Sage Journals: Discover world-class research

Abstract

HemoHIM is a standardized medicinal herbal preparation consisting of extracts of Angelica gigas Nakai, Cnidium officinale Makino, and Paeonia lactiflora Pallas that possesses immune regulatory activities. This study aimed to research the potential antioxidant effects of HemoHIM and its capacity for reducing fatigue in aged mice subjected to forced exercise. After administering HemoHIM 125 (500 mg/kg orally) for 4 weeks in 8-month-old female C57BL/6 mice (4 groups of 10 mice), various parameters were evaluated. The analyses revealed that HemoHIM enhanced swimming time and grip strength. In addition, it significantly reduced serum lactate levels and increased liver glutathione peroxidase (GPx) levels after exercise challenge. The expression levels of antioxidant enzymes and factors, including nuclear factor erythroid 2-related factor-2 (Nrf-2), heme oxygenase 1, superoxide dismutase, GPx, and glutathione reductase, were significantly higher in liver and muscle tissues of mice treated with HemoHIM. These results indicate that HemoHIM might function as an anti-fatigue and antioxidant agent by modulating the Nrf-2 signaling pathway.

INTRODUCTION

Fatigue is an unstable physiological condition that includes tiredness and weakness and can be physical, mental, or a combination of both.¹ Fatigue can also be caused by illness, but it often occurs in daily life due to lack of sleep or stress, and can be accompanied by physical or mental fatigue.^1,2

Numerous theories regarding the mechanisms related to physical fatigue have been proposed, such as the radical theory and exhaustion. According to the radical theory, the accumulation of reactive free radicals promote oxidative stress. Increased oxidative stress during these processes can impair cellular functions, leading to aging and various physiological abnormalities.³ Free radicals cause physical fatigue during excessive physical activity. Reactive oxygen species (ROS)-induced lipid peroxidation can impair the integrity of the cell membrane resulting in oxidative fatigue in skeletal muscle,^4,5 which can lead to cell aging and death. Both oxidative stress and damage affect aging-associated diseases, such as cancer, diabetes mellitus, and hypertension.^6,7

Skeletal muscle fibers continuously produce ROS during muscle contractions. In particular, ROS levels increase during intense exercise, which contributes to muscle fatigue. Thus, the antioxidants that regulate ROS levels may be the most important factors in anti-fatigue mechanisms.⁸

Nuclear factor erythroid 2-related factor-2 (Nrf-2) is an important marker of antioxidant signaling. Nrf-2 modulates the expression of genes encoding phase II detoxification enzymes and antioxidants such as heme oxygenase 1 (HO-1). Nrf-2 is negatively regulated by Kelch-like ECH-associated protein 1 (Keap-1), which is also associated with the HO-1-mediated antioxidant pathway.^9,10

HO-1 protects cells exposed to oxidizing agents by catalyzing the oxidation of heme to biologically active agents, for example, Fe²⁺ and CO. The final products produced from heme catabolism neutralizes intracellular ROS and exerts an antioxidant effect.¹¹ Several studies have reported that the Nrf2 pathway is associated with a protective role against oxidative stress and fatigue.

Hot water extracts of the roots of Angelica gigas Nakai (Angelica Radix), Cnidium officinale Makino (Cnidium Rhizoma), and Paeonia lactiflora Pallas (Paeonia Radix) were used to prepare HemoHIM and a polysaccharide fraction.^12,13 All three herbs are traditional Korean plants used in herbal medicine with several pharmacological activities, such as antioxidant, anti-inflammation, and antimicrobial effect.^14
–16 HemoHIM is a standardized preparation that influences on the immunoregulation and causes the maturation and activation of dendritic cells.^17,18

The key compounds are gallic acid, nodakenin, chlorogenic acid, and paeoniflorin. HemoHIM and its compounds have been studied to control the immunity,^17,18 exert anti-inflammatory effects,¹⁹ and protect against oxidative stress and H₂O₂-induced apoptosis.²⁰ In our previous study, HemoHIM improved exercise ability and decreased fatigue and oxidation in ICR mice.²¹ However, there are no studies on the anti-fatigue effects of HemoHIM in aged mice. In this study, we investigated the antioxidant and anti-fatigue effects of HemoHIM on fatigue in aged mice.

