Sage Journals: Discover world-class research

Abstract

Background:

Apolipoprotein A5 (APOA5) is involved in serum triglyceride (TG) regulation. Several studies have reported that the rs651821 locus in the APOA5 gene is associated with serum TG levels in the Chinese population. However, no research has been performed regarding the association between the variants of rs651821 and the risk of hyperlipidemic acute pancreatitis (HLAP).

Methods:

A case-control study was conducted and is reported following the STROBE guidelines. We enrolled a total of 88 participants in this study (60 HLAP patients and 28 controls). APOA5 was genotyped using PCR and Sanger sequencing. Logistic regression models were conducted to calculate odds ratios and a 95% confidence interval.

Results:

The genotype distribution of the rs651821 alleles in both groups follow the Hardy-Weinberg distribution. The frequency of the “C” allele in rs651821 was increased in HLAP patients compared to controls. In the recessive model, subjects with the “CC” genotype had an 8.217-fold higher risk for HLAP (OR = 8.217, 95% CI: 1.023-66.01, p = 0.046) than subjects with the “TC+TT” genotypes. After adjusting for sex, the association remained significant (OR = 9.898, 95% CI: 1.176-83.344, p = 0.035). Additionally, the “CC” genotype was related to an increased TG/apolipoprotein B (APOB) ratio and fasting plasma glucose (FPG) levels.

Conclusions:

Our findings suggest that the C allele of rs651821 in APOA5 increases the risk of HLAP in persons from Southeastern China.

Introduction

The prevalence of hypertriglyceridemia (HTG) has continued to increase rapidly over recent years in China (Opoku et al., 2019; Pan et al., 2016; Zhang et al., 2017). A cross-sectional study suggested that the prevalence of HTG has reached 43.9% in northeast China (Zhang et al., 2017). HTG is a lipid metabolism disorder associated with an increased risk of atherosclerotic cardiovascular disease and all-cause mortality (Nordestgaard and Varbo, 2014). In addition, severe HTG (SHTG triglyceride [TG] ≥5.65 mmol/L) can cause hyperlipidemic acute pancreatitis (HLAP). Moreover, a higher TG level is associated with a higher risk of acute pancreatitis (AP) (Hernandez et al., 2021). About 20% of individuals with serum TG levels >11.3 mmol/L could develop AP (Hansen et al., 2021).

Recent studies suggested that HTG had become the second leading cause of AP in several regions of China, accounting for ∼10-30% of AP cases (Boxhoorn et al., 2020; Chen et al., 2019; Du et al., 2019; He and Lyu, 2018; Lee and Papachristou, 2019; Zhang et al., 2019; Zheng et al., 2020). There are some evidences that HLAP may be prone to aggravation and recurrence, and have a higher rate of complications compared with other causes of pancreatitis, such as pulmonary infection, circulatory and respiratory failure, and renal insufficiency (Guo et al., 2017; He and Lyu, 2018; Yang et al., 2017). It could severely affect the patient's wellness and thus consume more medical resources in the next decade.

The pathogenesis of HLAP is not yet clear. Free fatty acids, calcium overload, endoplasmic reticulum stress, microcirculation disorders, oxidative stress, inflammatory mediators and cytokine damage, and gene polymorphisms are all involved in the occurrence and development of HLAP (Guo et al., 2019). Among them, the genetic predisposition plays a critical role. Particularly, variants in the lipoprotein lipase (LPL) gene and its molecular regulating genes could cause chylomicronemia and recurrent pancreatitis (Goldberg and Chait, 2020; Paquette et al., 2021).

