Sage Journals: Discover world-class research

Abstract

Spaceflight impacts cardiovascular function in astronauts; however, its impact on cardiac development and the stem cells that form the basis for cardiac repair is unknown. Accordingly, further research is needed to uncover the potential relevance of such changes to human health. Using simulated microgravity (SMG) generated by two-dimensional clinorotation and culture aboard the International Space Station (ISS), we assessed the effects of mechanical unloading on human neonatal cardiovascular progenitor cell (CPC) developmental properties and signaling. Following 6–7 days of SMG and 12 days of ISS culture, we analyzed changes in gene expression. Both environments induced the expression of genes that are typically associated with an earlier state of cardiovascular development. To understand the mechanism by which such changes occurred, we assessed the expression of mechanosensitive small RhoGTPases in SMG-cultured CPCs and observed decreased levels of RHOA and CDC42. Given the effect of these molecules on intracellular calcium levels, we evaluated changes in noncanonical Wnt/calcium signaling. After 6–7 days under SMG, CPCs exhibited elevated levels of WNT5A and PRKCA. Similarly, ISS-cultured CPCs exhibited elevated levels of calcium handling and signaling genes, which corresponded to protein kinase C alpha (PKCα), a calcium-dependent protein kinase, activation after 30 days. Akt was activated, whereas phosphorylated extracellular signal-regulated kinase levels were unchanged. To explore the effect of calcium induction in neonatal CPCs, we activated PKCα using hWnt5a treatment on Earth. Subsequently, early cardiovascular developmental marker levels were elevated. Transcripts induced by SMG and hWnt5a-treatment are expressed within the sinoatrial node, which may represent embryonic myocardium maintained in its primitive state. Calcium signaling is sensitive to mechanical unloading and directs CPC developmental properties. Further research both in space and on Earth may help refine the use of CPCs in stem cell-based therapies and highlight the molecular events of development.

Introduction

As humankind prepares for an expanded presence in space, the molecular effects of microgravity (MG) have increasingly become the subject of investigation. As this research has evolved, the application of MG, whether real or simulated, has been found to have potential therapeutic use here on Earth [1 –3]. Thus, efforts to characterize the biological response to reduced gravity conditions, including at a molecular level, will benefit society both in space and on Earth.

Research in our own laboratory has shown that simulated microgravity (SMG) impacts the developmental profile of human cardiovascular progenitor cells (CPCs) in an age-dependent manner [4]. Interestingly, microarray analysis in those experiments identified small RhoGTPases and Wnt signaling as being some of the systems affected by the SMG environment in neonatal CPCs.

The effect of mechanical unloading on mouse embryonic stem cells (mESCs) has been shown to impact differentiation and stemness, with experiments by Blaber et al. [5] demonstrating that embryoid bodies retain markers of self-renewal and exhibit reduced definitive germ layer marker expression when flown in space. However, in the same studies, when mechanically unloaded embryoid bodies returned to Earth, they were able to differentiate more readily into contractile cardiomyocyte colonies. Similarly, Jha et al. [6] found that human induced pluripotent stem cells more readily differentiate into cardiomyocytes using three-dimensional culture coupled with transient, early exposure to SMG.

These separate experiments may represent a similar phenomenon in which a low gravity culture promotes an enhanced state of stemness under SMG or MG that results in increased differentiation ability when the cells are returned to normal gravity conditions. Thus, stem cell therapies relevant to cardiac repair may be improved by manipulating the mechanisms relevant to mechanical signaling in cardiovascular progenitors. In particular, inducing enhanced stemness in cardiovascular progenitors may facilitate a correspondingly enhanced clinical effect upon transplantation.

Alterations in mechanical sensing molecules, such as the small RhoGTPases, are believed to be involved in the molecular adaptation to MG [7,8]. Importantly, these molecules are also able to impact intracellular signaling pathways, such as calcium oscillations, which subsequently can activate AKT [9] and extracellular signal-regulated kinase (ERK) [10]. In the context of cardiogenesis, these processes are critical to maintaining a balance between inductive and proliferative cues [11,12]. Therefore, manipulating the normal gravity environment of early CPCs may highlight important mechanisms by which early cardiac progenitors develop or expand. Such insights may be applied to further understand cardiovascular development and enhance the outcomes of stem cell-based regenerative therapies.

In the context of cardiac repair, early clinical trials of these types of therapies are promising [13 –15], but are stymied by a failure of cell engraftment and controversy over the appropriate cell type [16]. Therefore, the application of findings from MG experiments to Earth-based experiments may help overcome the shortcomings of current clinical trials involving the use of CPCs for cardiac repair.

In an effort to characterize both the effects of MG on a population of early CPCs as well as the potential use of these changes on Earth, we cultured neonatal human CPCs using a two-dimensional clinostat and in the National Laboratory aboard the International Space Station (ISS). We sought to identify changes in the transcription of genes involved in signaling in response to SMG and MG as well as the effects of such signaling changes on stemness. We then modeled features of these molecular changes in vitro using a small molecule under normal gravity conditions. In doing so, we present components of the adaptive cellular response to MG and their implications for enhancing the regenerative potential of neonatal CPCs.

Materials and Methods

Isolation and culture of early CPCs

The Institutional Review Board of Loma Linda University approved the protocol for use of tissue that was discarded during cardiovascular surgery, without identifiable private information, for this study with a waiver of informed consent. CPCs were isolated from cardiac tissue of neonates (1 day–1 month), as previously described [17]. Briefly, atrial tissue was cut into small clumps (∼1.0 mm³) and then enzymatically digested using collagenase (Roche, Indianapolis, IN) at a working concentration of 1.0 mg/mL. The resulting solution was then passed through a 40-μm cell strainer. Cells were cloned in a 96-well plate by limiting dilution to a final concentration of 0.8 cells per well to create populations for expansion.

Then, clones were screened for the coexpression of Isl1 and c-Kit and supplemented with growth media comprising 10% fetal bovine serum (Thermo Scientific, Waltham, MA), 100 μg/mL penicillin–streptomycin (Life Technologies, Carlsbad, CA), 1.0% minimum essential medium nonessential amino acids solution (Life Technologies), and 22% endothelial cell growth media (Lonza, Basel, Switzerland) in Medium 199 (Life Technologies). The MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Basel, Switzerland) was used to test for mycoplasma contamination.

Flow cytometry

Progenitor cell populations were fluorescently labeled with antibodies, as recommended by their respective manufacturers, and then analyzed using a MACSQuant^® analyzer (Miltenyi Biotec, Auburn, CA). Quantification of data was performed using FlowJo software version 10 (Ashland, OR). Isotype controls and unstained cell populations were used to define positive and negative gates. Antibodies used for cytometric analysis are described in Table 1.

Table 1.