MATERIALS AND METHODS

Preparation of HemoHIM

HemoHIM was manufactured with reference to Jo et al.²² The standardized HemoHIM contained nodakenin (50–150 mg/100 g), chlorogenic acid (25–60 mg/100 g), and paeoniflorin (200–400 mg/100 g). It was manufactured by HK Kolmar BNH Co., Ltd. (Batch No. HHH010). The roots of A. gigas, C. officinale, and P. lactiflora were extracted by the hot water extraction method. A portion of the extracted material was precipitated with 95% ethanol to obtain a polysaccharide fraction. Finally, the HemoHIM with the polysaccharide fraction was concentrated to a solid content of 30% ± 3% and freeze dried.

Animals and experimental protocol

Eight-month-old female C57BL/6 mice (DooYeol Biotech, Korea) were used (4 groups of 10 mice). The animals were acclimated for 1 week and were housed in a climate-controlled facility with a temperature of 22°C ± 3°C and humidity of 50% ± 5% and a 12 h light–dark cycle. Mice were divided into the following groups: (1) control group, (2) HemoHIM 125 mg/kg, (3) HemoHIM 500 mg/kg, and (4) creatine 625 mg/kg. The control group was orally administered only 0.5% carboxymethylcellulose, whereas the other group was orally administered HemoHIM at the assigned concentration for 4 weeks.

Motor behavior analysis using a grip strength test

The mice were pretrained on a grip strength test twice a week before the test on 0 day. The grip strength test was performed once a week. The grip strengths of the control and the HemoHIM groups were measured using a grip strength meter (model JD-A-22; Jeungdo Bio & Plant, Korea). The mice tails were suspended perpendicular to the grid, and it was able to hold the metal grid of the meter with all four feet until the front foot reached the end of the grid. The tests were performed in triplicate and the results are expressed as the average of the measured data in kilograms-of-force units.

Motor behavior analysis using a forced swimming test

On day 0, the mice received pretraining using the forced swim test (FST) twice a week before the test. The mice were forced to swim in a pool filled with water at 25°C ± 1°C. There were weights added at 5% of their body weight to increase their exercise load. Swimming time was measured until the noses of the mice began to sink below the surface and remained at least 5 sec during exhaustion. FST was performed once a week after the grip test, and tissue analysis was performed on the last day.

Biochemical analysis

Serum was collected by cardiac puncture and centrifuged at 158 g for 15 min (Smart R17 Centrifuge; Hanil Scientific, Inc., Korea). Serum l-lactate level was determined using an l-lactate assay kit (ab65331; Abcam, United Kingdom).

Hepatic assays

Liver tissue (10 mg) was homogenized (T25 digital Ultra-Turrax; IKA^®, Germany) and the homogenized tissues were centrifuged at 158 g and 4°C. Liver malondialdehyde (MDA), glutathione peroxidase (GPx), and catalase (CAT) were measured using a lipid peroxidation (MDA) test kit (ab118970), GPx test kit (ab102530), and CAT activity test kit (ab83464; Abcam).

RNA isolation and reverse transcription–polymerase chain reaction in vivo

Total RNA was extracted (Qiagen, Germany) from liver and muscle samples, and the extracted RNA was quantified using NanoDrop (Thermo Fisher Scientific, Inc., USA). cDNA was synthesized using a high-capacity cDNA reverse transcription kit (Applied Biosystems, USA), and then amplified using AccuPower PCR Premix (Bione, Korea). The primers used are shown in Table 1. Electrophoresis was performed using 1.8% agarose gel containing ethidium bromide. β-Actin was used as a control, and the results were analyzed using ImageJ software (NIH, USA).

Table 1.

