Sage Journals: Discover world-class research

Abstract

Introduction:

Studies indicate that ∼7% of pregnant individuals in North America consume cannabis in pregnancy. Pre-clinical studies have established that maternal exposure to Δ⁹-tetrahydrocannabinol (THC; major psychoactive component in cannabis) leads to fetal growth restriction and impaired cardiac function in offspring. However, the effects of maternal exposure to cannabidiol (CBD; major non-euphoric constituent) on cardiac outcomes in offspring remain unknown. Therefore, our objective is to investigate the functional and underlying molecular impacts in the hearts of offspring exposed to CBD in pregnancy.

Methods:

Pregnant Wistar rats were exposed to either 3 or 30 mg/kg CBD or vehicle control i.p. daily from gestational day 6 to term. Echocardiography was used to assess cardiac function in male and female offspring at postnatal day (PND) 21. Furthermore, quantitative polymerase chain reaction (qPCR), immunoblotting, and bulk RNA-sequencing (RNA-seq) were performed on PND21 offspring hearts.

Results:

Despite no differences in the heart-to-body weight ratio, both doses of CBD led to reduced cardiac function exclusively in male offspring at 3 weeks of age. Underlying this, significant alterations in the expression of the endocannabinoid system (ECS; e.g., decreased cannabinoid receptor 2) were observed. In addition, bulk RNA-seq data demonstrated transcriptional pathways significantly enriched in mitochondrial function/metabolism as well as development.

Conclusion:

Collectively, we demonstrated for the first time that gestational exposure to CBD, a constituent perceived as safe, leads to early sex-specific postnatal cardiac deficits and alterations in the cardiac ECS in offspring.

Introduction

With the increased legalization across North America, studies suggest that the self-reported prevalence of cannabis use in pregnancy is ∼7%, with daily or near-daily use at 3.4%.¹ Depending on the population studied, sample size, definition of cannabis use, and the methods of detecting cannabis, prevalence can range anywhere between 2% and 35%.^1–4 Studies indicate that consumption of cannabis products may be due to managing preexisting conditions such as depression and chronic pain as well as pregnancy-related symptoms such as nausea.⁵ Furthermore, a large-scale integrative review indicates that the uncertainty regarding adverse perinatal consequences was a strong driver for continued use in pregnancy.⁶ Overall, this is of concern given some clinical studies report that maternal cannabis use leads to low birthweight outcomes,^7,8 which is associated with an increased risk for cardiovascular disease.⁹

Δ⁹-tetrahydrocannabinol (THC), the major psychoactive constituent, and cannabidiol (CBD) the major non-euphoric constituent, are the two most abundant and widely known constituents in cannabis. THC and CBD are highly lipophilic and can cross the placental barrier into fetal circulation where they can impact placental function and/or exert direct effects on the developing fetus.¹⁰ To date, we and others have demonstrated that prenatal THC exposure in rodents leads to placental insufficiency and fetal growth restriction.^11–14 Furthermore, this results in abnormal fetal heart development, postnatal cardiac remodeling, and impaired cardiac function in 3-week old offspring.^15,16 However, the impact that prenatal CBD has on fetal development and postnatal heart function remains unknown. This is a crucial knowledge gap given that CBD products have skyrocketed over the last few years and are perceived and marketed as a safe and therapeutic constituent.¹⁷

A recent Canadian study indicates that up to one in four North Americans report using CBD products¹⁸ and another study reporting that a majority (62%) of those who consume CBD use it to treat medical conditions such as pain and anxiety,¹⁹ both of which are common symptoms of pregnancy. Indeed, preliminary data suggest that 20–30% of women would take CBD products to treat nausea, anxiety, and pain during pregnancy.²⁰ To date, there are limited pre-clinical studies investigating the safety of prenatal CBD exposure on offspring. Among the studies that do, only the reproductive,^21,22 neurobehavioral,^23–25 hepatic,²⁶ and pancreatic outcomes²⁷ in offspring have been explored. Given that maternal THC exposure impacts heart function in offspring,^15,16 and that Δ⁹-THC and CBD may share some common signaling pathways,²⁸ there is great impetus to study the effects CBD has on fetal development and postnatal cardiac outcomes.