Apolipoprotein A5 (APOA5) gene is a member of the APOA1/APOC3/APOA4/APOA5 gene cluster, which is located on chromosome 11q23. It encodes an apolipoprotein involved in regulating the serum TG and high-density lipoprotein cholesterol (HDL-C) concentrations (Pennacchio et al., 2001). Several single nucleotide polymorphisms (SNPs) of the APOA5 gene have been reported to affect the plasma TG levels in different populations and are significantly related to many diseases such as obesity, hypertension, coronary heart disease, metabolic syndrome, and stroke (Fu et al., 2015; Gao et al., 2018; Gombojav et al., 2016; Kefi et al., 2017; Ken-Dror et al., 2010; Kim et al., 2019; Lim et al., 2017; Saleheen et al., 2010; Wang et al., 2020; Wu et al., 2016; Xiao et al., 2017; You et al., 2018; Zhu et al., 2014).

Genome-wide association studies (GWAS) in the Chinese population identified an SNP (rs651821) in APOA5 that was significantly associated with serum TG level (Tan et al., 2012; Zhu et al., 2017). However, the association between the rs651821 in the APOA5 gene and HLAP remains unknown so far. This study aims to investigate the relationship between the APOA5 rs651821 and HLAP in the Chinese population. The following article was presented in accordance with the STROBE reporting checklist.

Methods

Study design

A case-control study was conducted following Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) statements. The cases were represented by patients diagnosed with HLAP in the hospital, the controls were patients with biliary acute pancreatitis (BAP). The sample was obtained from the Fujian Medical University Affiliated First Quanzhou Hospital, located in southeastern China, during 2018-2022. This study was approved by the Ethics Committee of the Fujian Medical University Affiliated First Quanzhou Hospital.

Subjects

A total of 88 participants were recruited, including 60 HLAP patients as cases and 28 BAP patients as controls. The inclusion criteria for the case group were (1) diagnosis of AP according to Chinese guidelines for the management of AP (at least two of the following three features: upper abdominal pain consistent with AP, serum lipase activity exceeds the upper limit of normal by three times, radiographic features of AP); (2) confirmed dyslipidemia with serum TG >11.3 mmol/L or serum TG >5.65 mmol/L together with lipemia. The inclusion criteria for the control group were (1) diagnosis of AP according to Chinese guidelines for the management of AP; (2) confirmed gallstones or biliary sludge on imaging methods or elevated serum levels of alanine aminotransferase (>60 U/L).

Patients with a history of alcohol consumption of >20 g/day, a history of pancreatic toxic drugs, known pancreatic or periampullary tumors, pancreatic duct anomaly disorders, hereditary pancreatitis, autoimmune pancreatitis, and traumatic pancreatitis were excluded from the study. All patients were not genetically related and were grouped by clinical presentation alone. The participants did not know their genotypes in advance, and neither the researchers.

Biochemical measurements

The general information, such as age, gender, alcohol consumption, and smoking status was collected from medical history and questionnaires. Blood samples were obtained in the morning after an overnight fast for detecting biochemical parameters, including lipid parameters, glycemia parameters, and liver function.

Genotyping analysis

Genomic DNA was extracted from peripheral blood lymphocytes. PCR reactions were performed on gDNA with the primer pairs (5′ AGCTACGGAGTTGTCAAGGC 3′ as the forward primer and 5′ GAACTGTTCCTGGGGTCTGG 3′ as the reverse primer). The PCR products of the expected size were separated by 1% agarose gel electrophoresis to confirm the presence and specificity of targeted sequences. After further purification, the PCR products were sequenced by the dideoxy approach. DNA Baser v5.15.0 was used to align the DNA fragments to target references and detect the variants from chromatograms.

Statistical analysis

Quantitative variables were expressed as mean ± standard deviation. The Hardy-Weinberg equilibrium was assessed with the chi-square test (p-value >0.05). Differences in the characteristics between groups were analyzed using the Student's t-test or Wilcoxon test. Differences in genotype distribution and allele frequency between groups were compared with the chi-square test or Fisher's exact test. Statistical analysis was performed using SPSS 22.0 software, and the p-value <0.05 was considered statistically significant.