Primer Sequences Used for Reverse Transcription–Polymerase Chain Reaction

Gene	Direction	Sequence (5′ to 3′)
Nrf-2	Forward	TTCCTCTGCTGCCATTAGTCAGTC
Nrf-2	Reverse	GCTCTTCCATTTCCGAGTCACTG
HO-1	Forward	CTGGAAGAGGAGATAGAGCGAA
HO-1	Reverse	TCTTAGCCTCTTCTGTCACCCT
Keap-1	Forward	TGCCCCTGTGGTCAAAGTG
Keap-1	Reverse	AGTCCTTGGAGTCTAGCCGAG
SOD	Forward	AATGTGTCCATTGAAGATCGTGTGA
SOD	Reverse	GCTTCCAGCATTTCCAGTCTTTGTA
GSr	Forward	GGGCAAAGAAGATTCCAGGTT
GSr	Reverse	GGACGGCTTCATCTTCAGTGA
GPx	Forward	CAGTTCGGACATCAGGAGAAT
GPx	Reverse	AGAGCGGGTGAGCCTTCT
Txn	Forward	TTCCCTCTGTGACAAGTATTCCAA
Txn	Reverse	GGTCGGCATGCATTTGACT
Gclc	Forward	GTCCTCAGGTGACATTCCAAGC
Gclc	Reverse	TGTTCTTCAGGGGCTCCAGTC
NQO-1	Forward	GGCAGAAGAGCACTGATCGTA
NQO-1	Reverse	TGATGGGATTGAAGTTCATGGC
CAT	Forward	TGTCCCCCACCATTGAACT
CAT	Reverse	TCTGCAGATACCTGTGAACTG
β-Actin	Forward	GCCATGTACGTAGCCATCCA
β-Actin	Reverse	GAACCGCTCATTGCCGATAG

Statistical analysis

All experimental data are presented as means ± standard errors of the means. Data were analyzed by a one-way analysis of variance (ANOVA) and Duncan's multiple range tests using GraphPad Prism 5.0 (GraphPad Prism Software, Inc., USA). A P value <.05 was considered significant.

RESULTS

HemoHIM enhanced swimming time and grip strength in aged mice

Forced swimming and grip strength tests are among the most frequently used models for evaluating fatigue in animal studies.²³ Swimming time and grip strength were measured in the FST to confirm the anti-fatigue effect of HemoHIM. Compared with the control group, the HemoHIM 500 mg/kg and creatine group had longer swimming times (P < .05) and stronger grip strength (P < .01) (Fig. 1). In addition, there was no significant difference in body weight among all groups (Fig. 2).

FIG. 1.

Effect of HemoHIM on swimming time to exhaustion in the FST (a) and grip strength test (b). Data are expressed as mean ± SEM. Comparisons were made between the control and HemoHIM groups (125 and 500 mg/kg). Significant differences from control group (*P < .05, **P < .01). HemoHIM, standardized fraction of water extracts of Angelica gigas Nakai, Cnidium officinale Makino, and Paeonia lactiflora Pallas. FST, forced swimming test; SEM, standard error of the mean.

FIG. 2.

Effect of HemoHIM on body weight changes of mice.

HemoHIM decreased serum lactate levels after forced exercise

Serum lactate levels were measured after forced exercise to evaluate the effects of HemoHIM on fatigue. Lactate levels in the HemoHIM-administered mice decreased dose-dependently compared with those in the control group (HemoHIM 125 mg/kg, P < .05; HemoHIM 500 mg/kg, P < .05; Fig. 3).

FIG. 3.

Effect of HemoHIM on lactate levels in serum after exercise challenge. Data are expressed as mean ± SEM. Comparisons were made between control and HemoHIM groups (125 and 500 mg/kg). Significant difference from control group (*P < .05). HemoHIM, standardized fraction of water extracts of Angelica gigas Nakai, Cnidium officinale Makino, and Paeonia lactiflora Pallas.

HemoHIM increased GPx expression in the liver after forced exercise

Antioxidant activity was determined on the basis of liver CAT, MDA, and GPx levels. In the HemoHIM group, the activity of CAT showed a tendency to increase compared with control (Fig. 4a). MDA concentrations were lower in the HemoHIM groups, but the differences were not statistically significant (Fig. 4b). GPx concentrations in the HemoHIM 500 mg/kg group were significantly higher when compared with controls (Fig. 4c).

FIG. 4.

