Phylogenetic analysis and morphology of Ganoderma multipileum,a Ganoderma species associated with dieback of the metropolitan woody plant Delonix regia (Boj. ex Hook.) Raf. in Vietnam

Abstract

Ganoderma multipileum, a wood decay mushroom, was initially discovered and classified in Taiwan through the analysis of its morphology and the internal transcribed spacer (ITS) region of nuclear ribosomal DNA. In this study, we identified a mushroom associated with the dieback of Delonix regia (Boj. ex Hook.) Raf., a woody ornamental street tree in Vietnam, as Ganoderma multipileum. This classification was based on phylogenetic analysis of ITS, RPB2, and TEF1 sequences, as well as morphology assessment and scanning electron microscope observation of basidiospores. The phylogenetic analysis revealed that the specimens collected in Vietnam formed a monophyletic group of Ganoderma multipileum with a high bootstrap value and posterior probability (100%/1.00). Furthermore, the morphological features consistent with laccate Ganoderma, including a thin pileipellis composed of enlarged and bulbous hyphae, and the basidiomes exhibited two different phenotypes. Notably, scanning electron microscopy of the basidiospores revealed ovoid spores with numerous echinules, providing the first documented evidence of this characteristic for Ganoderma multipileum. This research represents the first recorded instance of Ganoderma multipileum in Vietnam associated with the dieback of Delonix regia.

Keywords

wood decay mushroom Ganodermaceae

Introduction

The genus Ganoderma belongs to the family Ganodermataceae and has more than 418 species (www.indexfungorum.org, accessed July 30, 2022). Ganoderma is found in many regions around the world in diverse ecosystems and many species have been used as a medicinal herb for thousands of years in many Asian countries. Species in the genus Ganoderma are white-rot fungi that mostly grow on substrates of decayed wood or fibrous materials, where they degrade the lignocellulose in wood. Basal stem rot on oil palm is caused by Ganoderma, resulting in a yield loss of 23.8 fresh fruit brunches/t ha.¹ This has affected millions of farmers in Malaysia, Indonesia, and other countries, which annually produce 17.8 million tons of oil palms worldwide. Ganoderma species have also been documented attacking Acacia species in India, with many Acacia species serving important economic roles, such as growing it for pulp and wood. G. applanatum and G. lucidum have also been reported in Pakistan² and India on 144 crop perennials hosts such as Acacia, Arnacardium, Artocarpus, Bamboo, Cocos, Coffea, Dalbergia, Pinus, Quercus, and other species.³ Stem, butt, and root rot diseases are typical results of Ganoderma attacks. Before a stressed tree dies from such an infection, its symptoms may include branch dieback and the loss of foliage. The main entry points for diseases may be through soil roots, vegetative spread, or introduction by spores through wounds.⁴ Among the Ganoderma species, G. multipileum was discovered on a stump of decaying wood for the first time in Taiwan.⁵ Since then, G. multipileum has been described based on morphology and phylogeny in subtropical and tropical countries such as China,^6–8 India,⁹ Pakistan,¹⁰ and Thailand.¹¹ In previous reports, G. multipileum was described as a white-rot fungus that mainly decays dead softwood such as Sterculia nobilis, Delonix regia,⁵ and Pinus merkusii,¹¹ as well as hardwood plants such as Dalbergia sissoo and Vachellia nilotica.¹⁰

Delonix regia is a flowering plant of the Fabaceae family and is widely grown in Vietnam and other tropical countries. Various parts of this plant have been used in folk medicine.^12,13 A decoction of the bark is used to treat malaria, bloating, and rheumatism,¹³ while the leaves can treat lower blood pressure.¹⁴ In addition, phenolic compounds effectively increase antioxidant and antimicrobial activities, which hold potential for functional food and medicinal therapies.¹⁵ In Vietnam, the tree is also cultivated as an ornamental avenue tree along streets or near schools and offices. It is considered a summer symbol and is deeply rooted in Vietnamese culture. Notably, a recent document from Vietnam showed that this broadleaf tree host had Ganoderma colossum reported on a stump as a wood decay mushroom.¹⁶ In addition, tree protection in urban areas is significant because most plants that grow in metropolitan areas are woody.¹⁷ If urbanized trees are damaged by attacking pathogens, they can potentially harm citizens. Therefore, understanding the harmful pathogens of woody plants is necessary to determine and conduct control measures.

In this study, a species of Ganoderma was found to cause dieback of the ornamental plant D. regia in Ho Chi Minh City, Vietnam. Phylogenic and morphological analyses of the mushroom resulted in its classification as G. multipileum. The relation of this mushroom with the dieback of the host plant D. regia was noted.

Materials and methods

Host plant observation

The host plant, D. regia, was a healthy 27-year-old tree in 2018, standing ∼ 17 m tall. It was located at coordinates 10^o45'47.28″N and 106^o40'55.85″E in District 5, Ho Chi Minh City, Vietnam. The observation of disease symptoms began after the fruiting bodies had emerged on this tree, spanning a period of 40 months from the rainy season of (August–December) 2018 to December 2021.

Mushroom collection and mycelium isolation

Fresh specimens of the mushroom were collected in November 2018 by Nguyen, T.T.T. from the Faculty of Biology and Biotechnology, University of Science. These specimens were designated as voucher specimens and were deposited at the Laboratory of Microbiology, Faculty of Biology and Biotechnology, University of Science, Vietnam National University Ho Chi Minh City, Vietnam. They were given the code VNHCM1805 for identification and reference purposes. To cultivate the mycelium, tissue samples were taken from the fresh fruiting bodies and transferred to potato dextrose agar (PDA) in sterile Petri dishes (manufactured by STRIPLAN, Germany). The dishes were then incubated at a temperature of 25 ± 2 °C. For further studies, the mycelium was stored in 13 × 100 mm tubes (Pyrex, USA) at a temperature of 4 °C.