Results

General characteristics

The general characteristics of the 60 patients with HLAP and the 28 controls are presented in Table 1. All the participants are Chinese. The HLAP group was younger and had more male patients than the BAP group. The mean total cholesterol (TC), TG, non-high-density lipoprotein cholesterol (non-HDL-C), and glycated hemoglobin (HbA1c) were significantly higher in the HLAP group, but the systolic blood pressure (SBP), low-density lipoprotein cholesterol (LDL-C) was significantly higher in BAP group. The two groups did not differ by diastolic blood pressure (DBP), high-density lipoprotein cholesterol (HDL-C), or fasting plasma glucose (FPG) levels. The proportion of smokers, drinkers, and patients with fatty liver and diabetes was higher in the HLPA group and the proportion of patients with hypertension was higher in the BAP group.

Table 1.

Clinical and Biochemical Characteristics of Patients with Hyperlipidemic Acute Pancreatitis and Controls

	HLAP patients (n = 60)	BAP controls (n = 28)	t (χ²)	p
Male, n (%)	43 (71.7)	12 (42.9)	6.761	0.009^*
Age (years)^a	38.650 ± 9.016	58.790 ± 14.635	36.881	<0.001^*
SBP (mm Hg)^a	132.700 ± 15.854	144.464 ± 25.606	36.984	0.031^*
DBP (mm Hg)^a	84.917 ± 10.888	84.852 ± 17.033	37.653	0.987
TC (mmol/L)^a	11.924 ± 4.627	4.653 ± 0.975	69.394	<0.001^*
TG (mmol/L)^a	29.025 ± 18.777	1.256 ± 0.584	59.245	<0.001^*
HDL-C (mmol/L)^a	0.949 ± 0.840	1.073 ± 0.284	77.960	0.318
LDL-C (mmol/L)^a	2.029 ± 1.773	3.025 ± 0.720	82.309	<0.001^*
Non-HDL-C (mmol/L)^a	11.018 ± 4.356	3.580 ± 0.895	66.333	<0.001^*
FPG (mmol/L)^a	12.507 ± 6.038	10.134 ± 4.884	86.000	0.072
HbA1c (%)	8.537 ± 2.747	6.349 ± 1.238	82.921	<0.001^*
Drinking, n (%)	23 (38.3)	1 (3.6)	9.944	0.002^*
Smoking, n (%)	24 (40.0)	2 (7.1)	9.901	0.002^*
Hypertension, n (%)	11 (18.3)	11 (39.3)	4.470	0.034^*
Fatty liver, n (%)	52 (86.7)	11 (39.3)	21.073	<0.001^*
Diabetes, n (%)	35 (58.3)	8 (28.6)	6.768	0.009^*

Results are expressed as mean ± SD.

p < 0.05 was considered statistically significant.

BAP, biliary acute pancreatitis; DBP, diastolic blood pressure; FPG, fasting plasma glucose; HbA1c, glycated hemoglobin; HDL-C, high-density lipoprotein cholesterol; HLAP, hyperlipidemic acute pancreatitis; LDL-C, low-density lipoprotein cholesterol; SBP, systolic blood pressure; SD, standard deviation; TC, total cholesterol; TG, triglyceride.

Genotype distribution comparison

The distribution of rs651821 in APOA5 was in accordance with the Hardy-Weinberg distribution in all participants as well as separately in HLAP patients and controls (p > 0.05). The genotype distributions and allele frequencies of rs651821 is shown in Table 2. The frequency of the “TT,” “TC,” and “CC” genotypes was 38.3%, 38.3%, and 23.3% in the HLAP patients, and 53.6%, 42.9%, and 3.6% in BAP controls. Meanwhile, a significant elevation was observed in the frequency of the “C” allele in rs651821 for the HLAP patients (42.5% vs. 25.0% for BAP controls, p = 0.025) in Table 2.

Table 2.

The Genotype and Allele Distributions of rs651821 in Hyperlipidemic Acute Pancreatitis Patients and Controls

SNP	Genotype/allele		HLAP patients (n = 60), n (%)	BAP controls (n = 28), n (%)	χ ²	p
rs651821	Genotype	TT	23 (38.3)	15 (53.6)	5.499	0.064
		CT	23 (38.3)	12 (42.9)
		CC	14 (23.3)	1 (3.6)
	Allele	T	69 (57.5)	42 (75.0)	5.020	0.025^*
	Allele	C	51 (42.5)	14 (25.0)	5.020	0.025^*

p-Value <0.05 was considered statistically significant.