Phytocannabinoids can interact with the canonical endocannabinoid system (ECS), most well-studied through the cannabinoid receptor 1 (CB1) and 2 (CB2). This ECS also includes endogenously produced endocannabinoids, namely anandamide (AEA) and 2-arachidonyl glycerol (2-AG) and their respective enzymes responsible for its turnover. This system is known to be expressed in peripheral tissue, including the heart (CB1 and CB2 found in the rat and human myocardium^29,30 as well as cardiomyocytes³¹). In the heart, it seems that the regulation of the ECS is not involved in cardiovascular function under normal physiological conditions, however, cardiac pathologies are associated with an altered ECS, as reviewed.^32–36 This altered ECS is thought to be a cardioprotective response with much of the protective role seemingly attributed to the activation of CB2 in the heart.^35,36

Conversely, current knowledge on the cardiac ECS suggests that increases in CB1 activation have cardiodeleterious effects, while antagonism has cardioprotective effects, as previously reviewed.^32,35,36 Despite the importance of endocannabinoids in cardiovascular disease, little is known regarding the effects of the ECS on the heart after gestational cannabinoid exposure. Interestingly, CBD has been demonstrated to modulate the ECS.^37–39 For example, CBD has been reported to be a negative allosteric modulator of the CB1 receptor³⁸ and to inhibit fatty acid amide hydrolase (FAAH, a major enzyme that degrades the endocannabinoid AEA) in mouse brain,³⁹ which may increase AEA. However, it remains elusive if this occurs during critical windows of heart development.

This opens the possibility for CBD to “rewire” the ECS in development. It has been previously postulated that cannabinoid exposure in utero may be a “first hit” to the ECS, jeopardizing normal ECS development, which may increase susceptibility to future stressors and cardiovascular disease.⁴⁰ Therefore, the goal of this study is to investigate the effects of prenatal CBD exposure on the postnatal cardiac function and to determine if this is associated with alterations in the ECS in the heart.

Methods

CBD animal model

All animal procedures were conducted in accordance with the guidelines and standards of the Canadian Council on Animal Care. Animal Use Protocol (AUP No. 2019-126) was approved and was monitored by the Western University Animal Care Committee. All investigators understood and followed the ethical principles outlined by Grundy⁴¹ and the methods were performed in accordance with Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. Time-pregnant Wistar rat dams were purchased from Charles River (La Salle) and were maintained at 22°C on a light–dark cycle (12:12 light:dark) with access to food and water ad libitum. Dams arrived at the animal facility at gestational day (GD) 3 and were left to acclimatize for 3 days. Throughout gestation, maternal food intake and body weight were monitored to study the maternal weight gain and nutrition, as previously published.¹¹ Length of gestation was also measured to account for pre-term labor.

At birth, litters were counted and culled to 8 for uniform postnatal nutrition. Of the culled pups, hearts were weighed and flash frozen for RNA analysis. At postnatal day (PND) 21, male and female offspring were sacrificed with an overdose of pentobarbital i.p. followed by decapitation. Heart tissues were dissected, weighed, and flash frozen in liquid nitrogen for further protein and RNA analysis.

Drug preparation and exposure

CBD was received in powder form with 99.9% purity (Canopy) and was mixed with cremophor to the experimental concentrations. Similar to our previously published prenatal cannabinoid exposure paradigms,^{11,15,42–45} pregnant dams were randomly assigned to a treatment group and administered 3 mg/kg (n=8), 30 mg/kg of CBD (n=9), or vehicle control (1:18 cremophor: saline, n=8) daily via i.p. injection from GD6 to GD22 (birth). This window of exposure was selected because it has been demonstrated that THC exposure before GD5.5 adversely impacts implantation in rodents.⁴⁶