Antibodies Used in Flow Cytometry and Western Blotting

Antibody	Manufacturer	Isotype	Conc.	Species	Clone	Catalog no.	Lot no.
Mesp1-DyLight 405	Novus Biologicals	IgG	0.8 mg/mL	Rabbit	2030B	MAB9219 V	CKNQ01-1-050317-V
Isotype-DyLight 405	Novus Biologicals	IgG	1.05 mg/mL	Rabbit	NBP2-36463 V	NBP2-36463 V	31908-050317-V
Viobility 405/520	Miltenyi Biotec	n/a	n/a	n/a	n/a	130-109-814	5170315796
Islet1	Abcam	IgG1	0.83 mg/mL	Mouse	1H9	ab86472	GR273015-3
Fluorescein Labeling Kit	Novus Biologicals	n/a		n/a	10934	707-0030	1BS3384
Isotype-FITC	BioLegend	IgG1κ	0.5 mg/mL	Mouse	MOPC-21	400107	B199152
PDGFRα-PE	BioLegend	IgG1κ	100 μg/mL	Mouse	16A1	323505	B192368
Isotype-PE	BioLegend	IgG1κ	200 μg/mL	Mouse	MOPC-21	400113	B214532
cKit-DyLight 650	Novus Biologicals	IgG2Bκ	500 μg/mL	Mouse	2B8	NB100-77477C	B147020-A
Isotype-AlexaFluor 647	R&D Systems	IgG2B	10 μg/mL	Rat	141945	IC013R	AEIU0114121
SSEA1-APC/Vio 770	Miltenyi Biotec	IgG1	8.25 μg/mL	n/a	REA321	130-104-992	5161207356
REA Ctrl-APC/Vio 770	Miltenyi Biotec	IgG1	30 μg/mL	n/a	REA293	130-104-618	5170201560

Antibody	Manufacturer	Sample used (mg/mL)	Antibody dilution	Species	Clone	Catalog no.	Lot no.
GAPDH	Cell Signaling	0.4	1:50	Mouse	D4C6R	97166T	3
AKT (pan)	Cell Signaling	0.04	1:50	Rabbit	C67E7	4691S	17
Phospho-AKT (Ser473)	Cell Signaling	0.4	1:10	Rabbit	D9E	4060S	23
p44/42 MAPK (Erk1/2)	Cell Signaling	0.04	1:25	Rabbit	137F5	4695S	14
Phopsho-p44/42 MAPK (Erk1/2) (Th202/Ty204)	Cell Signaling	0.4	1:10	Rabbit	D13.14.4E	4370S	12
PKCα	Cell Signaling	0.04	1:25	Rabbit	Polyclonal	2056T	4
Phospho-PKCα/β II (Thr638/641)	Cell Signaling	0.04	1:10	Rabbit	Polyclonal	9375T	4

n/a, not applicable.

Simulated microgravity

A two-dimensional clinostat (BioServe Space Technologies, Boulder, CO) was used to simulate the effects of MG on Isl1+c-Kit+ CPCs, as previously described [4]. Clinorotation simulates MG by generating a state of relative motionlessness through the combined effects of gravity, centrifugation, and Brownian motion [18]. Using a rotation rate of 3.94 ± 0.01 rotations per minute, CPCs experienced a relative centrifugal force of <0.5 mG. Cells were seeded at a density of 200,000 cells per Opticell or Biocell, gassed with a mixture of 5% CO₂ and 95% air, and then subjected to clinorotation. After 6–7 days of clinorotation, cells were trypsinized, counted, and used for experiments. Controls were similarly seeded and grown under static conditions within a 5% CO₂ cell culture incubator for a matched period of time.

CPC culture aboard the ISS

For experiments described herein, neonatal CPCs derived from four unique neonates (1 day–1 month) were seeded into eight polystyrene Biocells (BioServe Space Technologies) containing 20 mL of growth media. Biocells were loaded into self-contained environments with 5% CO₂ and 95% air, and flown aboard SpaceX CRS-11 to the United States National Laboratory on the ISS. Three days after launch, the Biocells arrived at the National Laboratory, where they received fresh growth media and were placed in an incubator containing 5% CO₂ and 95% air.

Thereafter, fresh media were provided every 4–5 days, while aboard the ISS. Cells were either fixed with RNAProtect (Qiagen, Valencia, CA) after 12 days of culture on the ISS and stored at −80°C or fed and returned live to Earth after 30 days on the ISS. Cells that were returned live were immediately processed. Clone- and passage-matched ground controls were fed and treated in parallel with the feeding schedule and activities performed by our astronaut collaborator aboard the ISS.

Postflight sample processing

Upon landing and retrieval of the payload, live cells were trypsinized, counted, and used to generate protein lysates. After 30 days, Biocells cultured aboard the ISS or on the ground contained 1,126,000 ± 176,000 or 152,300 ± 46,700 CPCs, respectively. Biocells containing cells fixed and frozen in RNA protect were thawed at room temperature. The RNA protect was removed and centrifuged at 10,000 g at 4°C for 10 min. Biocells were disassembled and the culture membranes were then rinsed with TRIzol^® reagent (Life Technologies). RNA was purified from RNA protect samples using the RNeasy Mini Kit (Qiagen), as per the manufacturer's instructions, while total RNA was purified from TRIzol reagent using isopropanol- and ethanol-based precipitation. cDNA was generated and reverse transcription–polymerase chain reaction (RT-PCR) was performed as described below.

Quantitative RT-PCR

cDNA was prepared using 2 μg of RNA with Superscript III (Life Technologies). Quantitative real-time polymerase chain reaction was performed using Go-Taq^® qPCR Mastermix (Promega, Madison, WI) and the iCycler iQ™5 PCR Thermal Cycler (Bio-Rad, Hercules, CA) following a protocol of 94°C for 10 min followed by 45 cycles of 94°C for 15 s, 52–68°C (depending on the primer) for 60 s, and 72°C for 30 s. RT-PCR products were visualized using 1%–2% agarose gel electrophoresis and low mass DNA ladder (Invitrogen, Carlsbad, CA). Primers were designed using the National Center for Biotechnology Information Primer-BLAST program and obtained from Integrated DNA Technologies (Coralville, IA). Primers used in experiments are listed in Table 2.

Table 2.

Primer Pairs Used in Reverse Transcription–Polymerase Chain Reaction (Reported 5′ to 3′)