SNP, single nucleotide polymorphism.

APOA5 rs651821 and the risk of HLAP

Table 3 shows the relationship between APOA5 rs651821 and the risk of HLAP. In the recessive model, we observed a significant association between HLAP risk and rs651821. Subjects with the “CC” genotype had an 8.217-fold higher risk for HLAP (odds ratio [OR] = 8.217, 95% confidence interval [CI]: 1.023-66.01, p = 0.046) than subjects with the “TC + TT” genotype. The association remained significant after controlling for sex (adjusted OR = 9.898, 95% CI: 1.176-83.344, p = 0.035).

Table 3.

Apolipoprotein A5 rs651821 and the Risk of Hyperlipidemic Acute Pancreatitis with Recessive Model

Genotype	CC	CT+TT
HLAP patients (n = 60), n (%)	14 (23.3)	46 (76.7)
BAP controls (n = 28), n (%)	1 (3.6)	27 (96.4)
OR (95% CI)	1.023-66.017	1
p	0.046^*
Adjusted OR (95% CI)^a	1.176-83.344	1
p ^*	0.035^*

Adjusted for sex; ^*p-value <0.05 was considered statistically significant.

OR, odds ratio.

Association between genotypes and general characteristics

The differences in lipid parameters and glycemia parameters between the “CC” and the “TT” genotypes are presented in Table 4. Compared with the “TT” genotype, subjects with the genotype “CC” had significantly increased FPG and TG/apolipoprotein B (APOB) levels (p < 0.05).

Table 4.

Differences of Parameters Between Genotypes (CC, TT)

rs651821	Genotype		p
rs651821	CC	TT	p
Age (year)	38.400 ± 9.679	45.320 ± 15.968	0.192
TC (mmol/L)	10.807 ± 4.069	9.123 ± 5.010	0.110
TG (mmol/L)	27.643 ± 19.026	19.326 ± 22.739	0.086
HDL-C (mmol/L)	1.058 ± 0.882	0.993 ± 0.647	0.518
LDL-C (mmol/L)	1.697 ± 1.474	2.599 ± 1.805	0.179
Non-HDL-C (mmol/L)	9.749 ± 3.546	8.022 ± 5.020	0.104
TG/APOB	361.102 ± 1022.564	63.191 ± 122.000	0.017^*
FPG (mmol/L)	13.509 ± 4.841	10.891 ± 6.680	0.043^*
HbA1c (%)	7.979 ± 2.149	8.858 ± 2.934	0.428

p-value <0.05 was considered statistically significant.

APOB, apolipoprotein B; HbA1c, glycated hemoglobin; Non-HDL-C, non-high-density lipoprotein cholesterol.

Discussion

Despite the rising incidence and the increased disease burden of HLAP, the genetic predisposition of it is always under-recognized (Baass et al., 2020). In this study, we evaluated the association between rs651821 in APOA5 and HLAP risk in the southeast of China. We found that the minor allele “C” of rs651821 was associated with an increased HLAP risk. The “CC” genotype had a higher level of TG/APOB and FPG compared with the “TT” genotype.

The etiology of HLAP is complex and may involve multiple gene-gene and gene-environment interactions. APOA5 is essential LPL activator, which is involved in regulating TG metabolism (Fu et al., 2015). Its dysfunction may impact LPL activity and availability, and this then results in dyslipidemia (Kersten, 2014). Several SNPs of the APOA5 gene were identified to be associated with increased TG levels in China, including rs651821 (Fu et al., 2015; Gombojav et al., 2016; Tan et al., 2012; You et al., 2018; Zhu et al., 2017).