Although, to our knowledge, no studies examine the effects of CBD on implantation and spontaneous abortion in rodents before GD5.5, in vitro studies suggest that it may impact implantation.⁴⁷ The low dose of 3 mg/kg i.p. CBD has been previously reported to result in a serum concentration of ∼9 ng/mL.⁴⁸ Chronic exposure (14 days) to 30 mg/kg CBD per day has also been demonstrated to be safe and lead to stable serum concentrations of 180–220 ng/mL in vivo.⁴⁹ While humans studies on maternal CBD plasma concentrations are limited, we chose these doses of CBD to reflect the wide range of CBD reported in human umbilical cord tissue (10–332 ng/mL) in fetuses exposed to cannabis in pregnancy.⁵⁰ With respect to nonpregnant people, CBD plasma levels also vary greatly between individuals and depend on dose and route of exposure.

A small study demonstrated that individuals smoking a single cigarette led to an average peak blood plasma level of CBD, 110 ng/mL (range: 42–191 ng/mL), and in another study, 20 mg [2H]CBD via i.v. injection led to CBD plasma levels peaking at 686 ng/mL (356–962 ng/mL)—as reviewed.⁵¹ Moreover, our dose range of CBD has an estimated human equivalent dose range of ∼0.48–4.8 mg/kg using scaling factors for body surface area.⁵²

Echocardiographic assessment of cardiac function

The Vevo2100 Ultrasound Imaging System was used to assess cardiac function. A two-dimensional echocardiographic footage was captured blinded in PND21 vehicle and CBD-exposed offspring. Parasternal short axial and long axial views were captured using a 40 MHz linear transducer, as previously published.¹⁵ Throughout the echocardiography, animals were sedated using isoflurane (0.5–1.5%) through a nose cone. Heart rate was measured using electrode probes on the extremities and body temperature was maintained with a heating dock and monitored using a rectal probe. Real-time images obtained in the short axial view were used to measure parameters such as left ventricular posterior wall (LVPW) and anterior wall (LVAW) thickness as well as left ventricular interior diameter (LVID) at systole and diastole. Estimates were made for cardiac function parameters (e.g., stroke volume, ejection fraction and cardiac output) using left ventricular traces in systole and diastole.⁵³

RNA extractions and real-time quantitative reverse transcription polymerase chain reaction

Total RNA was isolated from rat heart tissue using TRIzol (Invitrogen) and chloroform (Sigma-Aldrich) extraction. RNA was diluted to 2 μg for reverse-transcriptase with a High-Capacity cDNA (complementary DNA) Reverse Transcriptase Kit (No. 4368814; Applied Biosystems) to make cDNA. Primer sets were designed using the NCBI Primer-BLAST tool (Table 1). SsoFast Eva green supermix (Bio-Rad) and Bio-Rad CFX384 Real-Time System were used with cyclic conditions set at 95°C for 3 min, followed by 43 cycles of 95°C for 15 sec, 58°C for 30 sec, and 72°C for 30 sec. All primer sets used were tested for one distinct melt peak and determined to fall within 90–110% primer efficiency. Relative transcript (messenger RNA [mRNA]) abundance obtained for all target genes of interest was normalized to the geometric means of 18S and β-actin.

Table 1.

Primer Sequences for Quantitative Real-Time Polymerase Chain Reaction

Gene	Forward	Reverse	GenBank/Ref.
Cnr1 (CB1)	CATTTCAAGCAAGGAGCACCC	GGTCTGTGGTGATGGTACGG	NM_012784.5
Cnr2 (CB2)	AGGTTGCATTCCCAACAGAC	TTAGTTCCTCTGGGCAATGG	NM_001164143.3
Faah	GTTCACCTTGGACCCTACCG	AGAAGGGAATCAGCGTGTGG	NM_001369126.1
Napepld	AGCTTATGAGCCAAGGTGGT	AGCTAAGGCAAAAGTCCCCC	NM_199381.2
Mgll (MGL)	ACCAACCCACTTTTCTGGCA	CAACCTCCGACTTGTTCCGA	NM_001398597.1
Daglα	CAGTACGTGCTCTACGTGCG	AGACGACCATCCCGAGAGT	NM_001005886.2
Beta actin	CCCGCGAGTACAACCTTCTT	TCATCCATGGCGAACTGGTG	NM_031144.3
18S	GGCCGTTCTTAGTTGGTGGA	CCCGGACATCTAAGGGCATC	NR_046237.2

CB1, cannabinoid receptor 1; CB2, cannabinoid receptor 2; MGL, monoacylglycerol lipase.