Gene	Forward sequence	Reverse sequence
ACTIN	TTTGAATGATGAGCCTTCGTCCCC	GTCTCAAGTCAGTGTACAGGTAAGC
CAMK2A	GTCCAGTTCCAGCGTTCAGTT	GTGGGGATTCAGGATGGTGG
CCND1	TGCTGGAGTCAAGCCTGCGC	AGGACATGCACACGGGCACG
CDC42	GGAGAAGCTGAGGTCATCATCAGA	GTCACGGGCCAGCTTTTCAG
cMYC	AAGACAGCGGCAGCCCGAAC	TGGGCGAGCTGCTGTCGTTG
CTNNB1	GCGGCGCCATTTTAAGCCTC	TGCACGTGTGGCAAGTTCTG
DUSP3	ATGCACGTCAACACCAATGC	ATGCTCAGGGCAGACTTGAC
GAPDH	TGCACCACCAACTGCTTAGC	GGCATGGACTGTGGTCATGAG
GATA4	GACAATCTGGTTAGGGGAAGC	ACACAATGCAAAACCCACGG
HCN4	CAGCCTCTTACGCCTGTTAC	CCAGGAGTTGTTCACCATGTTG
ISL1	CACAAGCGTCTCGGGATTGTGTTT	AGTGGCAAGTCTTCCGACAA
JUN	GTCCGCACTGATCCGCTCCG	GGGCTGCGCGCACAAGTTTC
MAPK1	TTCCCAGTTCTTGACCCCTG	GTACATACTGCCGCAGGTCA
MAPK3	ACCTACCTAAGGAGCGGCTG	GGCCTCAGCAAAGGAGAGAG
MAPK10	TTGCACTCTGACCATGTTGGTG	TCATCAACCATCCACTTCCTGTCT
MEIS1	GGACCAGTAGCTCACGTTGC	GATCGTCGTACCTTTGCGCC
MESP1	TAGGCCTCAGCGAGGAGAGT	TCCCTTGTCACTTGGGCTCC
NFKB1	GCAGATGGCCCATACCTTCAA	TTGTGAAGCTGCCAGTGCTA
NKX2-5	CGCCGCTCCAGTTCATAG	GGTGGAGCTGGAGAAGACAGA
PDGFRA	GCGCAATCTGGACACTGGGA	ATGGGGTACTGCCAGCTCAC
PIK3CA	AACAATGCCTCCACGACCAT	TCACGGTTGCCTACTGGTTC
PLCG1	GCCCGACATCTGCCAAAGAA	AGTCCATTGTCCACCACAAACT
POU5F1	AACCTGGAGTTTGTGCCAGGGTTT	TGAACTTCACCTTCCCTCCAACCA
PRKCA	TTTTCCCGGGCAACGACTC	CGCACCCGGACAAGAAAAAG
RELA	GCGAGAGGAGCACAGATACC	GGGGTTGTTGTTGGTCTGGA
SHOX2	CTTACGGCGTTCGTCTCCAA	GACACCTCCGTCAGTCGC
TBX3	TGGCCTACCATCCGTTCCTA	GGACATCCACTGTTCCCCAG
TBX5	CTCAGTCCCCCGGAACAAC	CACGTACCTCCCAGCTCAAG
TBX18	GGTGGCAGGTAATGCTGACT	ACTTGCATTGCCTTGCTTGG
TGFB1	GGGCTACCATGCCAACTTCT	GACACAGAGATCCGCAGTCC
WNT2B	TGGCGTGCACTCTCAGATTT	GACAAGATCAGTCCGGGTGG
WNT3A	CTGCCTGAGGGTGGGCTTTT	TGGAACCTTCCCAGCTCGAC
WNT5A	CTTCGCCCAGGTTGTAATTGAAGC	CTGCCAAAAACAGAGGTGTTATCC
WNT9A	CAGCAGCAAGTTCGTCAAGC	TTGCCCACCTCATGGAAAG
WNT11	TCAGAATGTTCTGCGGGACC	CCGAGTTCACTTGACGAGGC

RT² Profiler Array for SMG- and ISS-cultured CPCs

Gene expression changes in neonatal CPCs cultured under SMG were broadly assessed using the RT² profiler PCR array for the human epidermal growth factor/platelet-derived growth factor signaling pathway array plate (PAHS-040Z) following the manufacturer's instructions (Qiagen). We used custom array plates (CLAH22469A; Qiagen) as per the manufacturer's instructions to analyze gene expression changes in ISS-cultured neonatal CPCs that were relevant to Wnt, ERK, BMP/Smad, and Notch signaling; cytoskeletal maintenance; calcium handling; apoptosis and cell cycle; cardiac development and stemness; and regeneration.

For both array signaling plates, RNA was isolated and purified, of which 2 μg of RNA was reverse transcribed into cDNA as described above. cDNA was thoroughly mixed with 2 × RT2 SYBR Green Mastermix and RNase- and DNase-free water before being loaded into the profiler array plate. The array plate was placed in the iCycler iQ™5 PCR Thermal Cycler (Bio-Rad) and underwent a protocol of 95°C for 10 min and 40 cycles of 95°C for 15 s and 60°C for 1 min. Threshold cycle values were then analyzed for each individual clone using the Qiagen Data Analysis Center (http://qiagen.com/us/shop/genes-and-pathways/data-analysis-center-overview-page/) using GAPDH and ACTIN as housekeeping genes.

Since this analysis center performs only a two-tailed Student's t-test to calculate P-values, all fold changes for individual clones were exported to Prism and analyzed, as described below.

Western blot with protein simple

Following detachment, CPCs were homogenized using RIPA buffer containing phosphatase inhibitor cocktail (Millipore, Temecula, CA), followed by centrifugation at 14,000 g for 15 min at 4°C and collection of the supernatant for analysis. Total protein concentrations were determined using the Pierce Micro BCA Protein Assay Kit (Thermo Scientific, Rockford, IL). A capillary-based western blotting system (ProteinSimple Wes, San Jose, CA) was used to assess protein expression. All procedures were completed according to the manufacturer's instructions and default settings. The concentration of protein lysates, antibodies used in experiments, and antibody dilutions are indicated in Table 1. A positive control for phosphorylated Akt (Cell Signaling Technology, Danvers, MA; catalog number 9273S, lot number 20) was diluted 1:2.

The anti-rabbit and anti-mouse secondary antibodies included in the Wes Detection Module kit (ProteinSimple Wes) were used. All data were analyzed with the Compass Software associated with the Wes instrument (ProteinSimple Wes). Data were exported to Prism for further analysis, as described below.

Wnt5a treatment

Neonatal CPCs were grown until approximately 85% confluent and treated with 100 ng/mL recombinant human/mouse Wnt5a (R&D Systems, Minneapolis, MN) in CPC growth media for 1 h, a concentration and duration that were previously shown to induce protein kinase C activity [19]. Cells were then washed with phosphate-buffered saline and placed in TRIzol reagent or formed into protein lysates, as described by Abrahamsen and Lorens [20]. RT-PCR and western blotting were performed, as described above.

Statistical analysis

The Shapiro–Wilk test for normality was used to test the normality of data distribution. Student's t-test was used to compare the mean of all normally distributed data. Non-normally distributed data were compared using a Wilcoxon matched-pairs signed-rank text. For protein expression analysis, either Student's t-test or Mann–Whitney U test was used to compare the mean of normally or non-normally distributed data, respectively. All data are reported as the mean ± the standard error of the mean. Prism 7 version 7.02 (GraphPad, La Jolla, CA) was used for all statistical analyses. P values <0.05 were assumed to indicate statistical significance.

Results

CPCs derived from human neonates express markers of precardiovascular mesoderm

Neonatal CPCs express SSEA1 (Fig. 1A), PDGFRα (Fig. 1B), and Mesp1 (Fig. 1C). These clonal, early cardiovascular progenitors coexpress both Isl1 and cKit (Fig. 1D) and, as previously reported, can differentiate into all cardiovascular lineages [21]. Viability of CPCs was assessed using the Viobility 405/520 dye (Fig. 1E).

FIG. 1.

CPCs exhibit early cardiovascular developmental markers. Cells isolated from human tissue were screened for the expression of SSEA1 (A), PDGFRα (B), and Mesp1 (C) after being selected for the coexpression of Isl1 and c-Kit (D). CPCs were screened for viability (E) and used in subsequent assays. The concomitant expression of these select markers indicates a state of early and multipotent cardiovascular development [23]. CPC, cardiovascular progenitor cell.

Neonatal CPCs express markers of an earlier developmental state after SMG and spaceflight

Following culture under SMG for 6–7 days and aboard the ISS for 12 days, cardiogenesis-related gene expression was assessed in neonatal CPCs derived from human heart tissue and analyzed in the context of a modified version of a previously reported cardiac development profile [22] (Fig. 2).

FIG. 2.

SMG and spaceflight induce the expression of markers of an earlier developmental state in neonatal CPCs. Neonatal CPCs were cultured under SMG for 6–7 days and aboard the ISS for 12 days before being fixed in RNA protect, screened for the expression of markers of early development, and compared to a day 0–14 molecular cardiogenesis profile adapted from den Hartogh et al. [22] (A). SMG [(B), green] induced an earlier profile after 6–7 days than did culture aboard the ISS [(C), blue] after 12 days. Gel electrophoresis of the PCR products is shown. n = 3–9 per group. SMG, simulated microgravity; ISS, International Space Station.

