoxia inducible factor 1α and 2α in operable non-small cell lung cancer to angiogenic/molecular profile of tumors and survival. Br J Cancer 2001; 85: 881–890.

15.

Fire

, Xu

, Montgometry

: Potent and specific interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998; 391: 806–811.

16.

Ketting

, Fischer

, Bernstein

: Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev 2001; 15: 2654–2659.

17.

Grimm

: All for one, one for all: new combinatorial RNAi therapies combat hepatitis C virus evolution. Mol Ther 2012; 20: 1661–1663.

18.

Ramachandran

, Ignacimuthu

: RNA interference as a plausible anticancer therapeutic tool. Asian Pac J Cancer Prev 2012; 13: 2445–2452.

19.

McPherson

: Regulation of animal care and research? NIH's opinion. J Anim Sci 1980; 51: 492–496.

20.

Hamilton

, Aaltonen

(eds): Pathology and Genetics of Tumours of the Digestive System. Lyon: IARC Press, 2000.

21.

Wolf

, Zehentmayr

, Schmidt

: Treatment strategies for oesophageal cancer - time-trends and long term outcome data from a large tertiary referral centre. Radiat Oncol 2012; 7: 60.

22.

Avorn

: Two centuries of assessing drug risks. N Engl J Med 2012; 367: 193–197.

23.

Elbashir

, Harborth

, Lendeckel

: Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001; 411: 494–498.

24.

Paddison

, Candy

, Hannon

: Stable suppression of gene expression by RNAi in mammalian cells. Proc Natl Acad Sci U S A 2002; 99: 1443–1448.

25.

Dannull

, Lesher

, Holzknecht

: Immunoproteasome down-modulation enhances the ability of dendritic cells to stimulate antitumor immunity. Blood 2007; 110: 4341–4350.

26.

Huang

, Houghton

: Inhibitors of mammalian target of rapamycin as novel antitumor agents: from bench to clinic. Curr Opin Investig Drugs 2002; 3: 295–304.

27.

Cicora

, Roberti

, Lausada

: Immunosuppression in kidney donors with rapamycin and tacrolimus. Proinflammatory cytokine expression. Medicina (B Aires) 2012; 72: 3–9 [in Spanish, English abstract].

28.

Liang

, Lu

, Chu

: Rapamycin inhibits the proliferation of prostate cancer cell line 22RV1 and activity of S6K1. Zhonghua Nan Ke Xue 2012; 18: 327–330 [in Chinese, English abstract].

29.

Rai

, Henley

, Ratan

: Mammalian target of rapamycin: a new target in prostate cancer. Urol Oncol 2010; 28: 134–138.

30.

Albert

, Kim

, Cao

: Targeting the Akt/mammalian target of rapamycin pathway for radiosensitization of breast cancer. Mol Cancer Ther 2006; 5: 1183–1189.

31.

Zagórska

, Dulak

: HIF-1: the knowns and unknowns of hypoxia sensing. Acta Biochim Pol 2004; 51: 563–585.

32.

Backer

, Backer

: Imaging key biomarkers of tumor angiogenesis. Theranostics 2012; 2: 502–515.

33.

Hudson

, Liu

, Chiang

: Regulation of hypoxia-inducible factor 1α expression and function by the mammalian target of rapamycin. Mol Cell Biol 2002; 22: 7004–7014.

34.

Bárdos

, Chau

, Ashcroft

: Growth factor-mediated induction of HDM2 positively regulates hypoxia-inducible factor 1αexpression. Mol Cell Biol 2004; 24: 2905–2914.

35.

Uniacke

, Holterman

, Lachance

: An oxygen-regulated switch in the protein synthesis machinery. Nature 2012; 486: 126–129.

Mechanistic Target of Rapamycin Small Interfering RNA and Rapamycin Synergistically Inhibit Tumour Growth in a Mouse Xenograft Model of Human Oesophageal Carcinoma