The ΔCt values for each primer were calibrated to experimental samples with the lowest transcript abundance (highest Ct value). Relative transcript abundance was then calculated for each primer set as determined by the formula 2^ΔΔCt, where ΔΔCt was the normalized value.

Protein extraction and Western blot

Total protein from rat heart tissue was extracted by homogenization and sonication in RIPA buffer solution with protease and phosphatase inhibitors. Total protein samples were quantified using a BCA protein assay kit (No. 23225; Thermo Scientific) and diluted to 20 μg/well of protein. A pooled sample was prepared with contribution from every sample across treatment groups. Protein samples were separated via gel electrophoresis using 4–12% Bis-Tris gradient gels (Invitrogen) and transferred onto polyvinylidene difluoride membranes. Ponceau S (0.1%) staining was applied to the membranes and imaged to ensure equal loading and proper transfer of proteins. Membranes were blocked with 5% bovine serum albumin (BSA) for 1 h at room temperature and then probed overnight in 4° with a primary antibody for CB2 (ab3561; Abcam) or monoacylglycerol lipase (MGL; sc-398942; Santa Cruz), diluted to 1:2000 and 1:1000 in 5% BSA, respectively.

Goat anti-rabbit (7074P2; Cell Signaling Technology) or horse anti-mouse (7076S; Cell Signaling Technology) IgG HRP-linked secondary antibody was diluted to 1:10,000 in 5% BSA and rotated at room temperature for 1 h. Immunoreactive bands were detected using the Super Signal West Dura Chemiluminescent Substrate (Thermo Fisher Scientific) and then imaged on ChemiDoc Imager (Bio-Rad). For quantification, relative band density was normalized to total protein using Ponceau S staining and quantified using the Image Lab software 6.0.1 (Bio-Rad). When two blots were used for quantitative measurements, a pooled sample ratio between the two blots was used to normalize densitometry values.

RNA-sequencing and analysis

Previously collected and frozen hearts from 3-week-old male vehicle (n=7), CBD 3 mg/kg (n=6)-, and CBD 30 mg/kg (n=5)-exposed offspring were sent to Genome Quebec (Montreal, Canada) for total TRIzol-phenol RNA extraction, library preparation, and RNA-sequencing (RNA-seq). Quality of RNA was assessed using the RNA integrity number (RIN), with all samples having an RIN score ≥7.0. Paired end reads (25 million, 100 bp) were sequenced on the Illumina NovaSeq platform (NovaSeq 6000).

All reads were aligned and annotated with the latest ENSEMBL rat genome release available (mRatBN7.2) using the R package Rsubread with default settings. Raw counts were generated using the Rsubread sub package featureCounts. To correct for batch effects, the R package ComBat_seq was used.⁵⁴ The treatment group of the hearts was included as a factor for the model. Lowly expressed genes were then filtered out using a counts per million (CPM) cutoff of 0.5 in at least five or more samples. To convert ENSEMBL gene IDs to gene symbols, the gprofiler2 R interface for g:Profiler was used. Normalization and differential expression analysis were done using the edgeR R package.⁵⁵ Counts were normalized for both library size and library composition using the trimmed means of M-values (TMM) method.