Morphological characterization

Macroscopic features were observed on field notes and digital images (Canon EOS 7D, made in Japan). Kornerup and Wanscher's color standards¹⁸ were used to aid in identification. Mushroom samples were dried at 50 °C and stored in resealable plastic bags. The samples were cut into small pieces, inserted into a 5% KOH solution, stained with 1% cotton blue and Melzer reagent solution, and observed using a stereomicroscope (Meiji EMZ 127212, Saitama, Japan). Fruiting bodies were observed at 1000 × magnification using an optical microscope (S/N EU1611034 microscope and CMEX-10 PRO USB 3.0 microscope camera, Euromex, Arnhem, the Netherlands). The description of the basidiomata of Ganoderma followed Karst.¹⁹ Dimensions for basidiospores are given using the notation of the form (a) b–c (d). The b–c range contains a minimum of 90% of the measured values. Extreme values (a) and (d) are provided in parentheses. L_m and W_m indicate the average basidiospore length and width (± standard deviation) for the measured basidiospores. Q implies the “length/width ratio” of a basidiospore in the side view; Q_avg means the average Q of all specimens ± the standard deviation of the sample. A size of at least 50 basidiospores was measured. A JSM-IT100 InTouchScope^TM Scanning Electron Microscope (SEM) (JEOL, Ltd, Tokyo, Japan) was used to observe endospore ornamentation in detail.

DNA extraction, PCR, and sequencing

The mycelia were extracted using the phenol:chloroform: isoamyl alcohol technique (Merck, Darmstadt, Germany) with TE buffer (Tris HCl pH 8.0, 1.0 mM EDTA).²⁰ To obtain only DNA, RNAse A (60 μg) was added after extraction. The total DNA content was determined using NanoVue Plus (GE Healthcare, Gillingham, UK) and stored at −20 °C after purification and concentration. For amplification of the nuclear ribosomal internal transcribed spacers (ITSs; ITS1, 5.8S, ITS2), the primers ITS1F and ITS4 were utilized. Additionally, two protein-coding genes, translation factor 1α (TEF1) and RNA polymerase II's second-largest subunit (RPB2), were amplified using the primer pairs EF1-983F/EF1-2218R and fRPB2-5F/bRPB2-7R2, respectively (Table 1). The PCR components, with a total volume of 25 μL, consisted of 4 μL of sample DNA, 2.5 μL of Taq buffer, 2.5 μL of 2 mM dNTP, 0.125 μL of primers, 0.25 μL of Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA), 1.68 μL of MgCl₂ with optimized buffer, and 13.95 μL of sterile Milli-Q water. The PCR cycling conditions involved an initial denaturation step of 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min for ITS amplification and 2 min for TEF1 and RPB2 amplification. The final elongation step was performed at 72 °C for 5 min. PCR products (2 μL) were electrophoresed on a 2% agarose gel stained with EtBr²¹ in Tris-acetate EDTA buffer, and then visualized and photographed under UV light. Subsequently, Sanger sequencing was conducted by Macrogen (Seoul, Korea).

Table 1.

Primers were used in this study.

No.	Primers	Target gene	Direction	Primers sequences (5'→3')	References
1	ITS1F ITS4	ITS	Forward Reverse	CTTGGTCATTTAGAGGAAGTAA TCCTCCGCTTATTGATATGC	Gardes and Bruns²² White et al.²³
2	EF1-983F EF1-2218R	TEF1	Forward Reverse	GCYCCYGGHCAYCGTGAYTTYAT ATGACACCRACRGCRACRGTYTG	Rehner and Buckley²⁴ Rehner and Buckley²⁴
3	fRPB2-5F bRPB2-7R2	RPB2	Forward Reverse	GAYGAYMGWGATCAYTTYGG ACYTGRTTRTGRTCNGGRAANGG	Liu et al.²⁵ Matheny and Bougher²⁶

ITS: internal transcribed spacer; RPB2: RNA polymerase II's second-largest subunit; TEF1: translation factor 1α.

Phylogenetic tree construction

According to the corresponding Sanger sequencing chromatograms, misleading data from the ends of raw sequencing fragments were manually trimmed and assembled into consensus sequences using BioEdit v7.2. All newly obtained sequences have been submitted to GenBank.²⁷ Results for related genera on studies or searched and downloaded from the GenBank (Table 2) were acquired using BLAST via MAFFT v7.487²⁸ to align the obtained sequences. The alignments were edited and manually corrected using AliView.²⁹ The best-fit model was determined by jModelTest v2.1.10³⁰ based on the corrected Akaike information criterion (AICc). Maximum likelihood (ML) analyses were performed using IQ-TREE v2.0.3 on CIPRES Science Gateway v3.3³¹ with 1000 ultrafast bootstrap replicates. For Bayesian analysis, the best-fit nucleotide model, HKY + I + G, was selected by jModelTest v2.1.10, and posterior probabilities (PPs) were determined by Markov chain Monte Carlo (MCMC) using MrBayes v3.2.7a.³² Three different runs with 1 million generations and four chains were executed until the split deviation frequency value was < 0.01 and sampled every 100th generation. The initial 25% of sample trees were discarded as burn-in. The MCMC runs were checked to reach convergence with all ESS values above 200 by using Tracer v1.7.2.³³ The ML bootstrap values (BSs) ≥ 70% and PP ≥ 0.95 were presented on topologies from ML analyses, respectively. Tomophagus colossus TC-02 was selected as the outgroup for both ML and Bayesian analyses. Phylogenetic trees were visualized and modified using FigTree v.1.4.4.