APOA5 variants were also found to be the most frequent genetic determinant of multifactorial chylomicronemia syndrome, and the second most frequent genetic determinant of familial chylomicronemia syndrome next only to LPL, which are characterized as recurring HLAP (D'Erasmo et al., 2019; Dron et al., 2020). Both rare and common variants that affect the concentration and activity of APOA5 may be one of the causative factors of HLAP.

Several SNPs in APOA5 have been detected in some HLAP case reports (Chokshi et al., 2014; Hooper et al., 2014; Koopal et al., 2019; Perrone et al., 2019). Pu et al. (2020) demonstrated a robust association of rs2075291 in APOA5 with HLAP, particularly in pregnancy. But data on the possible relation between HLAP and rs651821 in APOA5 have so far been sparse. The SNP rs651821 was located in the 5′UTR and promoter region of APOA5. The frequency of variant rs651821 is 29% in the East Asian population, more prevalent than other populations in the world (Chou et al., 2022).

Chou et al. (2022) revealed variant rs651821 is the causal variant affecting TG level rather than variant rs662799 in the genome-wide association study (GWAS) of hyperlipidemia. A cross-sectional and representative survey of Jilin Province, China showed that the “C” allele frequency was 36.8%, and the frequency of the “TT,” “TC,” and “CC” genotypes was 39.8%, 46.7%, and 13.5% in the HTG group. Another prospective cohort study from Denmark showed that more AP events occurred in variant rs651821 carriers, but the frequency of variant rs651821 is low in the Denmark population (Hansen et al., 2021).

Our available data showed that the “C” allele frequency was 42.5%, and the frequency of the “TT,” “TC,” and “CC” genotypes was 38.3%, 38.3%, and 23.3% in the HLAP group. Moreover, we found that the genotypic and allelic frequencies of rs651821 exhibited significant differences between the HLAP and the BAP groups. We used the recessive genetic model, which made biological sense based on previous literature to establish an association between the genotype and HLAP risk (Adams et al., 2014; Lim et al., 2017). Furthermore, we found the carriers of the “CC” genotype of rs651821 were found to have an 8.217-fold higher risk of HLAP than those with other genotypes, which suggested that APOA5 variant rs651821 conferred susceptibility to HLAP in the Quanzhou population.

Mechanistically, it has been proposed that chylomicrons (CM) excess is needed to provoke HLAP (Hernandez et al., 2021). Gonzales et al. demonstrated that the calculation of serum TG/APOB ratio may help identify HTG patients at risk for HLAP. This marker of CM persistence (TG/APOB >10.6) has a high sensitivity (90%) and specificity (75%) for the identification of HLAP risk (Bai et al., 2019). In our study, subjects with the genotype “CC” had a higher level of TG/APOB.

It showed that those with the genotype “CC” of rs651821 had a higher risk for HLAP. Our study also found that subjects with the genotype “CC” had a higher level of FPG. Previous research suggested that the genotype “AA” of rs1263173, which is also located in the 5′UTR region of APOA5, significantly increased the plasma glucose level (Xu et al., 2018). The rs1263173 “AA” carriers and rs651821 “CC” carriers may be more susceptible to type 2 diabetes mellitus. Accordingly, further research on the relationship between APOA5 variant rs651821 and plasma glucose regulation is needed.

There are some limitations of our study that should be acknowledged. First, the sample size of our study cohort was small. Hence, the subjects in this study may not be entirely representative of the general southeastern Chinese population. Second, there was a difference in age between the two groups due to the features of the disease itself, so maybe some selection biases existed. Third, our study did not include other etiologies of AP such as alcoholic pancreatitis, autoimmune pancreatitis, and drug-induced pancreatitis.

We excluded the patients with alcoholic pancreatitis because excessive alcohol intake can lead to elevated TG and the disturbance of lipid metabolism, which could potentially introduce unnecessary confounding factors in the downstream analysis. Likewise, we excluded drug-induced and autoimmune-induced AP to avoid potential confounders. Besides, few patients admitted to our hospital were diagnosed with these two less common etiologies. Future studies with larger sample sizes are required to confirm our results and to assess the genetic predisposition in other etiologies of AP.