Normalized counts were then fit to a genewise negative binomial generalized linear model, and a quasilikelihood F test used for differential expression analysis of contrasts of interest. To account for multiple testing, p-values were adjusted using Benjamini & Hochberg false discovery rate (FDR) correction. An FDR cutoff of <0.05 was used to determine significance. Gene set enrichment analysis (GSEA) using the Gene Ontology (GO) database was performed using clusterProfiler. To generate a ranked metric for the GSEA, the −log10 transformed unadjusted p-values for all genes in the analysis (14,959 genes) were multiplied by the sign of their respective fold change and arranged in descending order. Significance for the GSEA was determined with an FDR cutoff of <0.01.

Statistical analysis

All maternal, neonatal, echocardiographic, quantitative polymerase chain reaction (qPCR), and immunoblotting data are represented as mean±standard error of the mean. We sought to determine whether either dose of CBD led to changes relative to the vehicle control, therefore one-way analysis of variance (ANOVA) with post hoc Dunnett's multiple comparisons test was used. Values of p<0.05 were considered statistically significant. Statistical outliers were determined using Grubb's test. All aforementioned statistical tests were completed with GraphPad 8 Prism software. For statistical analysis used in RNA-seq, see above in the “RNA-Sequencing and Analysis” section. Throughout all experiments, to avoid litter bias, offspring were randomly selected from separate litters (i.e., n=1 represents pups from a single pregnant rat).

Results

CBD exposure in rats does not affect maternal weight gain and food intake

Similar to previous studies with maternal THC exposure,^11,12,56 maternal exposure to a daily dose of 3 or 30 mg/kg i.p. injections from GD6 to GD22 did not alter maternal food intake or weight gain (Table 2). Moreover, both doses of CBD did not affect litter sizes and nearly all pups were born at-term, and therefore, there were no significant differences in gestational length (Table 2).

Table 2.

Maternal Outcome Measurements

Maternal measurements	VEH (N=8)	CBD3 (N=8)	CBD30 (N=9)	p
Maternal measurements	VEH (N=8)	CBD3 (N=8)	CBD30 (N=9)	VEH vs. CBD3	VEH vs. CBD30
Gestational length (days)	21.9±0.125	21.8±0.164	21.9±0.111	0.742	0.996
Average food intake: days 12–14 (g/day)	23.0±0.655	24.9±1.54	25.9±2.11	0.627	0.353
Average food intake: days 18–20 (g/day)	23.6±0.533	23.0±0.688	24.7±1.05	0.870	0.558
Pregnancy weight gain: GD6–GD21 (g)	103.8±5.83	105.5±5.83	100.8±9.08	0.985	0.955
Litter size at birth	9.25±0.526	9.75±0.526	8.44±0.973	0.852	0.655

All values are expressed as mean±SEM, N=8–9 moms/group. PND21 survival measurements include all males and females. One-way ANOVA post hoc Dunnett's was used for statistical analysis.

ANOVA, analysis of variance; CBD, cannabidiol; GD, gestational day; PND, postnatal day; SEM, standard error of the mean; VEH, vehicle.

CBD exposure in rats does not affect neonatal and postnatal weight measurements

Given previous studies demonstrated that maternal THC exposure leads to fetal growth deficits¹¹ and smaller hearts at birth,¹⁵ we measured these parameters in the current study but found that neither doses of prenatal CBD altered birthweight or heart-to-body weight ratios at birth (Table 3). Similarly, both sexes at PND21 did not exhibit significant changes in body weight or heart-to-body weight ratios in either dose relative to vehicle control (Table 3).

Table 3.

Offspring Postnatal Weight Measurements

Weight measurement	VEH (N=7–10)	CBD3 (N=9–10)	CBD30 (N=7–8)	p
Weight measurement	VEH (N=7–10)	CBD3 (N=9–10)	CBD30 (N=7–8)	VEH vs. CBD3	VEH vs. CBD30
PND1 body weight (g)	6.70±0.104	6.56±0.0950	6.54±0.0935	0.514	0.425
PND1 heart-to-birthweight ratio	0.00570±0.000372	0.00479±0.000380	0.00543±0.000232	0.129	0.834
Male PND21 body weight (g)	60.7±2.31	57.10±1.10	61.00±2.59	0.344	0.993
Male PND21 heart-to-body weight ratio	0.00626±0.000300	0.006670±0.000311	0.00657±0.000434	0.599	0.764
Female PND21 body weight (g)	59.4±1.64	54.7±1.32	55.0±1.84	0.0688	0.120
Female PND21 heart-to-body weight ratio	0.00737±0.000332	0.00654±0.000227	0.00672±0.000429	0.132	0.316

All values are expressed as mean±SEM, N=7–10 animals/group/sex. Each animal was taken from a different litter to account for litter bias. One-way ANOVA post hoc Dunnett's was used for statistical analysis.