Table 2.

Genbank accession numbers of Ganoderma species sequences used in the phylogenetic analysis.

Species	GenBank accession no.			Voucher	Locality	References
Species	ITS	RPB2	TEF1	Voucher	Locality	References
Ganoderma boninense	KJ143905	KJ143964	KJ143925	WD 2028	Japan	Zhou et at.⁸
Ganoderma boninense	KJ143906	KJ143965	KJ143924	WD 2085	Japan	Zhou et at.⁸
Ganoderma curtisii	JQ781848	KJ143966	KJ143926	CBS 100131	USA	Zhou et at.⁸
Ganoderma curtisii	MG654167	MG754854	–	223FL	USA	Loyd et al.³⁴
Ganoderma curtisii	MG654097	MG754856	MG754728	UMNFL28	USA	Loyd et al.³⁴
Ganoderma flexipes	MZ354925	MZ245403	MZ221657	Dai 20461	China	Sun et al.³⁵
Ganoderma flexipes	MZ354924	MZ245402	MZ221656	Cui 13863	China	Sun et al.³⁵
Ganoderma leucocontextum (Holotype)	KF011548	–	–	GDGM 40200	China	Li et al.³⁶
Ganoderma leucocontextum	KU572485	MG367516	KU572495	Dai 15601	China	Xing et al.³⁷
Ganoderma lingzhi (Holotype)	JQ781858	JX029980	JX029976	Wu1006-38	China	Cao et al.⁶
Ganoderma lingzhi	KY364245	KY393267	KY393279	SFC20150624-06	Korea	Jargalmaa et al.³⁸
Ganoderma lingzhi	JQ781864	JX029978	JX029974	Dai12479	China	Cao et al.⁶
Ganoderma lucidum	KJ143911	KJ143971	KJ143929	K 175217	UK	Zhou et al.⁸
Ganoderma lucidum	MK554777	MK554765	MK554730	MULC:31549	France	Cabarroi-Hernández et al.³⁹
Ganoderma lucidum	KJ143912	–	KJ143930	MT 26/10	Czech Republic	Zhou et al.⁸
Ganoderma multipileum Ding Hou (Holotype)	KJ143913	KJ143972	KJ143931	CWN 04670	Taiwan, China	Wang et al.⁵
Ganoderma multipileum	MZ706463			VNHCM1805	Vietnam	This study*
Ganoderma multipileum	MG279184	MG367521	MG367575	Cui 14373	China	Xing et al.³⁷
Ganoderma multipileum	KJ143914	KJ143973	KJ143932	Dai 9447	China	Zhou et al.⁸
Ganoderma multipileum	MN401406	MN423142	MN423172	MLU 19-2166	Thailand	Luangharn et al.¹¹
Ganoderma oregonense	JQ781875	KJ143974	KJ143933	CBS 265.88	USA	Loyd et al.³⁴
Ganoderma oregonense	MG654190	MG754740	–	UMNAK1	USA	Loyd et al.³⁴
Ganoderma resinaceum	KJ143916	–	KJ143934	CBS 194.76	The Netherlands	Zhou et al.⁸
Ganoderma resinaceum	MG706249	MG837820	MG837857	LGAM 448	Greece	Sun et al.³⁵
Ganoderma resinaceum	MK554786	MK554764	MK554737	MUCL:52253	France	Cabarroi-Hernández et al.³⁹
Ganoderma sessile	MG654306	MG754866	MG754749	111TX	USA	Loyd et al.³⁴
Ganoderma sessile	MG654319	MG754750	MG754869	228DC	USA	Loyd et al.³⁴
Ganoderma sessile	KJ143936	–	KJ143936	JV 1209/9	USA	Zhou et al.⁸
Ganoderma sichuanense	MN396324	MN423130	MN423163	MFLU 19-2164	Thailand	Luangharn et al.¹¹
Ganoderma sichuanense	KT693253	–	–	B4 13106 13304 13309 clone 2	USA	Raja et al.⁴⁰
Ganoderma tropicum	MG279194	MG367532	MG367585	Dai 16434	China	Xing et al.³⁷
Ganoderma tropicum	KF495000	MG367531	MG367584	He 1232	China	Xing et al.³⁷
Ganoderma tsugae Murill	KJ143919	KJ143977	KJ143939	Dai 12751b	USA	Zhou et al.⁸
Ganoderma tsugae	DQ206985	DQ408116	DQ059048	AFTOL-ID 771	USA	Matheny et al.⁴¹
Ganoderma tsugae	MG654345	–	MG754766	UMNWI23	USA	Loyd et al.³⁴
Tomophagus colossus	KJ143923	–	KJ143943	TC-02	Vietnam	Zhou et al.⁸

*This species is presented in this study.

ITS: internal transcribed spacer; RPB2: RNA polymerase II's second-largest subunit; TEF1: translation factor 1α.