We observed increased expression of WNT5A, MEIS1, and PDGFRA, but decreased expression of ISL1, NKX2-5, GATA4, and TBX18 (Fig. 2B) in SMG-cultured CPCs. The black box indicates the control profile of gene expression, whereas the green box indicates the approximate SMG profile of gene expression. Meanwhile, we observed similar changes in WNT5A and ISL1 expression under MG, but less pronounced changes in the remaining markers (Fig. 2C). This led to a modestly dedifferentiated cardiac developmental gene expression profile in ISS-cultured CPCs (blue box) compared to SMG-cultured CPCs (green box).

SMG promotes expression of genes involved in noncanonical Wnt/Ca²⁺ signaling

Since the induction of early cardiac genes under reduced gravity conditions may represent enhanced stemness, we sought to identify the mechanism by which such changes occurred. Previous reports of RhoA as a gravity-sensing molecule led us to assess the involvement of small RhoGTPases in mediating the effects of SMG on neonatal CPCs.

We observed significantly decreased expression of RHOA (0.041 ± 0.014-fold change, P < 0.001, n = 4) and CDC42 (0.074 ± 0.001-fold change, P < 0.05, n = 3) (Fig. 3A). Given the role of small RhoGTPases in planar cell polarity Wnt signaling, we evaluated the expression of both canonical and noncanonical Wnt ligands in neonatal CPCs cultured under SMG. In doing so, we identified no change in the expression of the canonical Wnt ligand WNT3A (2.260 ± 0.154-fold change, P = 0.063, n = 3) or of GSK3B (4.308 ± 1.599-fold change, P = 0.131, n = 4), which sequesters β-catenin for degradation. Meanwhile, we identified a significant decrease in the transcript level of the canonical Wnt effector CTNNB1 (0.017 ± 0.002-fold change, P < 0.01, n = 3) (Fig. 3B).

FIG. 3.

SMG induces noncanonical Wnt/Ca²⁺ signaling gene expression. The reduced expression of small RhoGTPases under SMG (A) led us to measure expression of genes in the canonical Wnt pathway (B) and noncanonical Wnt ligands (C), which were induced. The suppression of small RhoGTPase expression and canonical Wnt signaling (D) prompted us to explore the noncanonical Wnt/Ca²⁺ pathway, whose transcripts were elevated (E). Modified calcium signaling can impact the ERK/MAPK and AKT/PI3K (F) pathways. n = 3–9 per group, *P < 0.05, **P < 0.01, ***P < 0.001. Changes in gene expression are shown as the mean ± SEM. SEM, standard error of the mean; ERK, extracellular signal-regulated kinase.

In the absence of canonical Wnt signaling, we examined the expression of noncanonical Wnt ligands and found an induction in WNT5A expression (37.190 ± 16.330-fold change, P < 0.05, n = 6) and a general increase in WNT9A expression (69.910 ± 33.430-fold change, P = 0.063, n = 6) (Fig. 3C). Given the relationship between intracellular calcium handling and planar cell polarity signaling (Fig. 3D), we evaluated changes to the transcript levels in the noncanonical Wnt/Ca²⁺ pathway (Fig. 3E): PLCG1 (15.870 ± 8.571-fold change, P = 0.092, n = 3), PRKCA (17.560 ± 7.246-fold change, P < 0.05, n = 3), and the transcription factor NFATC3 (14.180 ± 6.318-fold change, P = 0.055, n = 3).

Activation of ERK and AKT pathways in association with SMG signaling in CPCs

The pleiotropic nature of calcium signaling can impact other signaling pathways (Fig. 3F). Therefore, we sought to identify additional pathways that might be affected following exposure to SMG. MAPK/ERK-related transcripts were expressed at higher levels (Fig. 4A, B). In particular, MAPK/ERK pathway inducer [TGFB1 (29.130 ± 3.637-fold change, P < 0.05, n = 3)] and transducer genes [MAPK3 (12.050 ± 8.644-fold change, P < 0.05, n = 3), MAPK8 (14.320 ± 6.291-fold change, P < 0.05, n = 3), and MAPK9 (4.624 ± 0.571-fold change, P < 0.001, n = 3)] were all expressed at elevated levels. However, targets of MAPK/ERK signaling were not significantly altered: GRB2 (9.395 ± 5.715-fold change, P = 0.280, n = 3), RAF1 (18.750 ± 13.840-fold change, P = 0.290, n = 3), and ELK1 (9.105 ± 4.203-fold change, P = 0.194, n = 3).

FIG. 4.

AKT and ERK/MAPK signaling pathway constituent genes induced by SMG. Transcripts of genes involved in ERK/MAPK signaling activation and transduction (A) as well as targets (B) were all elevated. Similar increases in transcript levels of genes involved in AKT signaling and activation were observed (C). n = 3–4 per group, *P < 0.05, **P < 0.01, ***P < 0.001. Changes in gene expression are shown as the mean ± SEM.

Similarly, AKT-related signaling genes were induced, including AKT1 (10.620 ± 3.065-fold change, P < 0.05, n = 4), AKT3 (10.120 ± 0.839-fold change, P < 0.01, n = 3), and PIK3CA (9.334 ± 1.196-fold change, P < 0.01, n = 4), which promote Akt phosphorylation (ie, activation). AKT/PI3K pathway activation also enhances the stability of cyclin D1 (CCND1) and c-Jun, which facilitate G1-to-S cell cycle transition, while also targeting NFκB during antiapoptotic signaling. We then assessed changes in the levels of transcripts for Akt pathway targets (Fig. 4C).

Flight aboard the ISS activates PKCα in neonatal CPCs

These observations in SMG prompted us to determine whether calcium handling and signaling were altered by spaceflight. We evaluated the expression of genes involved in regulating intracellular calcium levels and subsequent signaling events in neonatal CPCs after flight aboard the ISS and observed significantly elevated levels of RYR2 (5.265 ± 1.508-fold change, P < 0.05, n = 3), CACNA1S (8.059 ± 1.771-fold change, P < 0.05, n = 3), and CAMK2A (5.979 ± 1.289-fold change, P < 0.05, n = 3) (Fig. 5A).

FIG. 5.

Spaceflight activates PKCα in neonatal CPCs after 30 days. After 12 days aboard the ISS, neonatal CPCs were fixed and induction of genes involved in calcium handling was measured by RT-PCR (A). Calcium handling alterations at 12 days led to the induction of genes involved in calcium signaling at 30 days (B). Protein lysates were made from pooled neonatal clones after 30 days aboard the ISS and phosphorylated PKCαβ, PKCα, and GAPDH protein levels were determined in technical replicates (C, D). ISS culture mediates changes to calcium signaling that impact cardiogenesis (E). n = 3 per group for RT-PCR and n = 3 measurements of four pooled neonatal clones for protein analysis; *P < 0.05, **P < 0.01, ***P < 0.001. Fold changes are shown as the mean ± SEM. PKCα, protein kinase C alpha; RT-PCR, reverse transcription–polymerase chain reaction.