Conclusions

In conclusion, this study provided preliminary evidence that variant rs651821 is associated with HLAP. Our data revealed the frequency of the risk allele of APOA5 rs651821 was significantly higher in the HLAP group, and carriers of the CC genotype had increased TG/APOB and FPG levels. Our results suggested that rs651821 might be an important genetic factor for HLAP in southeastern China.

Footnotes

Acknowledgments

We sincerely thank the study participants for their contribution to the research, as well as current and past investigators and staff.

Authors' Contributions

Y.L. designed and performed the study. Y.L., Z.H., A.Z., T.H., Y.Z., M.Y., and G.G. recruited the subjects, drew blood samples, and collected the data. Y.L., Y.L., and H.C. performed the experiments. Y.L. and Y.L. accomplished data analysis. Y.L. wrote the article. Z.H. reviewed and edited the article. All authors read and approved the article.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

The study was supported by Science and Technology Project of Quanzhou [2017Z003, 2019N022S] and High-level Talent Innovation Project of Quanzhou [2019CT007].

References

Adams

, Raffield

, Freedman

, et al. Analysis of common and coding variants with cardiovascular disease in the Diabetes Heart Study. Cardiovasc Diabetol, 2014; 13(1):77.

Baass

, Paquette

, Bernard

, et al. Familial chylomicronemia syndrome: An under-recognized cause of severe hypertriglyceridaemia. J Intern Med, 2020; 287(4):340-348.

Bai

, Kou

, Zhang

, et al. Functional polymorphisms of the APOA1/C3/A4/A5-ZPR1-BUD13 gene cluster are associated with dyslipidemia in a sex-specific pattern. PeerJ, 2019; 6:e6175.

Boxhoorn

, Voermans

, Bouwense

, et al. Acute pancreatitis. Lancet, 2020; 396(10252):726-734.

Chen

, Yang

, Li

, et al. Identification of a novel and heterozygous LMF1 nonsense mutation in an acute pancreatitis patient with severe hypertriglyceridemia, severe obesity and heavy smoking. Lipids Health Dis, 2019; 18(1):68.

Chokshi

, Blumenschein

, Ahmad

, et al. Genotype-phenotype relationships in patients with type I hyperlipoproteinemia. J Clin Lipidol, 2014; 8(3):287-295.

Chou

, Chen

, Shen

. A common variant in 11q23.3 associated with hyperlipidemia is mediated by the binding and regulation of GATA4. NPJ Genom Med, 2022; 7(1):4.

D'Erasmo

, Di Costanzo

, Cassandra

, et al. Spectrum of mutations and long-term clinical outcomes in genetic chylomicronemia syndromes. Arterioscler Thromb Vasc Biol, 2019; 39(12):2531-2541.

Dron

, Dilliott

, Lawson

, et al. Loss-of-function CREB3L3 variants in patients with severe hypertriglyceridemia. Arterioscler Thromb Vasc Biol, 2020; 40(8):1935-1941.

10.

, Chen

, Li

, et al. Chinese guidelines for the management of acute pancreatitis (Shenyang, 2019). J Clin Hepatol, 2019; 35(12):2706-2711. [In Chinese].

11.

, Tang

, Chen

, et al. Effects of polymorphisms in APOA4-APOA5-ZNF259-BUD13 gene cluster on plasma levels of triglycerides and risk of coronary heart disease in a Chinese Han Population. PLoS One, 2015; 10(9):e0138652.

12.

Gao

, Tabb

, Dimitrov

, et al. Exome sequencing identifies genetic variants associated with circulating lipid levels in Mexican Americans: The Insulin Resistance Atherosclerosis Family Study (IRASFS). Sci Rep, 2018; 8(1):5603.

13.

Goldberg

, Chait

. A comprehensive update on the Chylomicronemia Syndrome. Front Endocrinol (Lausanne), 2020; 11:593931

14.

Gombojav

, Lee

, Kho

, et al. Multiple susceptibility loci at chromosome 11q23.3 are associated with plasma triglyceride in East Asians. J Lipid Res, 2016; 57(2):318-324.