Results

Disease symptoms on the host plant

Ganoderma multipileum VNHCM1805 was initially noticed on the host tree, D. regia, during the rainy season of 2018. The tree exhibited blooming in the summer of May 2019, but it did not flower again in May 2020. Over time, the leaves of the host plant were lost, and the branches began to die back, leading up to May 2021 (Figure 1(a) to (c)). The basidiocarps of the mushroom persisted and were observed on the roots and trunk of the host tree during each rainy season from 2018 to 2021 (Figure 1(d) and (f)). No infections caused by pets or insects were observed on the plant. Furthermore, there was visible damage to the phloem on the side where the basidiocarps were growing, resulting in abnormal bark. The bark displayed signs of sap spillage, which then reversed its flow (Figure 1(g)). Considering the potential risks of extensive damage to nearby houses and residents, the decision was made to cut down the dying tree before 2022.

Figure 1.

Delonix regian disease symptoms and the macroscopic structures of G. multipileum VNHCM1805 basidiomes: (a) D. regia tree in May 2019, (b) the same tree in May 2020, (c) the same tree in May 2021, (d) basidiocarps growing at the base of the same living tree, (e) lower surface of a basidiome, (f) young basidiocarp on tree roots, (g) cutting part of the bark from the same living tree where the young basidiocarp was growing, and (h) section of basidiome. Scale bars: d: 20 cm; e to h: 2 cm.

Phylogeny

In this experiment, we conducted phylogenetic analyses using a combined dataset comprising ITS, RPB2, and TEF1 sequences from 36 taxa. The results indicated that these sequences were attributed to the Ganoderma genus and were classified into six distinct clades (Figure 2). Reference sequences from GenBank, obtained from samples collected in the USA, the UK, Czech Republic, France, Italy, Korea, China, Japan, the Netherlands, Thailand, and Vietnam, were included, and they encompassed holotypes of G. lingzhi, G. leucocontextum, and G. multipileum. Tomophagus colossus (Fr.) Murill 1905 (TC-02, Vietnam) served as the outgroup in the taxonomic tree. The dataset consisted of 2176 sites, including gap regions (558 sites for ITS, 946 sites for RPB2, and 672 sites for TEF1). The tree topologies resulting from the maximum likelihood (ML) analysis were consistent with the Bayesian analysis. The best-scoring ML tree and Bayesian analysis are depicted in Figure 2 (and supporting information). Notably, the specimens collected from Vietnam formed a significantly distinct, monophyletic group with the G. multipileum taxon. This group included the holotype (CWN 04670) and other sequences from China (Cui 14373, Dai 9447) and Thailand (MLU 19-2166). The strong support for this clustering was reflected by high ML/PP values of 100% and 1.00, respectively.

Figure 2.

Phylogeny of Ganoderma spp. based on data from ITS, RPB2, and TEF1 sequences. Bootstrap values were obtained from maximum likelihood above 70% and posterior probabilities equal to or greater than 0.95 (given above branches). The tree is rooted in Tomophagus colossus TC-02 (Vietnam). New species were collected in Vietnam in bold (black).

Taxonomy

Basidiome: annual, stipitate, laccate, woody. Pileus 15–25 × 7–10 cm up to 2.2 cm thick at the base, flabelliform, upper surface brownish orange (6C8), orange-rooted to reddish brown (8D8) at maturity, weakly to strongly laccate, reniform, dimidiate, pilei expanding, sometimes with pilei growing from the lower pilei or growing together, up to 36 cm, and 54 cm in overall width from the lower pilei, curly and wavy edges; lower surface yellowish white (4A2) to brownish gray at maturity. The young basidiocarp's upper surface is brownish orange (6C8), orange-rooted to reddish brown (8D8), somewhat lacquered, obviously sulcate, rugged and non-rough, margin obtuse or not, white to orange-yellow. Context 0.1–1.8 cm thick, light brown (6D6) to dark brown (6F8), occasionally melanoid in KOH, corky. Hymenophore whitish cream on the surface while young, straw, or light brown (6D6) at maturity. Pores, subcircular to circular, 25–110 μm thickness, 60–80 μm per mm, 60–220 μm in diameter, and 3–5 spores/mm. Stipe 1.5–3.5 cm in length, up to 0.7–3.0 cm in width, sub-cylindrical to cylindrical, strong laccate, reddish brown (9D7), and brownish red (10D6) at maturity (Figure 3).

Figure 3.

Microscopic structures of the basidiome G. multipileum VNHCM1805: (a) section of pileus (2 ×), (b) pores in lower surface (4 ×), (c) a pore (40 ×), (d) section of Pileipellis (100 ×), (e and f) hyphae of context (100 ×), (f) basidiospores (100 ×); (g) chlamydospores (100 ×), (h) culture after incubation at 25 ± 2 °C for 7 days. Scale bars: a: 1 cm, b: 1 mm, c: 50 µm, d: 20 µm, and e to g: 10 µm.

Basidiome: The basidiome of the mushroom is annual, stipitate (having a stem), laccate (shiny), and woody in texture. The pileus (cap) measures 15–25 cm in width and 7–10 cm in thickness at the base. It has a flabelliform (fan-shaped) appearance, with the upper surface exhibiting shades of brownish orange (6C8) and becoming reddish brown (8D8) as it matures. The pileus is weakly to strongly laccate (lacquer-like), reniform (kidney-shaped), and dimidiate (having two symmetrical halves). The pilei may expand and sometimes have additional pilei growing from the lower portion, resulting in an overall width of up to 36 and 54 cm. The edges of the pilei are curly and wavy. The lower surface is yellowish-white (4A2) and turns brownish-gray with maturity. When the basidiocarp is young, the upper surface of the pileus is brownish orange (6C8) and reddish brown (8D8), displaying a lacquered appearance. It is also visibly sulcate and has grooves or furrows, and has a rugged, non-rough texture. The margin of the pileus may be obtuse (blunt) or not, and it can range in color from white to orange-yellow.