Changes in calcium handling at 12 days suggested an ultimate induction of calcium signaling at 30 days, which was supported by significantly elevated levels of PLCG1 (6.041 ± 0.527-fold change, P < 0.01, n = 3), PRKCA (4.482 ± 0.617-fold change, P < 0.01, n = 3), and CAMK2A (3.982 ± 0.540-fold change, P < 0.01, n = 3) transcripts (Fig. 5B). Moreover, we assessed a significant increase in phosphorylated protein kinase C alpha (PKCα), a calcium-dependent protein kinase C (P-PKCα: 1.448 ± 0.065-fold change, P < 0.01; P-PKCα/PKCα: 1.298 ± 0.058-fold change, P < 0.05; P-PKCα/GAPDH: 1.466 ± 0.088-fold change, P < 0.05; n = 3–4) after 30 days of ISS culture (Fig. 5C, D). Such ISS-mediated changes to calcium signaling may have a direct impact on cardiogenesis, as shown in the schematic in Fig. 5E.

Flight aboard the ISS activates Akt in neonatal CPCs

These findings of increased expression of calcium-related signaling prompted us to assess the role of calcium-sensitive pathways that are pertinent to stem cell physiology (ie, ERK and Akt). We assessed the expression of Akt-related signaling genes in neonatal CPCs after 12 and 30 days of flight aboard the ISS. At 12 days, we observed significantly elevated levels of PIK3CA (2.216 ± 0.343-fold change, P < 0.01, n = 9), cMYC (4.811 ± 1.341-fold change, P < 0.05, n = 9), and NFκB1 (2.704 ± 0.528-fold change, P < 0.05, n = 9). At 30 days, we observed significantly elevated levels of PIK3CA (7.764 ± 0.472-fold change, P < 0.001, n = 3), CCNDI (3.257 ± 0.195-fold change, P < 0.01, n = 3), cMYC (3.297 ± 0.309-fold change, P < 0.01, n = 9), JUN (4.997 ± 0.213-fold change, P < 0.001, n = 3), NFκB1 (5.935 ± 0.830-fold change, P < 0.01, n = 3), and RELA (2.799 ± 0.291-fold change, P < 0.01, n = 3) (Fig. 6A).

FIG. 6.

Spaceflight activates Akt signaling in neonatal CPCs after 30 days. After 12 and 30 days aboard the ISS, neonatal CPCs were fixed and gene expression along the Akt pathway was measured by RT-PCR (A). Protein lysates were made from pooled neonatal clones after 30 days aboard the ISS and phosphorylated Akt, Akt, and GAPDH protein levels were determined in technical replicates (B, C). n = 3–9 per group for RT-PCR and n = 3 measurements of four pooled neonatal clones for protein analysis; *P < 0.05, **P < 0.01, ***P < 0.001. Fold changes are shown as the mean ± SEM.

Protein expression analysis revealed an induction of phosphorylated Akt following spaceflight when normalized to GAPDH or analyzed as total substrate (P-AKT: 1.573 ± 0.152-fold change, P < 0.05; P-AKT/GAPDH: 1.812 ± 0.176-fold change, P < 0.05; n = 3) after 30 days of ISS culture. Notably, Akt phosphorylation only trended toward an increase when normalized to pan-Akt (P-AKT/AKT: 1.211 ± 0.117-fold change, P = 0.189, n = 3) (Fig. 6B, C).

ERK/MAPK is not activated in neonatal CPCs by spaceflight

This change in Akt activity prompted us to investigate whether ERK/MAPK signaling was altered by spaceflight. We evaluated the expression of ERK/MAPK-related signaling genes in neonatal CPCs after 12 and 30 days of flight aboard the ISS (Fig. 7A). At 12 days, we observed significantly reduced levels of DUSP3 (0.280 ± 0.126-fold change, P < 0.01, n = 3), which encodes a phosphatase involved in the deactivation of ERK/MAPK signaling. Interestingly, the targets of ERK/MAPK signaling were also elevated: GRB2 (11.660 ± 2.709-fold change, P < 0.05, n = 3) and RAF1 (5.230 ± 0.762-fold change, P < 0.01, n = 3) (Fig. 7B). However, at 30 days, the induction of genes along this signaling pathway was muted. Moreover, we observed no increase in phosphorylated ERK after 30 days of ISS culture (Fig. 7C, D).

FIG. 7.

Spaceflight does not activate Erk signaling in neonatal CPCs after 30 days. After 12 and 30 days aboard the ISS, neonatal CPCs were fixed and gene expression along the ERK/MAPK pathway was measured by RT-PCR. At 12 days, the ERK/MAPK pathway (A) and target (B) gene expression were generally elevated; however, at 30 days, such pathway gene expression was largely muted (A). Protein lysates were generated from pooled neonatal clones after 30 days aboard the ISS and phosphorylated ERK1/2, ERK1/2, and GAPDH protein levels were determined in technical replicates (C, D). n = 3 per group for RT-PCR and n = 3–4 measurements of four pooled neonatal clones for protein analysis; *P < 0.05, **P < 0.01. Fold changes are shown as the mean ± SEM.

Ca²⁺ signaling contributes to induction of genes involved in early cardiogenesis

Given the role of calcium signaling in mediating the effects of spaceflight in neonatal CPCs, we sought to assess the effects of such signaling on the ground. Neonatal CPCs were treated with recombinant hWnt5a (100 ng/mL) for 1 h, which is a concentration and duration that were previously shown to induce PKC activity [19]. We then investigated the induction of noncanonical Wnt ligands (Fig. 8A) and calcium signaling genes (Fig. 8B): WNT5A (3.027 ± 0.087-fold change, P < 0.01, n = 3), WNT9A (4.587 ± 0.485-fold change, P < 0.05, n = 3), WNT11 (3.713 ± 0.297-fold change, P < 0.05, n = 3), PLCG1 (4.609 ± 0.544-fold change, P < 0.05, n = 3), PRKCA (28.190 ± 2.658-fold change, P < 0.01, n = 3), and CAMK2A (342.700 ± 37.760-fold change, P < 0.05, n = 3).

FIG. 8.

Noncanonical Wnt/Ca²⁺ signaling impacts the developmental phenotype of neonatal CPCs. Wnt5a treatment of neonatal CPCs for 1 h induces expression of noncanonical Wnt ligands (A), genes involved in the noncanonical Wnt/Ca²⁺ pathway (B), and calcium-dependent PKCα activation (C, D). Induction of genes along this pathway occurred concomitantly with modifications in expression of markers of early cardiogenesis (E). The primordial phenotype of Wnt5a-treated CPCs included the induction of sinoatrial nodal genes (F), which was also observed under SMG (G). n = 3; *P < 0.05, **P < 0.01, ***P < 0.001. Changes in gene expression are shown as the mean ± SEM.

The induction of PKCα phosphorylation indicated the presence of calcium activity [(P-PKC/PKC: 1.635 ± 0.072-fold change, P < 0.05, n = 3; (Fig. 8C, D)]. This occurred concomitantly with the induction of early developmental genes (Fig. 8E), including the pluripotency marker POU5F1 (3.453 ± 0.194-fold change, P < 0.05, n = 3) and the mesodermal marker MESP1 (23.760 ± 1.230-fold change, P < 0.01, n = 3).