Effect of HemoHIM on CAT activity (a), MDA content (b), and GPx activity (c) in liver tissue after exercise challenge. Data are expressed as mean ± SEM. Comparisons were made between the control and HemoHIM groups (125 and 500 mg/kg). Significant difference from control group (*P < .05). HemoHIM, standardized fraction of water extracts of Angelica gigas Nakai, Cnidium officinale Makino, and Paeonia lactiflora Pallas. CAT, catalase; GPx, glutathione peroxidase; MDA, malondialdehyde.

HemoHIM upregulated the Nrf-2/HO-1 pathway and regulated other antioxidant factors in the liver after forced exercise

To investigate the antioxidant and anti-fatigue effects of HemoHIM, mRNA expression of genes related to the Nrf-2/HO-1 pathway was measured in liver tissues. Nrf2 levels were elevated in the HemoHIM group compared with the control group (Fig. 5a). Also, HO-1 expressions in the HemoHIM groups were significantly upregulated in liver tissue (HemoHIM 125 mg/kg; HemoHIM 500 mg/kg, P < .01; Fig. 5b).

FIG. 5.

Effects of HemoHIM on (a) Nrf-2, (b) HO-1, (c) Keap-1, (d) SOD, (e) GSr, (f) GPx, (g) Txn, (h) Gclc, (i) NQO-1, and (j) CAT mRNA expression levels in liver tissue detected using RT-PCR after exercise challenge. Data are expressed as mean ± SEM. Comparisons were made between control and HemoHIM groups (125 and 500 mg/kg). Significant differences from control group (*P < .05, **P < .01, ***P < .001). HemoHIM, standardized fraction of water extracts of Angelica gigas Nakai, Cnidium officinale Makino, and Paeonia lactiflora Pallas. Gclc, glutamate cysteine ligase catalytic subunit; GSr, glutathione reductase; HO-1, heme oxygenase 1; Keap-1, Kelch-like ECH-associated protein 1; NQO-1, NADPH quinone oxidoreductase-1; Nrf-2, nuclear factor erythroid 2-related factor-2; RT-PCR, reverse transcription–polymerase chain reaction; SOD, superoxide dismutase; Txn, thioredoxin.

In addition, Keap-1 expression in the HemoHIM 125 mg/kg group was downregulated compared with that in the control group (P < .05; Fig. 5c); however, superoxide dismutase (SOD) levels in both HemoHIM groups were upregulated compared with controls (HemoHIM 125 mg/kg; P < .05, HemoHIM 500 mg/kg; P < .05; Fig. 5d). In addition, there was a statistically significant increase in glutathione reductase (GSr) levels in the HemoHIM 500 mg/kg group compared with the control group (P < .001; Fig. 5e).

The expression of GPx and thioredoxin (Txn) was upregulated compared with that in the control group (GPx: HemoHIM 125 mg/kg, P < .01; HemoHIM 500 mg/kg, P < .001; Txn: HemoHIM 500 mg/kg, P < .001; Fig. 5f, g). Furthermore, the expression of glutamate cysteine ligase catalytic subunit (Gclc) was significantly upregulated compared with that in the control group (HemoHIM 125 mg/kg; P < .01, HemoHIM 500 mg/kg; P < .001; Fig. 5h). HemoHIM 500 mg/kg significantly induced the expression of the antioxidant factors NADPH quinone oxidoreductase-1 (NQO-1; HemoHIM 125 mg/kg; P < .001, HemoHIM 500 mg/kg; P < .001; Fig. 5i) and CAT (HemoHIM 500 mg/kg; P < .05; Fig. 5j) compared with that in the control group.

HemoHIM upregulated the Nrf-2/HO-1 pathway and regulated other antioxidant factors in muscle after forced exercise

To determine the anti-fatigue effect of HemoHIM on exercise performance in mice, Nrf-2/HO-1 pathway genes and antioxidant factors were measured in skeletal muscle tissue after the final exercise. Nrf-2 expression in the HemoHIM groups was significantly elevated compared with that in the control group (HemoHIM 125 mg/kg, P < .001; HemoHIM 500 mg/kg, P < .001) (Fig. 6a). Similarly, HO-1 gene expression was upregulated in the HemoHIM 500 mg/kg group after exercise compared with that in the control group (P < .01) (Fig. 6b).