Context: The context (inner flesh) of the mushroom is 0.1–1.8 cm thick and varies in color from light brown (6D6) to dark brown (6F8), occasionally becoming melanoid (darkening) when treated with potassium hydroxide (KOH). The context has a corky texture.

Hymenophore: The hymenophore (the spore-bearing surface) appears whitish cream when young and turns straw or light brown (6D6) as it matures. The pores on the hymenophore are subcircular to circular in shape, with a thickness of 25–110 μm, 60–80 pores per millimeter, and a diameter of 60–220 μm. The mushroom produces 3–5 spores per millimeter. The stipe (stem) measures 1.5–3.5 cm in length and 0.7–3.0 cm in width. It is sub-cylindrical to cylindrical in shape and has a strong laccate appearance. The stipe color ranges from reddish brown (9D7) to brownish red (10D6) as it matures (Figure 3).

Hyphal structure: The hyphal structure of the mushroom consists of generative hyphae, which are trimetric in shape, colored, and measure 2.0–5.2 μm in diameter (n = 30). These hyphae have thin walls. The skeletal hyphae, on the other hand, are broader, measuring 4.3–7.1 μm (n = 30). They are yellowish brown to reddish brown in potassium hydroxide (KOH) solution. The binding hyphae are few in number and measure 1.2–2.0 μm in diameter (n = 30). They have thick walls and a highly branched structure.

Basidiospores: The basidiospores of the mushroom are ovoid in shape, mostly truncated, and possess double walls. They range in color from brownish orange (7C4) to brown (7E5). The spores measure (7.3) 8.0–11.5 (12.2) × (5.3) 5.5–7.8 (8.3) μm, with an average length (Lm) of 10.6 μm and an average width (Wm) of 6.8 μm (n = 50). The spores have an average Q-value (Qavg) of 1.79 ± 0.28. In the absence of a myxosporium, the spores measure (6.6) 7.3–10.9 (11.3) × (4.9) 5.1–7.2 (7.7) μm, with an average length (Lm) of 8.7 μm and an average width (Wm) of 6.2 μm (n = 50). These spores have an average Q-value (Qavg) of 1.47 ± 0.34. The exosporium (outer wall) is hyaline, while the endosporium (inter wall) displays conspicuous echinulae and has a fine dark brown color (7F). The eursporium is also present (Figure 4).

Figure 4.

Basidiospores of Ganoderma multipileum VNHCM1805 observed via a scanning electron microscope (SEM): (a) view at 1500 ×, (b) view of exosporium and endosporium at 5000 ×, (c) view of exosporium at 10,000 ×, and (d) detail in endospore ornamentation at 10,000 ×.

Pileipellis: The pileipellis (surface layer of the cap) is cutis in structure and consists of clavate cells measuring 13–42 μm in length and 6.0–13.6 μm in width. These cells exhibit dextrinoid to mildly or severely amyloid characteristics.

Colonies: The colonies of the mushroom exhibit the mycelia are white (4A1) when young and turn pale yellowish white (4A2) to grayish yellow (4B6) after seven days of growth on the PDA medium at a temperature of 25 ± 2 °C. The colonies are round in shape and display growth in a radiating pattern, with the center being thicker and gradually thinning outward. The hyphae are hyaline (transparent) and possess clamp connections, indicating a specific structure at the point of hyphal fusion. The hyphae are also branched. After 5–7 days of growth, chlamydospores become visible. These chlamydospores are club-shaped and have thick walls. They stain with 1% cotton blue and measure 5.5–8.5 × 9.0 × 11.0 μm in size.

Discussion

The genus Ganoderma and the species G. lucidum were initially described in 1881 by Finnish mycologist Karsten.¹⁹ However, the taxonomy of the G. lucidum complex has been challenging due to its wide distribution across various regions, leading to morphological variability. Recent advancements in DNA sequence analysis have provided effective tools for taxonomists to combine data. In 1950, Ding Hou et al. discovered G. multipileum in Taiwan and classified it as a new species within the G. lucidum complex. The nrDNA of this species was subsequently sequenced by Wang et al.⁵ In addition, Zhou et al.⁸ sequenced the RPB2 and TEF1 genes of this strain. Phylogenetic analysis based on these sequenced genes revealed that they clustered together with the holotype and other strains of G. multipileum. The phylogenetic tree also demonstrated that the relationship between G. multipileum and G. tropicum was closer than with the G. lucidum complex, supporting that G. multipileum belongs to the laccate species of Ganoderma. Wang et al.⁵ further suggested that G. multipileum exhibits two phenotypes of fruiting bodies based on morphological features, including those growing from the stem with some stipes and mushroom caps growing together, as well as from lower pilei. The specimens collected in Vietnam displayed both phenotypes of sporocarps when growing on a living royal poinciana tree. In contrast, specimens from Thailand and Pakistan exhibited multiple-pileate sporocarps and were found on decayed hardwoods.^10,11 The basidiospores of Vietnamese G. multipileum had typical oval shapes similar to the holotype of G. multipileum, as confirmed by SEM photos for the first time. The basidiospores displayed numerous echinules, consistent with the descriptions by Wang et al. in their drawings. G. multipileum has been described and illustrated in four countries and territories, including Taiwan, China, Thailand, and Pakistan. Previous research has shown its association with the decay of various wood types, including gymnosperms (Merkus pine, Pinus merkusii) and angiosperms (Sterculia nobilis—Chinese chestnut, Dalbergia sissoo—North Indian rosewood, Vachellia nilotica—gum arabic tree). Interestingly, most host plants of G. multipileum from the angiosperm group belong to the Fabaceae family, including D. regia, D. sissoo, and V. nilotica. According to the literature, Ganoderma spp. are predominantly found in the vicinity of tree stumps and roots, and this genus is known as one of the most prevalent plant pathogens.^42–45 Species within this genus are categorized as white-rot fungi and possess enzymes capable of degrading lignin and cellulose. These enzymatic properties enable Ganoderma spp. to decompose as much as 99% of lignin in various types of wood.⁴⁶ Consequently, Ganoderma species typically parasitize older trees and rarely affect younger ones. The infection of trees occurs when airborne fungal spores enter the bark through open wounds in the trunk and roots.⁴³