Sinoatrial nodal genes and Hcn4 are induced by calcium pathway activity

Increasing evidence indicates that sinoatrial nodal cells represent a population of embryonic myocardium that retains its primitive phenotype [24]. For this reason, we assessed the relationship between primordial cardiogenesis gene induction and that of the sinoatrial nodal gene program in Wnt5-treated CPCs (Fig. 8F). In doing so, we observed significant increases in the expression of TBX3 (5.212 ± 0.917-fold change, P < 0.05, n = 3), TBX5 (7.678 ± 0.178-fold change, P < 0.01, n = 3), SHOX2 (6.318 ± 0.813-fold change, P < 0.05, n = 3), and HCN4 (9.489 ± 1.191-fold change, P < 0.05, n = 3) along with decreased expression of NKX2-5 (0.237 ± 0.044-fold change, P < 0.05, n = 3).

A similar induction of the sinoatrial nodal gene program was observed in SMG-treated CPCs: TBX3 (141.600 ± 54.550-fold change, P < 0.05, n = 3), TBX5 (35.620 ± 4.667-fold change, P < 0.05, n = 3), HCN4 (48.510 ± 18.710-fold change, P < 0.05, n = 3), and NKX2-5 (0.146 ± 0.042-fold change, P < 0.001, n = 3) (Fig. 8G).

Discussion

Both SMG and culture aboard the ISS induced the expression of markers of early cardiovascular development along with genes involved in calcium signaling, although to different extents. While WNT5A and PRKCA induction occur along with that of ERK and Akt in SMG, neonatal CPCs that were cultured aboard the ISS exhibited increases in calcium-dependent protein kinase C (PKCα) activation along with only increased Akt activation. This increase in calcium signaling was modeled in vitro on Earth using hWnt5a, a noncanonical ligand that promotes protein kinase C activation. In doing so, we observed an important role in calcium signaling in accounting for the effects, at least in part, of spaceflight within neonatal CPCs.

Across models and culture systems, molecular biologists have increasingly identified the role of small RhoGTPases in mediating the response of cells to a reduced gravity environment [7,8]. RhoA and CDC42 are small RhoGTPases that associate with the actin cytoskeleton [25], participate in the noncanonical Wnt planar cell polarity pathway [26], and modulate intracellular calcium potentiation [27]. Other experiments have identified alterations to small RhoGTPases, such as the suppression of RhoA in mesenchymal stem cells (MSCs), in response to SMG [28]. Elsewhere, researchers have reported the involvement of the primary cilium, which coordinates the early molecular events of cardiogenesis [29], as a sensor of cell–cell contact and altered mechanical stress [30]. Interestingly, RhoA activity was found to be related to ciliogenesis [31], further supporting the hypothesis that small RhoGTPases have an important role in cardiac development

Ultimately, this reduction in RHOA expression logically follows from the reduced mechanical stress that is expected under MG conditions. Accordingly, mechanotransduction-induced changes in RhoA expression would be expected to impact calcium handling. Indeed, substrate rigidity (or the lack thereof in this context), has been shown to directly impact calcium oscillations within MSCs. Using fluorescence resonance energy transfer, Kim et al. [27] observed changes to Ca²⁺ oscillation in accordance with changes to the stiffness of the MSC culture environment.

Similarly, we found that calcium pathway genes and those related to calcium handling were expressed at higher levels following culture aboard the ISS as well as under SMG, although to a more modest extent. These changes in calcium extend beyond human CPCs. During spaceflight, calcium loss is widely observed in astronauts and usually linked to changes in bone metabolism [32]. Yet, in one animal model of SMG, mice were observed to exhibit an increased incidence of arrhythmias along with alterations in intracellular calcium handling, including ryanodine receptor (RyR2) phosphorylation [33]. Moreover, short-duration atrial fibrillation, premature ventricular contractions, and ventricular tachycardia have all been reported in astronauts during spaceflight [34]. Importantly, while the etiology of such cardiac events during spaceflight remains unknown, disturbances in calcium handling may be an important contribution to cardiac abnormalities in space.

Meanwhile, the modification of signaling pathways related to calcium, either as an important secondary or mediating molecule, directly impacts the ability of CPCs to differentiate or maintain pluripotency [35,36]. The effect of calcium signaling is dependent both on the pathway in which it is involved as well as the species under study, with mESCs exhibiting far different responses to calcium-mediated activity compared to human ESCs (hESCs). For example, calcium signaling promotes pluripotency in hESCs, while being affiliated with differentiation in mESCs [35].

In the context of cardiogenesis, studies performed in both embryos and ESC-derived cardiomyocytes have shown a critical role of Ca²⁺ in regulating multiple steps of heart formation [12]. For example, induction of Ca²⁺ oscillation promotes proliferation and, upon transplantation, enhances engraftment and expansion [37]. In this way, our observed shift in expression of markers of early cardiac development is likely the result, at least in part, of modified calcium signaling activity within neonatal CPCs. Furthermore, research into Mesp1-expressing precardiac mesoderm derived from hESCs exhibited enriched activity along the calcium, extracellular matrix receptor, and Wnt signaling pathways at day 5 of development [22], which is supported by our observed increase in markers of such a state of development after culture aboard the ISS and using SMG (Fig. 2).

Meanwhile, Akt signaling by calcium activation has been well documented to promote the maintenance of pluripotency in hESCs [35]. In addition, Akt signaling exerts a critical role in several cell functions that are relevant to stem cell transplantation, migration, and cytokine expression [38]. Therefore, manipulating calcium signaling on Earth and promoting Akt activation present a novel therapeutic opportunity for cell-based cardiac repair.

In addition to modifying intracellular calcium signaling, the expression of noncanonical Wnt ligands has been observed in association with the cryoinjury response of the neonatal rodent heart [39]. Since WNT5A and PRKCA gene expression induction is involved in the response of neonatal CPCs to SMG, we sought to assess the potential role of Wnt5a in promoting enhanced stemness in CPCs. While preliminary, these early results indicate a relationship between enhanced intracellular calcium signaling as well as an increased expression of markers of early cardiogenesis in neonatal CPCs. The expression of early cardiogenic mesoderm markers indicates a potentially earlier developmental state.

In addition to being linked to enhanced therapeutic potential following transplantation [40 –43], such an early developmental state may also provide the appropriate cell source for biological pacemaker development. In an avian model, Bressan et al. used fate mapping to determine that sinoatrial nodal cells were observed to already be specified shortly after gastrulation before the onset of cardiogenesis within a region that was observed to be Nkx2-5 and Isl1 negative [44]. Meanwhile, the Keller group recently reported a method of generating sinoatrial nodal-like pacemaker cells in Nkx2-5-negative cardiomyocytes [45]. Similarly, we observed decreased NKX2-5 and ISL1 expression under both SMG and MG.

When considered together, our findings using simulated and real MG support the emerging hypothesis that sinoatrial nodal cells represent a dedifferentiated/undifferentiated state of cardiac development [24]. Moreover, our observation that calcium signaling has an integral role in this process is mirrored by observations that Wnt7a, which mobilizes intracellular calcium [46], has been observed in the developing cardiac conduction system [47]. Given the observed changes to the expression of calcium handling genes and proteins, future studies should assess the effect of SMG and ISS culture on intracellular Ca²⁺ transients and the electrophysiological properties of CPCs.

Importantly, many of these processes observed under SMG and MG are dependent upon the developmental status of the cell. Indeed, later stages of cardiogenesis and the incipient developmental cues of ESCs respond differently to calcium and Wnt signaling [48 –50]. Therefore, understanding the effects of mechanical transduction and altered intracellular calcium signaling within the myriad cell types that constitute the human body will help inform medical interventions that will be necessary to sustain deep space missions. Meanwhile, the molecular events that constitute MG sensing can be manipulated on Earth to facilitate regeneration. In doing so, MG-inspired, cell-based therapies can be developed.

