Description of a Case of Helicobacter pylori Infection with In Vitro Resistance to Tetracycline: An Exceptional Event with No Consequences?

Abstract

Resistance in Helicobacter pylori to tetracycline is rare. We describe the case of an H. pylori strain with a high level of resistance to tetracycline (minimum inhibitory concentration = 12 mg/L). However, despite tetracycline resistance, bismuth quadritherapy was effective. Analysis of the patient's antibiotic treatment history over the previous 25 years revealed repeated 3-month courses of tetracycline for the treatment of acne, suggesting in vivo selection pressure responsible for the emergence of the triple mutation (AGA→TTC) in 16S rDNA associated with tetracycline resistance. This is a rare event but one worth monitoring, especially in view of the widespread use of bismuth quadritherapy for probabilistic treatment in countries where it is available.

Background

Antibiotic resistance in Helicobacter pylori is a worldwide concern. It has now been established that rates of primary resistance to key eradication antibiotics such as clarithromycin and levofloxacin exceed the 15% threshold for probabilistic treatment in many countries. ¹ Worldwide, access to H. pylori culture from gastric biopsies is not widely available, as it requires preanalytical conditions for transporting biopsies that are sometimes difficult or impossible to implement locally. ² Cultivation of H. pylori also requires a degree of expertise that some microbiologists do not possess.

However, H. pylori culture has excellent specificity (100%), but sensitivity is highly dependent on the factors mentioned above. ³ The isolation of H. pylori in culture nevertheless enables microbiologists to assess the sensitivity of H. pylori to all antibiotics of interest in eradication therapy (clarithromycin, levofloxacin, metronidazole, tetracycline, rifampicin, and amoxicillin).

In H. pylori, resistance is due to mutations in the following target genes: 16S rDNA for tetracycline, ⁴ 23S rDNA for clarithromycin, ⁵ Quinolone Resistance Determining Region (QRDR) of gyrA for levofloxacin, ⁵ rpoB for rifampin, ⁶ pbp1 for amoxicillin, ⁷ and rdxA-frxA-fdxB for metronidazole.^5,8,9

Resistance in H. pylori, particularly to tetracycline, is rare, although some publications describe high rates of resistance. ¹⁰ These published data should be interpreted with caution, as high-level resistance to tetracycline in H. pylori is linked to a triple mutation within the same AGA926–928TTC codon. ¹¹ This event is, therefore, probably “costly” for the bacterium. In France, National Reference Center for Campylobacters and Helicobacters (NRCCH) data for the period 2017–2021 show only 0.1% tetracycline resistance in H. pylori, with moderate minimum inhibitory concentration (MIC) levels in the absence of strains presenting with this triple mutation in 16S rDNA.

We describe here the case of an H. pylori strain with a high level of resistance to tetracycline isolated in 2022 in the bacteriology laboratory of the Centre Hospitalier Annecy Genevois (Annecy, France) from a gastric biopsy taken from a patient at the same hospital.

Materials and Methods

H. pylori culture

The culture was done on two biopsies from the antrum and two biopsies from the fundus pooled in a single transport medium (Portagerm Pylori; biomérieux, Marcy l'Etoile, France). Bacteriological analyses carried out at the Annecy Hospital by culture on biomérieux Pylori agar plates (biomérieux) in a microaerobic atmosphere at 37°C identified a strain of H. pylori (positive for oxidase, catalase, and urease).

The antibiogram was performed on Schaedler vitamin K1 agar plate (Thermo Fisher Scientific, MA) using the Etest technique (biomérieux) in accordance with CASFM 2022 recommendations ¹² with the following cutoff values: amoxicillin 0.125 mg/L, clarithromycine 0.5 mg/L, levofloxacin 1 mg/L, tetracycline 1 mg/L, metronidazole 8 mg/L, and rifampicin 4 mg/L. The strain was sent to the NRCCH for further molecular examination.

Molecular analyses

Bacterial genomic DNA was extracted on a MagnaPure automated system (Roche Applied Science, Manheim, Germany) according to a previously published protocol. ¹³

End-point PCR followed by Sanger sequencing was performed as previously described ¹⁴ to identify mutations in gyrA, 16S rDNA, and 23S rDNA genes associated with levofloxacin, tetracycline, and clarithromycin resistance, respectively. The primers used in this study are given in Table 1.

Table 1.