FIG. 6.

Effects of HemoHIM on (a) Nrf-2, (b) HO-1, (c) Keap-1, (d) SOD, (e) GSr, (f) GPx, (g) Txn, (h) Gclc, (i) NQO-1, and (j) CAT mRNA expression levels in muscle tissue detected using RT-PCR after exercise challenge. Data are expressed as mean ± SEM. Comparisons were made between control and HemoHIM groups (125 and 500 mg/kg). Significant differences from the control group (*P < .05, **P < .01, ***P < .001). HemoHIM, standardized fraction of water extracts of Angelica gigas Nakai, Cnidium officinale Makino, and Paeonia lactiflora Pallas.

In the HemoHIM group, Keap-1 levels showed a tendency to decrease (Fig. 6c). However, SOD levels were significantly increased in the HemoHIM 125 mg/kg and HemoHIM 500 mg/kg groups compared with those in the control group (HemoHIM 125 mg/kg, P < .05; HemoHIM 500 mg/kg, P < .001) (Fig. 6d). GSr expression was significantly upregulated by HemoHIM (HemoHIM 125 mg/kg, P < .05; HemoHIM 500 mg/kg, P < .01; Fig. 6e).

In addition, GPx levels were higher in the 500 mg/kg HemoHIM group than in the control group (P < .001; Fig. 6f), and Txn levels showed a dose-dependent increase in the HemoHIM groups (500 mg/kg; P < .001; Fig. 6g). Gclc expression was significantly upregulated in the HemoHIM 500 mg/kg group compared with controls (P < .01; Fig. 6h). Finally, NQO-1 expression in the HemoHIM 125 mg/kg group (P < .05; Fig. 6i) and CAT expression in the HemoHIM 500 mg/kg group (P < .001; Fig. 6j) were significantly higher than the corresponding values in the control group.

DISCUSSION

In this study, we explored the effect of HemoHIM on high-intensity exercise-induced fatigue in aged mice. The treated mice exhibited enhanced performance in forced swimming and grip strength tests, thus demonstrating the potential anti-fatigue activity of HemoHIM.

Fatigue is a common physiological response observed in various conditions, including cancer, aging, and depression.²⁴ It can be categorized as either mental or physical fatigue. Physical fatigue, which arises from intense exercise or demanding physical labor, manifests as physical abnormalities, including sleep disturbances and lethargy. High-intensity exercise can increase the production of ROS and oxygen consumption, resulting in elevated oxidative stress leading to oxidative damage.²⁵

Studies such as those by Ma et al.²⁶ and Oliveira et al.²⁷ have explored drugs such as melatonin and carvedilol, which possess strong antioxidant properties but may entail serious side effects. Recently, several studies have highlighted the potential of natural antioxidant medicinal plants and herbs in reducing fatigue and exercise-induced oxidative damage.^28,29 Therefore, one strategy to suppress fatigue involves eliminating or inhibiting the production of fatigue-related metabolites during exercise.

In this study, we found increased CAT and GPx levels and decreased MDA levels in the liver of HemoHIM-treated mice, suggesting that HemoHIM could alleviate fatigue. Exercise-induced protein oxidation leads to the production of ROS and MDA, accompanied by an increase in the levels of primary antioxidant enzymes such as CAT and GPx.³⁰ CAT can reduce fatigue and alleviate other physiological abnormalities by breaking down H₂O₂ into H₂O and O₂, whereas GPx is responsible for reducing H₂O₂ into water and alcohol.^31,32

Accumulation of ROS and MDA, as well as reduced antioxidant enzyme levels, has been reported in chronic fatigue. Therefore, it can be reasoned that reversing these effects can help combat fatigue. We also found that HemoHIM reduced blood lactate levels, potentially enhancing the anti-fatigue effect. Blood lactate accumulation can lower the pH value of the muscle tissue or blood, potentially causing side effects in physiological responses.²³

Furthermore, HemoHIM regulated the expression activities of Nrf-2, HO-1, NQO-1, Txn, and Gclc by reverse transcription–polymerase chain reaction (PCR) analysis of liver and muscle tissue. In addition, HemoHIM activated the expression of antioxidant-related enzymes and factors such as SOD, GSr, GPx, and CAT. The Nrf-2 signaling pathway is crucially involved in oxidative stress.³³ Under normal conditions, Nrf-2-dependent transcription is repressed by the negative regulator Keap-1.