Footnotes

Acknowledgments

We thank Peggy Whitson for performing cell culture experiments aboard the ISS. We thank Carla V. Hoehn, Stephanie Countryman, and BioServe Space Technologies for their assistance with cell culture hardware development, preparation, and deployment. Funding for this experiment was provided by the Center for Advancement of Science in Space (grant no. GA-2014-130 to M.K.J.).

Prior Conference Presentations: Simulated microgravity data were presented, in part, at the 2016 International Space Station Research and Development Conference (San Diego, CA) and at the 2015 and 2016 World Stem Cell Summits (Atlanta, GA and West Palm Beach, FL).

Author Disclosure Statement

No competing financial interests exist.

References

Mitsuhara

, Takeda

, Yamaguchi

, Manabe

, Matsumoto

, Kawahara

, Yuge

and Kurisu

. (2013). Simulated microgravity facilitates cell migration and neuroprotection after bone marrow stromal cell transplantation in spinal cord injury. Stem Cell Res Ther, 4:35.

Hwang

Y-S

, Cho

, Tay

, Heng

JYY

, Ho

, Kazarian

, Williams

, Boccaccini

, Polak

and Mantalaris

. (2009). The use of murine embryonic stem cells, alginate encapsulation, and rotary microgravity bioreactor in bone tissue engineering. Biomaterials, 30:499–507.

Yuge

, Kajiume

, Tahara

, Kawahara

, Umeda

, Yoshimoto

, Wu

S-L

, Yamaoka

, Asashima

, Kataoka

and Ide

. (2006). Microgravity potentiates stem cell proliferation while sustaining the capability of differentiation. Stem Cells Dev, 15:921–929.

Fuentes

, Appleby

, Raya

, Bailey

, Hasaniya

, Stodieck

and Kearns-Jonker

. (2015). Simulated microgravity exerts an age-dependent effect on the differentiation of cardiovascular progenitors isolated from the human heart. PLoS One, 10:e0132378.

Blaber

, Finkelstein

, Dvorochkin

, Sato

, Yousuf

, Burns

, Globus

and Almeida

. (2015). Microgravity reduces the differentiation and regenerative potential of embryonic stem cells. Stem Cells Dev, 24:2605–2621.

Jha

, Wu

, Singh

, Preininger

, Han

, Ding

, Cho

, Jo

, Maher

, Wagner

and Xu

. (2016). Simulated microgravity and 3D culture enhance induction, viability, proliferation and differentiation of cardiac progenitors from human pluripotent stem cells. Sci Rep, 6:30956.

Meyers

, Zayzafoon

, Douglas

and McDonald

. (2005). RhoA and cytoskeletal disruption mediate reduced osteoblastogenesis and enhanced adipogenesis of human mesenchymal stem cells in modeled microgravity. J Bone Miner Res, 20:1858–1866.

Louis

, Deroanne

, Nusgens

, Vico

and Guignandon

. (2015). RhoGTPases as key players in mammalian cell adaptation to microgravity. Biomed Res Int, 2015:747693.

Gocher

, Azabdaftari

, Euscher

, Dai

, Karacosta

, Franke

and Edelman

. (2014). Akt activation by Ca²⁺/calmodulin-dependent protein kinase 2 (CaMKK2) in ovarian cancer cells. J Biol Chem, 292:14188–14204.

10.

Schonwasser

, Marais

, Marshall

and Parker

. (1998). Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes. Mol Cell Biol, 18:790–798.

11.

Romorini

, Garate

, Neiman

, Luzzani

, Furmento

, Guberman

, Sevlever

, Scassa

and Miriuka

. (2016). AKT/GSK3β signaling pathway is critically involved in human pluripotent stem cell survival. Sci Rep, 6:35660.

12.

Pucéat

and Jaconi

. (2005). Ca²⁺ signalling in cardiogenesis. Cell Calcium, 38:383–389.

13.

Bolli

, Chugh

, D'Amario

, Loughran

, Stoddard

, Ikram

, Beache

, Wagner

, Leri

, et al. (2011). Cardiac stem cells in patients with ischaemic cardiomyopathy (SCIPIO): initial results of a randomised phase 1 trial. Lancet, 378:1847–1857.

14.

Makkar

, Smith

, Cheng

, Malliaras

, Thomson

, Berman

, Czer

, Marbán

, Mendizabal

, et al. (2012). Intracoronary cardiosphere-derived cells for heart regeneration after myocardial infarction (CADUCEUS): a prospective, randomised phase 1 trial. Lancet, 379:895–904.

15.

Gerbin

and Murry

. (2015). The winding road to regenerating the human heart. Cardiovasc Pathol, 24:133–140.

16.

Hong

, Guo

, Li

, Cao

, Al-Maqtari

, Vajravelu

, Du

, Book

, Zhu

, et al. (2014). c-kit+ cardiac stem cells alleviate post-myocardial infarction left ventricular dysfunction despite poor engraftment and negligible retention in the recipient heart. PLoS One, 9:e96725.

17.

Fuentes

, Appleby

, Tsay

, Martinez

, Bailey

, Hasaniya

and Kearns-Jonker

. (2013). Human neonatal cardiovascular progenitors: unlocking the secret to regenerative ability. PLoS One, 8:e77464.

18.

Klaus

, Todd

and Schatz

. (1998). Functional weightlessness during clinorotation of cell suspensions. Adv Space Res, 21:1315–1318.

19.

Koyanagi

, Iwasaki

, Haendeler

, Leitges

, Zeiher

and Dimmeler

. (2009). Wnt5a increases cardiac gene expressions of cultured human circulating progenitor cells via a PKC delta activation. PLoS One, 4:1–7.

20.

Abrahamsen

and Lorens

. (2013). Evaluating extracellular matrix influence on adherent cell signaling by cold trypsin phosphorylation-specific flow cytometry. BMC Cell Biol, 14:36.

21.

Baio

, Walden

, Fuentes

, Lee

, Hasaniya

, Bailey

and Kearns-Jonker

. (2017). A hyper-crosslinked carbohydrate polymer scaffold facilitates lineage commitment and maintains a reserve pool of proliferating cardiovascular progenitors. Transplant Direct, 3:e153.

22.

den Hartogh

, Wolstencroft

, Mummery

and Passier

. (2016). A comprehensive gene expression analysis at sequential stages of in vitro cardiac differentiation from isolated MESP1-expressing-mesoderm progenitors. Sci Rep, 6:19386.

23.

Tian

, Liu

, Gnatovski

, Ma

and Wang

. (2015). Heart regeneration with embryonic cardiac progenitor cells and cardiac tissue engineering. J Stem Cell Transplant Biol, 1:104.

24.

Bakker

, Christoffels

and Moorman

. (2010). The cardiac pacemaker and conduction system develops from embryonic myocardium that retains its primitive phenotype. J Cardiovasc Pharmacol, 56:6–15.

25.

Cenni

, Sirri

, Riccio

, Lattanzi

, Santi

, de Pol

, Maraldi

and Marmiroli

. (2003). Targeting of the Akt/PKB kinase to the actin skeleton. Cell Mol Life Sci, 60:2710–2720.

26.

Komiya

and Habas

. (2008). Wnt signal transduction pathways. Organogenesis, 4:68–75.

27.