15.

Gonzales

, Donato

, Shah

, et al. Measurement of apolipoprotein B levels helps in the identification of patients at risk for hypertriglyceridemic pancreatitis. J Clin Lipidol, 2021; 15(1):97-103.

16.

Guo

, Song

, Li

, et al. Meta analysis of etiology and clinical features of recurrent acute pancreatitis in China in recent decade. Chin J Pancreatol, 2017; 17(04):231-237. [In Chinese.]

17.

Guo

, Li

, Zhang

, et al. Hypertriglyceridemia-induced acute pancreatitis: Progress on disease mechanisms and treatment modalities. Discov Med, 2019; 27(147):101-109.

18.

Hansen

SEJ

, Madsen

, Varbo

, et al. Genetic variants associated with increased plasma levels of triglycerides, via effects on the lipoprotein lipase pathway, increase risk of acute pancreatitis. Clin Gastroenterol Hepatol, 2021; 19(8):1652-1660 e1656.

19.

and Lyu

. The diagnosis and treatment of hypertriglyceridemic pancreatitis. Zhonghua Nei Ke Za Zhi, 2018; 57(2):149-151. [In Chinese.]

20.

Hernandez

, Passi

, Modarressi

, et al. Clinical management of hypertriglyceridemia in the prevention of cardiovascular disease and pancreatitis. Curr Atheroscler Rep, 2021; 23(11):72.

21.

Hooper

, Kurtkoti

, Hamilton-Craig

, et al. Clinical features and genetic analysis of three patients with severe hypertriglyceridaemia. Ann Clin Biochem, 2014; 51(Pt 4):485-489.

22.

Kefi

, Hechmi

, Dallali

, et al. Association of apolipoprotein A5 gene variants with metabolic syndrome in Tunisian population. Ann Endocrinol (Paris), 2017; 78(3):146-155.

23.

Ken-Dror

, Goldbourt

, Dankner

. Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins. J Hum Genet, 2010; 55(5):300-307.

24.

Kersten

. Physiological regulation of lipoprotein lipase. Biochim Biophys Acta, 2014; 1841(7):919-933.

25.

Kim

, Anwar

, Choi

. Association of BUD13-ZNF259-APOA5-APOA1-SIK3 cluster polymorphism in 11q23.3 and structure of APOA5 with increased plasma triglyceride levels in a Korean population. Sci Rep, 2019; 9(1):8296.

26.

Koopal

, Bemelmans

, Marais

, et al. Severe hypertriglyceridaemia and pancreatitis in a patient with lipoprotein lipase deficiency based on mutations in lipoprotein lipase (LPL) and apolipoprotein A5 (APOA5) genes. BMJ Case Rep, 2019; 12(4):e228199.

27.

Lee

, Papachristou

. New insights into acute pancreatitis. Nat Rev Gastroenterol Hepatol, 2019; 16(8):479-496.

28.

Lim

, You

, Yoon

, et al. The effect of heritability and host genetics on the gut microbiota and metabolic syndrome. Gut, 2017; 66(6):1031-1038.

29.

Nordestgaard

, Varbo

. Triglycerides and cardiovascular disease. Lancet, 2014; 384(9943):626-635.

30.

Opoku

, Gan

, Fu

, et al. Prevalence and risk factors for dyslipidemia among adults in rural and urban China: Findings from the China National Stroke Screening and prevention project (CNSSPP). BMC Public Health, 2019; 19(1):1500.

31.

Pan

, Yang

, Wu

, et al. The prevalence, awareness, treatment and control of dyslipidemia among adults in China. Atherosclerosis, 2016; 248:2-9.

32.

Paquette

, Amyot

, Fantino

, et al. Rare variants in triglycerides-related genes increase pancreatitis risk in Multifactorial Chylomicronemia Syndrome. J Clin Endocrinol Metab, 2021; 106(9):e3473-e3482.

33.

Pennacchio

, Olivier

, Hubacek

, et al. An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing. Science, 2001; 294(5540):169-173.