However, when cells or tissues are exposed to oxidative stress environments, Nrf-2 avoids Keap-1 mediated inhibition and enters the nucleus, activating genes encoding antioxidant and phase II detoxifying enzymes (Gclc), detoxifying enzymes (GSr and NQO-1), and antioxidant enzymes (CAT, GPx, SOD, and HO-1).³⁴ Therefore, activation of the Nrf-2 signaling pathway is vital for antioxidation.

In summary, this study demonstrated that HemoHIM exhibits an anti-fatigue effect in aged mice subjected to forced exercise. This anti-fatigue effect was most likely caused by the increased antioxidant activity of the enzyme system, and the removal free radicals resulting in decreased oxidative damage.

In conclusion, this study confirmed that HemoHIM exhibits anti-fatigue effects in aged mice. The observed effects included a reduction in lactate and MDA concentrations, increased GPx and CAT activity, and improved exercise performance. The underlying mechanism of these anti-fatigue effects is thought to be associated with the antioxidant properties of HemoHIM, exerted through the activation of the Nrf-2/HO-1 signaling pathway and various antioxidant factors such as SOD, GSr, GPx, Txn, Gclc, NQO-1, and CAT.

The potential anti-fatigue activity of HemoHIM could benefit both the general population and elderly individuals experiencing fatigue. Although the exact mechanisms of HemoHIM are yet to be elucidated, this study suggests the use of HemoHIM as an anti-fatigue agent by showing scientific evidence supporting anti-fatigue outcomes with HemoHIM consumption.

ETHICAL APPROVAL STATEMENT

All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the HK Korea Kolmar Animal Ethics Committee (19-KBH-F-01) and were followed by national and institutional guidelines.

Footnotes

AUTHORs' CONTRIBUTIONS

Conceptualization and writing—review and editing by H.S.L. Supervision and methodology by S.-K.K. Methodology, formal analysis, investigation, resources, data curation, and writing—original draft by D.-A.K. Methodology by Y.S.K. Writing—original draft by S.-B.B.

AUTHOR DISCLOSURE STATEMENT

No competing financial interests exist.

FUNDING INFORMATION

This study was supported by a grant from HK Kolmar BNH Co., Ltd., Korea.

References

Jason

, Evans

, Brown

, et al. What is fatigue? Pathological and nonpathological fatigue. PM&R, 2010; 2(5):327–331; doi: 10.1016/j.pmrj.2010.03.028

Lamou

, Taiwe

, Hamadou

, et al. Antioxidant and antifatigue properties of the aqueous extract of Moringa oleifera in rats subjected to forced swimming endurance test. Oxid Med Cell Longev, 2016; 2016:3517824; doi: 10.1155/2016/3517824

Wang

, Zhang

, Zhou

YJ et al

. The decapeptide CMS001 enhances swimming endurance in mice. Peptides, 2008; 29(7):1176–1182; doi: 10.1016/j.peptides.2008.03.004

Allen

, Lamb

, Westerblad

. Skeletal muscle fatigue: Cellular mechanisms. Physiol Rev, 2008; 88(1):287–332; doi: 10.1152/physrev.00015.2007

Fittipaldi

, Dimauro

, Mercatelli

, et al. Role of exercise-induced reactive oxygen species in the modulation of heat shock protein response. Free Radic Res, 2014; 48(1):52–70; doi: 10.3109/10715762.2013.835047

Jomova

, Vondrakova

, Lawson

, et al. Metals, oxidative stress and neurodegenerative disorders. Mol Cell Biochem, 2010; 345:91–104; doi: 10.1007/s11010-010-0563-x

Jomova

, Valko

. Advances in metal-induced oxidative stress and human disease. Toxicology, 2011; 283(2–3):65–87; doi: 10.1016/j.tox.2011.03.001

Park

, Jang

, Lee

, et al. Akebia quinata decaisne aqueous extract acts as a novel anti-fatigue agent in mice exposed to chronic restraint stress. J Ethnopharmacol, 2018; 222:270–279; doi: 10.1016/j.jep.2018.04.010

Bryan

, Olayanju

, Goldring

, et al. The Nrf2 cell defence pathway: Keap1-dependent and-independent mechanisms of regulation. Biochem Pharmacol, 2013; 85(6):705–717; doi: 10.1016/j.bcp.2012.11.016

10.