Kim

, Seong

, Ouyang

, Sun

, Lu

, Hong

, Wang

and Wang

. (2009). Substrate rigidity regulates Ca²⁺ oscillation via RhoA pathway in stem cells. J Cell Physiol, 218:285–293.

28.

Seki

, Imamizo-Sato

, Yamazaki

, Ishioka

and Higashibata

. (2006). Suppression of Rho activation process due to simulated microgravity induced cytoskeletal disorganization. Biol Sci Space, 20:75–79.

29.

Clement

, Kristensen

, Møllgård

, Pazour

, Yoder

, Larsen

and Christensen

. (2009). The primary cilium coordinates early cardiogenesis and hedgehog signaling in cardiomyocyte differentiation. J Cell Sci, 122:3070–3082.

30.

Moorman

, Shimada

, Sokunbi

and Pfirrmann

. (2007). Simulated-microgravity induced changes in gene expression in zebrafish embryos suggest that the primary cilium is involved in gravity transduction. Gravit Space Res, 20:79–86.

31.

Pan

, You

, Huang

and Brody

. (2007). RhoA-mediated apical actin enrichment is required for ciliogenesis and promoted by Foxj1. J Cell Sci, 120:1868–1876.

32.

Smith

, McCoy

, Gazda

, Morgan

JLL

, Heer

and Zwart

. (2012). Space flight calcium: implications for astronaut health, spacecraft operations, and Earth. Nutrients, 4:2047–2068.

33.

Respress

, Gershovich

, Wang

, Reynolds

, Skapura

, Sutton

, Miyake

and Wehrens

XHT

. (2014). Long-term simulated microgravity causes cardiac RyR2 phosphorylation and arrhythmias in mice. Int J Cardiol, 176:994–1000.

34.

Anzai

, Frey

and Nogami

. (2014). Cardiac arrhythmias during long-duration spaceflights. J Arrhythmia, 30:139–149.

35.

Tonelli

FMP

, Santos

, Gomes

, da Silva

, Gomes

, Ladeira

and Resende

. (2012). Stem cells and calcium signaling. Adv Exp Med Biol, 740:891–916.

36.

Apati

, Berecz

and Sarkadi

. (2016). Calcium signaling in human pluripotent stem cells. Cell Calcium, 59:117–123.

37.

Ferreira-Martins

, Rondon-Clavo

, Tugal

, Korn

, Rizzi

, Padin-Iruegas

, Ottolenghi

, De Angelis

, Urbanek

, et al. (2009). Spontaneous calcium oscillations regulate human cardiac progenitor cell growth. Circ Res, 105:764–774.

38.

Manning

and Cantley

. (2007). AKT/PKB signaling: navigating downstream. Cell, 129:1261–1274.

39.

Mizutani

, Wu

and Nusse

. (2016). Fibrosis of the neonatal mouse heart after cryoinjury is accompanied by Wnt signaling activation and epicardial-to-mesenchymal transition. J Am Heart Assoc, 5:e002457.

40.

Menasché

, Vanneaux

, Hagège

, Bel

, Cholley

, Cacciapuoti

, Parouchev

, Benhamouda

, Tachdjian

, et al. (2015). Human embryonic stem cell-derived cardiac progenitors for severe heart failure treatment: first clinical case report. Eur Heart J, 36:2011–2017.

41.

Behfar

, Yamada

, Crespo-Diaz

, Besbitt

, Rowe

, Perez-Terzic

, Gausiin

, Homsy

, Bartunek

and Terzic

. (2010). Guided cardiopoiesis enhances therapeutic benefit of bone marrow human mesenchymal stem cells in chronic myocardial infarction. J Am Coll Cardiol, 56:721–734.

42.

Bartunek

, Behfar

, Dolatabadi

, Vanderheyden

, Ostojic

, Dens

, Nakadi

, Banovic

, Beleslin

, et al. (2013). Cardiopoietic stem cell therapy in heart failure: the C-CURE (Cardiopoietic stem Cell therapy in heart failURE) multicenter randomized trial with lineage-specified biologics. J Am Coll Cardiol, 61:2329–2338.

43.

Blin

, Nury

, Stefanovic

, Neri

, Guillevic

, Brinon

, Bellamy

, Rücker-Martin

, Barbry

, et al. (2010). A purified population of multipotent cardiovascular progenitors derived from primate pluripotent stem cells engrafts in postmyocardial infarcted nonhuman primates. J Clin Invest, 120:1125–1139.

44.

Bressan

, Liu

and Mikawa

. (2013). Early mesodermal cues assign avian cardiac pacemaker fate potential in a tertiary heart field. Science, 340:744–748.

45.

Protze

, Liu

, Nussinovitch

, Ohana

, Backx

, Hepstein

and Keller

. (2017). Sinoatrial node cardiomyocytes derived from human pluripotent cells function as a biological pacemaker. Nat Biotechnol, 35:56–68.

46.

Thrasivoulou

, Millar

and Ahmed

. (2013). Activation of intracellular calcium by multiple Wnt ligands and translocation of β-catenin into the nucleus: a convergent model of Wnt/Ca²⁺ and Wnt/β-catenin pathways. J Biol Chem, 288:35651–35659.

47.

Gessert

and Kuhl

. (2010). The multiple phases and faces of Wnt signaling during cardiac differentiation and development. Circ Res, 107:186–199.

48.

Ueno

, Weidinger

, Osugi

, Kohn

, Golob

, Pabon

, Reinecke

, Moon

and Murry

. (2007). Biphasic role for Wnt/β-catenin signaling in cardiac specification in zebrafish and embryonic stem cells. Proc Natl Acad Sci U S A, 104:9685–9690.

49.

Cohen

, Tian

and Morrisey

. (2008). Wnt signaling: an essential regulator of cardiovascular differentiation, morphogenesis, and progenitor self-renewal. Development, 135:789–798.

50.

Ozhan

and Weidinger

. (2015). Wnt/β-catenin signaling in heart regeneration. Cell Regen (Lond), 4:3.

Spaceflight Activates Protein Kinase C Alpha Signaling and Modifies the Developmental Stage of Human Neonatal Cardiovascular Progenitor Cells

Abstract

Introduction

Materials and Methods

Isolation and culture of early CPCs

Flow cytometry

Simulated microgravity

CPC culture aboard the ISS

Postflight sample processing

Quantitative RT-PCR

RT2 Profiler Array for SMG- and ISS-cultured CPCs

Western blot with protein simple

Wnt5a treatment

Statistical analysis

Results

CPCs derived from human neonates express markers of precardiovascular mesoderm

Neonatal CPCs express markers of an earlier developmental state after SMG and spaceflight

SMG promotes expression of genes involved in noncanonical Wnt/Ca2+ signaling

Activation of ERK and AKT pathways in association with SMG signaling in CPCs

Flight aboard the ISS activates PKCα in neonatal CPCs

Flight aboard the ISS activates Akt in neonatal CPCs

ERK/MAPK is not activated in neonatal CPCs by spaceflight

Ca2+ signaling contributes to induction of genes involved in early cardiogenesis

Sinoatrial nodal genes and Hcn4 are induced by calcium pathway activity

Discussion

Footnotes

Acknowledgments

Author Disclosure Statement

References

RT² Profiler Array for SMG- and ISS-cultured CPCs

SMG promotes expression of genes involved in noncanonical Wnt/Ca²⁺ signaling

Ca²⁺ signaling contributes to induction of genes involved in early cardiogenesis