As a result of infection, the xylem cells in the affected tree become necrotic, impeding the transport of water and minerals to the leaves and other parts of the plant.⁴⁷ Among the Ganoderma species, G. adspersum, G. applanatum, G. resinaceum, and G. pfeifferi are known to be highly detrimental fungi in urban landscapes in Europe,⁴⁸ while G. boninense primarily affects oil palm plantations in Southeast Asia.^1,49 In the United States, pathogens affecting landscape trees include G. applanatum, G. boninense, the G. lucidum complex, G. sessile, and G. zonatum.^4,42,50 In this study, G. multipileum was observed and collected from D. regia, an old tree aged 27 years, which served as a street ornamental plant in the metropolitan area of Ho Chi Minh City, Vietnam. The region has a dense and high-density population.⁵¹ The symptoms of tree dieback included the lack of flowering, the absence of new branches after the spread of fungal growth on the base and root, leaf shedding, and gradual withering of branches. The process of decline began with the drying of twigs, followed by branches, limbs, and eventually the trunk. At the site where the fungus grew, there was bleeding sap that turned black, leading to symptoms of root rot, root dryness, and tree death. No signs of pest or insect attacks were observed on the plant, while neighboring trees thrived and grew well. This suggests that factors such as soil layers or nutrient supply did not significantly impact the plant's health.

In the limitation of this study, it should be noted that experiments following Koch's postulates, which involve infecting mycelia or basidiospores on another royal poinciana of the same age, observing the infection, and obtaining the mycelia, were not conducted. These experiments usually require a minimum of three years to complete. However, in this study, the growth of the fungus was observed concurrently with the plant's dieback symptoms over a period of 40 months. It is also important to consider previous studies that have reported on the harmful effects of Ganoderma spp. on landscape plants.

Conclusion

In conclusion, this study presents a comprehensive examination of the morphology, phylogenetic analysis based on ITS, RPB2, and TEF1 sequences, and assessment of basidiospores using scanning electron microscopy for G. multipileum. The collected specimen significantly clustered together and formed a monophyletic group with other G. multipileum taxon, including the holotype, with strong support from ML/PP values. These findings also highlight the distinctiveness of G. multipileum compared to related species worldwide. Importantly, this research unveils the first documented occurrence of G. multipileum in Vietnam. The study establishes a clear association between the presence of these fungi and disease symptoms observed in the host plant Delonix regia.

Footnotes

Acknowledgements

The authors give thanks to the Center for Bioscience and Biotechnology, University of Science, Vietnam National University Ho Chi Minh City for technical support. The preprint of the manuscript was submitted in Research Square with DOI:https://doi.org/10.21203/rs.3.rs-2421198/v1.

Authors contribution

All authors contributed to the study’s conception and design. Material preparation and description were performed by TTT Nguyen, HD Nguyen, and AT Bui. Fungal remains were analyzed and interpreted by TTT Nguyen, KHT Pham, and KTP Van. The manuscript draft prepared by TTT Nguyen was revised and finalized by MH Tran and LT Tran. All authors read and approved the final manuscript.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: Trang Thi Thu Nguyen was funded by the Vingroup Joint Stock Company and supported by the PhD Scholarship Program of the Vingroup Innovation Foundation (VINIF), Vingroup Big Data Institute (VINBIGDATA) (grant number: code VINIF.2020.TS.68).

Data availability

The data generated during the current study are available from the corresponding author upon reasonable request.

ORCID iD

Manh Hung Tran

Author biographies

Trang Thi Thu Nguyen is a lecturer in the Department of Microbiology, Faculty of Biology and Biotechnology at the University of Science, Vietnam National University, Ho Chi Minh City. Simultaneously, she is pursuing her PhD in the field of Microbiology. Her research focus encompasses the taxonomy of macrofungi, the cultivation of edible medicinal mushrooms, and the exploration of bioactive compounds from microorganisms. Notably, Nguyen has authored six research articles published in renowned Journals (SCOPUS, SCI, SCIE) and has contributed a chapter to an international book.

Hoang Duc Nguyen holds a PhD degree earned in Germany. Presently, he serves as an Associate Professor at the Faculty of Biology and Biotechnology within the University of Science, Vietnam National University, Ho Chi Minh City. Notably, he also assumes the role of Director at the Center for Bioscience and Biotechnology.

Anh Tu Bui holds both a bachelor's and master's degree from the Faculty of Mathematics and Computer Science at the University of Science, Vietnam National University, Ho Chi Minh City. He currently serves as a lecturer at the Ho Chi Minh City University of Medicine and Pharmacy in Vietnam.

Khanh Huyen Thi Pham completed her pharmacy degree in September 2022. She presently serves as a teaching assistant at the University of Danang's School of Medicine and Pharmacy. Her academic journey and current role highlight her active involvement in diverse scientific research projects. She has authored six scientific articles focused on herbal medicines, with contributions to four national and two international journals.