Kang

, Lee

, Park

JW et al

. Phosphatidylinositol 3-kinase regulates nuclear translocation of NF-E2-related factor 2 through actin rearrangement in response to oxidative stress. Mol Pharmacol, 2002; 62(5):1001–1010; doi: 10.1124/mol.62.5.1001

11.

Scapagnini

, Butterfield

, Colombrita

, et al. Ethyl ferulate, a lipophilic polyphenol, induces HO-1 and protects rat neurons against oxidative stress. Antioxid Redox Signal, 2004; 6(5):811–818; doi: 10.1089/ars.2004.6.811

12.

Kwon

, KIM

, Baek

, et al. Standardized extract (HemoHIM) from Angelica gigas Nakai, Cnidium officinale Makino and Paeonia lactiflora Pallas extract attenuates acetaminophen-induced liver injury in human hepatocellular carcinoma cells and mice model. Indian J Phar Sci, 2021; 83(2):765; doi: 10.3646/8/pharmaceutical-sciences.765

13.

Kim

, Kown

, Kim

, et al. Standardized extract (HemoHIM) protects against scopolamine-induced amnesia in a murine model. Evid Based Complement Alternat Med, 2021; 2021:8884243; doi: 10.1155/2021/8884243

14.

Noh

, Lee

, Do

, et al. Antioxidant and ACE inhibitory activity of cultivated and wild Angelica gigas Nakai extracts prepared using different extraction conditions. Prev Nutr Food Sci, 2014; 19(4):274; doi: 10.3746/pnf.2014.19.4.274

15.

Lee

, Kang

. Analysis of the antimicrobial, cytotoxic, and antioxidant activities of Cnidium officinale extracts. Plants, 2020; 9(8):988; doi: 10.3390/plants9080988

16.

Song

, Wu

, Dai

. Paeonol attenuates progression of atherosclerotic lesion formation through lipid regulation, anti-inflammatory and antioxidant activities. J Chin Phar Sci, 2018; 27(8):57; doi: 10.5246/jcps.2018.08.057

17.

Shin

, Kim

, et al. Effects of a herbal composition (HemoHIM) on the activation of dendritic cells. J Korean Soc Food Sci Nutr, 2006; 35(10):1322–1328; doi: 10.3746/jkfn.2006.35.10.1322

18.

Park

, Jo

, Jung

, et al. Immunomodulatory effect of a new herbal preparation (HemoHIM) in cyclophosphamide-treated mice. J Korean Soc Food Sci Nutr, 2006; 3:54–60; doi: 10.3746/jfn.2006.11.1.054

19.

, Lee

, Kim

, et al. Antiinflammatory activity of an herbal preparation (HemoHIM) in rats. Phytother Res, 2007; 21(7):625–628; doi: 10.1002/ptr.2068

20.

Shin

, Kim

, et al. Protective effects of a herbal composition (HemoHIM) against apoptosis induced by oxidative stress of hydrogen peroxide. J Korean Soc Food Sci Nutr, 2006; 35(9):1127–1132; doi: jkfn.2006.35.9.1127

21.

Kwon

, Kim

, et al. Antioxidant and antifatigue effect of a standardized fraction (HemoHIM) from Angelica gigas, Cnidium officinale, and Paeonia lactiflora . Pharm Biol, 2021; 59(1):389–398; doi: 10.1080/13880209.2021.1900878

22.

, Park

, Jung

, et al. Protective effect of an herbal preparation (HemoHIM) on the self-renewal tissues and immune system against c-irradiation. J Korean Soc Food Sci Nutr, 2005; 34:805–813; doi: 10.3746/jkfn.2005.34.6.805

23.