34.

Perrone

, Brunelli

, Perrone

, et al. A successful term pregnancy with severe hypertriglyceridaemia and acute pancreatitis. Clinical management and review of the literature. Atheroscler Suppl, 2019; 40:117-121.

35.

, Yang

, Shi

, et al. Gene-environment interaction between APOA5 c.553G>T and pregnancy in hypertriglyceridemia-induced acute pancreatitis. J Clin Lipidol, 2020; 14(4):498-506.

36.

Saleheen

, Soranzo

, Rasheed

, et al. Genetic determinants of major blood lipids in Pakistanis compared with Europeans. Circ Cardiovasc Genet, 2010; 3(4):348-357.

37.

Tan

, Sun

, Xia

, et al. A genome-wide association and gene-environment interaction study for serum triglycerides levels in a healthy Chinese male population. Hum Mol Genet, 2012; 21(7):1658-1664.

38.

Wang

, Zhou

, He

, et al. APOA5 rs651821 confers increased risk for hypertension in Tongdao Dong population. Clin Exp Hypertens, 2020; 42(1):81-85.

39.

, Yu

, Zhao

, et al. Interactions of environmental factors and APOA1-APOC3-APOA4-APOA5 gene cluster gene polymorphisms with Metabolic Syndrome. PLoS One, 2016; 11(1):e0147946.

40.

Xiao

, Sun

, Zhang

, et al. Association analysis of APO gene polymorphisms with ischemic stroke risk: A case-control study in a Chinese Han population. Oncotarget, 2017; 8(36):60496-60503.

41.

, Lu

, Liu

, et al. Apolipoprotein A5 gene polymorphisms are associated with non-alcoholic fatty liver disease. Hepatobiliary Pancreat Dis Int, 2018; 17(3):214-219.

42.

Yang

, Zhang

, Liu

, et al. Comparison of clinical characteristics of severe hyperlipidemic pancreatitis and severe acute gallstone pancreatitis. Chin J Gen Pract, 2017; 16(09):692-695. [In Chinese.]

43.

You

, Wu

, Zhang

, et al. Effects of polymorphisms in APOA5 on the plasma levels of triglycerides and risk of coronary heart disease in Jilin, northeast China: A case-control study. BMJ Open, 2018; 8(6):e020016.

44.

Zhang

, Xing

, Wu

, et al. The prevalence, awareness, treatment, and control of dyslipidemia in northeast China: A population-based cross-sectional survey. Lipids Health Dis, 2017; 16(1):61.

45.

Zhang

, Deng

, Jin

, et al. Hypertriglyceridaemia-associated acute pancreatitis: Diagnosis and impact on severity. HPB (Oxford), 2019; 21(9):1240-1249.

46.

Zheng

, Li

, Zhu

, et al. Superoxide dismutase predicts persistent circulation failure and mortality in the early stage of acute pancreatitis. Dig Dis Sci, 2020; 65(12):3551-3557.

47.

Zhu

, Wang

, Liang

, et al. Triglyceride-raising APOA5 genetic variants are associated with obesity and non-HDL-C in Chinese children and adolescents. Lipids Health Dis, 2014; 13:93.

48.

Zhu

, Zhang

, Zhou

, et al. Susceptibility loci for metabolic syndrome and metabolic components identified in Han Chinese: A multi-stage genome-wide association study. J Cell Mol Med, 2017; 21(6):1106-1116.

Association of Apolipoprotein A5 Gene Variants with Hyperlipidemic Acute Pancreatitis in Southeastern China

Abstract

Background:

Methods:

Results:

Conclusions:

Introduction

Methods

Study design

Subjects

Biochemical measurements

Genotyping analysis

Statistical analysis

Results

General characteristics

Genotype distribution comparison

APOA5 rs651821 and the risk of HLAP

Association between genotypes and general characteristics

Discussion

Conclusions

Footnotes

Acknowledgments

Authors' Contributions

Author Disclosure Statement

Funding Information

References