Kim Thuong Pham Van graduated with honors from Guangxi Medical University, China, and obtained a master's degree in Pharmacognosy, Traditional Pharmacy. Currently, she is pursuing a PhD in Greater Guangzhou, China, specializing in traditional pharmacology and botanical chemistry. With over a decade of experience in teaching and research in this domain, she brings a wealth of expertise to her work. She is currently affiliated with the School of Medicine & Pharmacy at The University of Danang in Da Nang, Vietnam.

Linh Thuoc Tran is a distinguished Professor at the Faculty of Biology and Biotechnology, University of Science, Vietnam National University, Ho Chi Minh City. His impressive academic contributions include the publication of 107 research articles, the authorship of 03 books, and the granting of 2 US patents.

Manh Hung Tran is a lecturer and researcher in natural medicine at the University of Danang's School of Medicine and Pharmacy. He earned his PhD in pharmaceutical science from Korea in 2008. His expertise lies in drug discovery from natural sources, focusing on compounds from natural medicinal plants and fungi. Notably, he has contributed to projects involving phenolics, iridoids, alkaloids, lignans, triterpenoids, dammaranes, saponins, aromatics, and flavonoids. His work spans various health applications, including anti-atherosclerosis, anti-Alzheimer's, anti-diabetes, anti-obesity, anti-cancer, and anti-inflammatory activities. His skills encompass cell cultures, molecular biology, enzyme assays, compound isolation, and advanced techniques like structure elucidation, docking simulations, mass spectrometry, and bacterial fermentation.

References

Ariffin

Idris

Singh

. Status of Ganoderma in oil palm. In: Flood

Bridge

Holderness

(eds) Ganoderma diseases of perennial crops. Wallingford, Oxfordshire: CABI Publishing, 2000, pp.49–68.

Nasir

. Diseases caused by Ganoderma spp. on perennial crops in Pakistan. Mycopathologia 2005; 159: 119–121.

Sankaran

Bridge

Gokulapalan

. Ganoderma diseases of perennial crops in India—an overview. Mycopathologia 2005; 159: 143–152.

Kües

Nelson

Liu

, et al. Genome analysis of medicinal Ganoderma spp. with plant-pathogenic and saprotrophic lifestyles. Phytochemistry 2015; 114: 18–37.

Wang

, et al. Ganoderma multipileum, the correct name for “G. lucidum” in tropical Asia. Botanical Studies 2009; 50: 451–458.

Cao

Dai

. Species clarification of the prize medicinal Ganoderma mushroom Lingzhi. Fungal Divers 2012; 56: 49–62.

Wang

, et al. The species identity of the widely cultivated Ganoderma, “G. lucidum” (Ling-zhi), in China. PLoS ONE 2012; 7: e40857.

Zhou

Cao

, et al. Global diversity of the Ganoderma lucidum complex (Ganodermataceae, Polyporales) inferred from morphology and multilocus phylogeny. Phytochemistry 2015; 114: 7–15.

Bhatt

Mistri

Joshi

, et al. Molecular survey of basidiomycetes and divergence time estimation: an Indian perspective. PLoS ONE 2018; 13: e0197306.

10.

Umar

Ahmed

Guzman-Davalos

, et al. Ganoderma multipileum and Tomophagus cattienensis—new records from Pakistan. Mycotaxon 2022; 137: 135–151.

11.

Luangharn

Karunarathna

Dutta

. Ganoderma (Ganodermataceae, Basidiomycota) species from the Greater Mekong Subregion. Journal of Fungi 2021; 7: 819.

12.

Singh

Naresh

. A review: introduction to genus Delonix. World Journal of Pharmacy and Pharmaceutical Sciences 2014; 3: 2042–2055.

13.

Modi

Mishra

Bhatt

, et al. Delonix regia: historic perspectives and modern phytochemical and pharmacological researches. Chin J Nat Med 2016; 14: 31–39.

14.

Wang

Lee

, et al. Delonix regia leaf extract (DRLE): a potential therapeutic agent for cardioprotection. PLoS ONE 2016; 11: e0167768.

15.

Shabir

Anwar

Sultana

, et al. Antioxidant and antimicrobial attributes and phenolics of different solvent extracts from leaves, flowers and bark of gold mohar [Delonix regia (Bojer ex Hook.) Raf.]. Molecules 2011; 16: 7302–7319.

16.

Kleinwächter

Anh

Kiet

, et al. Colossolactones, new triterpenoid metabolites from a Vietnamese mushroom Ganoderma colossum. J Nat Prod 2001; 64: 236–239.

17.

Tello

Tomalak

Siwecki

, et al. Biotic urban growing conditions-threats, pests and diseases. In: Konijnendijk

Nilsson

Randrup

Schipperijn

(eds) Urban forests and trees: a reference book. Berlin, Heidelberg: Springer, 2005, pp.325–365.

18.

Kornerup

Wanscher

. Methuen handbook of colour. 3rd ed. London: Methuen & Co. Ltd, 1978.

19.

Karsten

. Enumeratio boletinearum et polyporearum fennicarum, systemate novo dispositarum. Reviews of Mycology 1881; 3: 16–19. https://cir.nii.ac.jp/crid/1573387449823898368 .

20.

Elkins

. DNA Extraction. In: Elkins

(eds) Forensic DNA biology. Amsterdam: Elsevier Inc, 2013, pp.39–52.

21.