Huang

, Hsu

, Huang

, et al. Triterpenoid-rich extract from Antrodia camphorata improves physical fatigue and exercise performance in mice. Evid Based Complement Alternat Med, 2012; 2012:364741; doi: 10.1155/2012/364741

24.

Tharakan

, Dhanasekaran

, Brown-Borg

, et al. Trichopus zeylanicus combats fatigue without amphetamine-mimetic activity. Phytother Res, 2006; 20(3):165–168; doi: 10.1002/ptr.1773

25.

. Research on the influence of anti-fatigue effect and movement ability of blueberry polysaccharides on aged mice. Open Biomed Eng J, 2015; 9:314; doi: 10.2174/1874120701509010314

26.

, Xu

, Zhang

et al. Utilizing melatonin to alleviate side effects of chemotherapy: A potentially good partner for treating cancer with ageing. Oxid Med Cell Longev, 2020; 2020:6841581; doi: 10.1155/2020/6841581

27.

Oliveira

, Goncalves

, Monteiro

, et al. Are the antioxidant properties of carvedilol important for the protection of cardiac mitochondria?. Curr Vasc Pharmacol, 2005; 3(2):147–158; doi: 10.2174/1570161053586903

28.

Tang

, Zhang

, Gao

, et al. The anti-fatigue effect of 20 (R)-ginsenoside Rg3 in mice by intranasally administration. Biol Pharm Bull, 2008; 31(11):2024–2027; doi: 10.1248/bpb.31.2024

29.

Imai

, Nakagawa

. Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian cells. Free Radic Biol Med, 2003; 34(2):145–169; doi: 10.1016/S0891-5849(02)01197-8

30.

Powers

, Lennon

. Analysis of cellular responses to free radicals: Focus on exercise and skeletal muscle. Proc Nutr Soc, 1999; 58(4):1025–1033; doi: 10.1017/S0029665199001342

31.

Anand

, Phani Kumar

, Pandareesh

, et al. Effect of bacoside extract from Bacopa monniera on physical fatigue induced by forced swimming. Phytother Res, 2012; 26(4):587–593; doi: 10.1002/ptr.3611

32.

Maher

, Yamamoto

. The rise of antioxidant signaling—The evolution and hormetic actions of Nrf2. Toxicol Appl Pharmacol, 2010; 244(1):4–15; doi: 10.1016/j.taap.2010.01.011

33.

, Cheng

, Bi

, et al. Effects of N-butylphthalide on the activation of Keap1/Nrf-2 signal pathway in rats after carbon monoxide poisoning. Environ Toxicol Pharmacol, 2015; 40(1):22–29; doi: 10.1016/j.etap.2015.05.009

34.

Surh

, Kundu

, Na

. Nrf2 as a master redox switch in turning on the cellular signaling involved in the induction of cytoprotective genes by some chemopreventive phytochemicals. Planta Med, 2008; 74(13):1526–1539; doi: 10.1055/s-0028-1088302

Antioxidant and Anti-Fatigue Effects of a Standardized Botanical Extract Fraction (HemoHIM) in Forced-Exercised Aged Mice

Abstract

INTRODUCTION

MATERIALS AND METHODS

Preparation of HemoHIM

Animals and experimental protocol

Motor behavior analysis using a grip strength test

Motor behavior analysis using a forced swimming test

Biochemical analysis

Hepatic assays

RNA isolation and reverse transcription–polymerase chain reaction in vivo

Statistical analysis

RESULTS

HemoHIM enhanced swimming time and grip strength in aged mice

HemoHIM decreased serum lactate levels after forced exercise

HemoHIM increased GPx expression in the liver after forced exercise

HemoHIM upregulated the Nrf-2/HO-1 pathway and regulated other antioxidant factors in the liver after forced exercise

HemoHIM upregulated the Nrf-2/HO-1 pathway and regulated other antioxidant factors in muscle after forced exercise

DISCUSSION

ETHICAL APPROVAL STATEMENT

Footnotes

AUTHORs' CONTRIBUTIONS

AUTHOR DISCLOSURE STATEMENT

FUNDING INFORMATION

References