Primers Used in This Study

Primer	Target gene (PCR product, bp)	Primer sequence (5′–3′)	References
HpyS	23S rDNA (260 bp)	AGGTTAAGAGGATGCGTCAGTC	11,13
HpyA		CGCATGATATTCCCATTAGCAGT
F-QRDR-HP	gyrA-QRDR (300 bp)	GCGTATTTTGTATGCGATGC	This study
R-QRDR-HP		ACAAAATCAATGGTGTCTTTATCA
16S-880fw	16S rDNA (120 bp)	ATAGACGGGGACCCGCACAAG	4
16S-999rv		TGGCAAGCCAGACACTCCA

bp, base pair; QRDR, Quinolone Resistance Determining Region.

Results

The clinical and endoscopic aspects of this case were as follows: the patient was 59 years old at diagnosis and had no family history of gastric cancer, had undergone cholecystectomy, and had a history of pyelonephritis and acne flare-ups. In the presence of persistent abdominal pain associated with a normal laboratory workup, endoscopic investigations were proposed. The colonoscopy was macroscopically normal, and gastric biopsies were taken under gastroscopy.

Chronic antrofundic pangastritis of mild intensity, inactive, without atrophy or metaplasia, with moderate H. pylori positivity was identified. On receipt of the bacteriological results, the attending physician initiated a 10-day course of bismuth-based quadritherapy comprising omeprazole 20 mg bid and Pylera^® (bismuth subcitrate potassium/metronidazole/tetracycline) qid, commercialized in France under the name of Pylera. Compliance was complete.

Two follow-up ¹⁴ C-urea breath tests (Helikit, Mayoli Spindler) conducted 4 and 9 weeks after the completion of bismuth quadritherapy were negative (delta over baseline values of 0.72 and 0.32, respectively), indicating that the H. pylori infection had been eradicated.

Antimicrobial susceptibility testing was then performed using E-test on the H. pylori strain successfully isolated from patient gastric biopsy, revealing bacterial resistance to clarithromycin (MIC >32 mg/L), levofloxacin (MIC >32 mg/L), and tetracycline (MIC = 12 mg/L). The strain remained sensitive to rifampicin (MIC = 0.5 mg/L), amoxicillin (MIC = 0.016 mg/L), and metronidazole (MIC = 0.75 mg/L).

Using genomic DNA from the strain, PCR followed by Sanger sequencing has detected A2143G mutation in the 23S rRNA gene, which is the primary mechanism for resistance to clarithromycin in H. pylori. An N87I mutation was found in the QRDR sequence of gyrA, which is known in H. pylori to be associated with resistance to levofloxacin.^5,15 For tetracycline, the presence of an AGA→TTC triple mutation in codons 926–928, known to be associated with a high level of resistance to tetracycline, ⁴ was identified.

Discussion

The H. pylori strain presented with an unusual resistance profile (clarithromycin-, levofloxacin-, and tetracycline-resistant), potentially placing the clinician in a delicate situation when proposing eradication treatment. However, despite tetracycline resistance, bismuth quadritherapy was effective, as confirmed by two follow-up 13C-urea breath tests. Analysis of the patient's antibiotic treatment history over the previous 25 years revealed repeated 3-month courses (in the last 3 years) of tetracycline for the treatment of acne, suggesting in vivo selection pressure responsible for the emergence of the triple mutation in 16S rDNA associated with tetracycline resistance.

Since the NRCCH has been intentionally studying mutations in the 16S rDNA of H. pylori, other single and double mutations have been identified within the target codon including AGA→GTA/TGA/GGA, associated with MIC values ranging from 1 to 6 mg/L (data not shown). However, none of these MIC values were higher than that of our study strain that carries a triple mutation. This is in line with the data published by Glocker et al. ⁴

However, this high level of resistance does not appear to have had any impact on eradication therapy in the present case. Several hypotheses can be put forward. First, the combined in vivo action of bismuth and metronidazole would have provided sufficient antibacterial effect for eradicating the H. pylori bacteria in this patient. Evidently, the strain had a low metronidazole MIC (0.75 mg/L). The second hypothesis is that the tetracycline MIC level found in this study (12 mg/L) may be lower than the tetracycline concentration reached in vivo within the gastric mucosa. To the best of our knowledge, no study has evaluated these values in the gastric mucosa of patients undergoing treatment with bismuth quadritherapy.

Conclusions

In conclusion, we describe here the first confirmed case in France of infection with a multidrug-resistant H. pylori strain with tetracycline resistance isolated from a patient who had received multiple antibiotic therapies, suggesting a prior selection pressure. This is a rare event but one worth monitoring, especially in view of the widespread use of bismuth quadritherapy for probabilistic treatment in countries where it is available.