Lai

Herr

. Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations. Proc Natl Acad Sci U S A 1992; 89: 6958–6962.

22.

Gardes

Bruns

. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Mol Ecol 1993; 2: 113–118.

23.

White

Bruns

Lee

, et al. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis

Gelfand

Sninsky

White

(eds) PCR Protocols, a guide to methods and applications. Cambridge, Massachusetts: Academic Press, 1990, pp.315–322.

24.

Rehner

Buckley

. A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005; 97: 84–98.

25.

Liu

Whelen

Hall

. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol Biol Evol 1999; 16: 1799–1808.

26.

Matheny

Bougher

. The new genus Auritella from Africa and Australia (Inocybaceae, Agaricales): molecular systematics, taxonomy and historical biogeography. Mycol Prog 2006; 5: 2–17.

27.

Sayers

Cavanaugh

Clark

, et al. Genbank. Nucleic Acids Res 2019; 47: D94–D99.

28.

Katoh

Standley

. MAFFT Multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 2013; 30: 772–780.

29.

Larsson

. Aliview: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 2014; 30: 3276–3278.

30.

Darriba

Taboada

Doallo

, et al. Jmodeltest 2: more models, new heuristics and parallel computing. Nat Methods 2012; 9: 72.

31.

Miller

Schwartz

. The CIPRES science gateway: a community resource for phylogenetic analyses sustainable software for science view project CIPRES view project. Proceedings of the Gateway Computing Environments Workshop (GCE) 2011; 41: –8.

32.

Ronquist

Huelsenbeck

. Mrbayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003; 19: 1572–1574.

33.

Rambaut

Drummond

Xie

, et al. Posterior summarization in Bayesian phylogenetics using tracer 1.7. Syst Biol 2018; 67: 901–904.

34.

Loyd

Barnes

Held

, et al. Elucidating “lucidum”: distinguishing the diverse laccate Ganoderma species of the United States. PLoS ONE 2018; 13: e0199738.

35.

Sun

Xing

, et al. Species diversity, systematic revision and molecular phylogeny of Ganodermataceae (Polyporales, Basidiomycota) with an emphasis on Chinese collections. Stud Mycol 2005; 53: 287–415.

36.

Deng

, et al. Ganoderma leucocontextum, a new member of the G. lucidum complex from southwestern China. Mycoscience 2015; 56: 81–85.

37.

Xing

Sun

Han

, et al. Morphological and molecular identification of two new Ganoderma species on Casuarina equisetifolia from China. MycoKeys 2018; 34: 93–108.

38.

Jargalmaa

Eimes

Park

, et al. Taxonomic evaluation of selected Ganoderma species and database sequence validation. Peer J 2017; 5: e3596.

39.

Cabarroi-Hernández

Villalobos-Arámbula

Torres-Torres

, et al. The Ganoderma weberianum-resinaceum lineage: multilocus phylogenetic analysis and morphology confirm G. mexicanum and G. parvulum in the Neotropics. MycoKeys 2019; 59: 95–131.

40.

Raja

Baker

Little

, et al.

DNA barcoding for identification of consumer-relevant mushrooms: a partial solution for product certification?

Food Chem 2017; 214: 383–392.

41.

Matheny

Wang

Binder

, et al. Contributions of rpb2 and tef1 to the phylogeny of mushrooms and allies (Basidiomycota, Fungi). Mol Phylogenet Evol 2007; 43: 430–451.

42.

Loyd

Linder

Anger

, et al. Pathogenicity of Ganoderma species on landscape trees in the Southeastern United States. Plant Dis 2018; 102: 1944–1949.

43.

Sadyś

Skjøth

Kennedy

. Back-trajectories show export of airborne fungal spores (Ganoderma sp.) from forests to agricultural and urban areas in England. Atmos Environ 2014; 84: 88–99.

44.

Grinn-Gofroń

Bogawski

Bosiacka

, et al. Abundance of Ganoderma sp. in Europe and SW Asia: modelling the pathogen infection levels in local trees using the proxy of airborne fungal spore concentrations. Sci Total Environ 2021; 793: 148509.

45.

Náplavová

Beck

Gáper

, et al. Synanthropic process evaluation (with factors affecting propensity to parasitism) and host range within the genus Ganoderma in Central Europe. Forests 2021; 12: 1437.

46.

Dill

Kraepelin

. Palo Podrido: model for extensive delignification of wood by Ganoderma applanatum. Appl Environ Microbiol 1986; 52: 1305–1312.

47.

Pearce

. Reaction zone relics and the dynamics of fungal spread in the xylem of woody angiosperms. Physiol Mol Plant Pathol 1991; 39: 41–55.

48.

Michalíková

Beck

Gáper

, et al. Can wood-decaying urban macrofungi be identified by using fuzzy interference system? An example in Central European Ganoderma species. Sci Rep 2021; 11: 13222.

49.

Bharudin

Ab Wahab

AFF

Abd Samad

, et al. Review update on the life cycle, plant–microbe interaction, genomics, detection and control strategies of the oil palm pathogen Ganoderma boninense. Biology (Basel) 2022; 11: 51.

50.

Kunta

Miao

Shigaki

, et al. Ganoderma infecting citrus in Texas is a unique taxon within the G. lucidum complex: evidence from the ITS region. Pest Technology 2010; 4: 62–64.

51.

Yue

Chen

Thy

PTM

, et al. Identifying urban vitality in metropolitan areas of developing countries from a comparative perspective: Ho Chi Minh City versus Shanghai. Sustainable Cities and Society 2021; 65: 102609.