PND21 male but not female offspring exposed to a daily dose of 3 or 30 mg/kg CBD in gestation exhibit reduced cardiac function

To determine if maternal CBD exposure impacts postnatal left ventricular function in offspring, echocardiography was performed on males and females at PND21. Male offspring exposed to 3 and 30 mg/kg CBD in gestation demonstrated a significant (p<0.05) reduction of ∼27% and ∼30% in stroke volume, respectively (Fig. 1b). In addition, male offspring exposed to either dose of CBD exhibited a significant (p<0.01 for CBD3; p<0.05 for CBD30) decrease of >30% in cardiac output (Fig. 1c). Furthermore, male offspring exposed to 30 mg/kg CBD displayed a significant (p<0.01) 10% reduction in ejection fraction (Fig. 1d). Furthermore, there were no immediate signs of neonatal mortality up to PND21 in both doses, nor were there any changes in LVID (Fig. 1f, g), wall thickness, LV mass, or LV volume at systole and diastole via echocardiography (Supplementary Table S1).

FIG. 1.

Echocardiographic assessment indicates that 3 and 30 mg/kg/day CBD during gestation leads to decreased cardiac function in males but not female offspring at PND21. Male (a) heart rate, (b) stroke volume, (c) cardiac output, (d) ejection fraction, (e) fractional shortening, (f) LVIDd, and (g) LVIDs, at 3 weeks. Female (h) heart rate, (i) stroke volume, (j) cardiac output, (k) ejection fraction, (l) fractional shortening, (m) LVIDd, and (n) LVIDs, at 3 weeks. Mean±SEM, n=6–7 males/group, n=5–7 females/group. Each echo was performed on offspring from a different litter to account for litter bias. Significance; one-way ANOVA post hoc Dunnett's test (*p<0.05, **p<0.01). ANOVA, analysis of variance; CBD, cannabidiol; LVIDd, left ventricular internal diameter end diastole; LVIDs, left ventricular internal diameter end systole; PND, postnatal day; SEM, standard error of the mean.

Unlike males, the cardiac function in female CBD-exposed offspring remained unaffected relative to their vehicle control groups at PND21 (Fig. 1h–n and Supplementary Table S1).

The ECS was altered in PND21 male offspring hearts exposed to CBD in gestation

Given that the ECS is known to be dysregulated in cardiovascular disease state,^34–36 we next sought to determine whether the observed cardiac deficits in CBD-exposed offspring males were associated with sex-specific alteration in the ECS. To investigate whether males and females exhibited changes in the cardiac ECS, we measured the steady-state mRNA transcript abundance of the major endocannabinoid receptors as well as degradative and synthesizing endocannabinoid enzymes. This included CB1 and CB2 as well as synthesizing (NAPE-PLD, N-acyl phosphatidylethanolamine phospholipase D and DAGL, diacylglycerol lipase) and degrading enzymes (FAAH and MGL). qPCR data indicated that there was a significant (p<0.05) decrease in the CB2 receptor mRNA expression (Fig. 2b) in male offspring hearts exposed to 30 mg/kg CBD in gestation. Consistent with this trend, immunoblots also demonstrated a significant (p<0.05) decrease in protein expression of CB2 in these CBD-exposed male offspring hearts (Fig. 2m).

FIG. 2.

Gestational exposure to CBD leads to sex-specific alterations in cardiac endocannabinoid system targets in offspring at PND21. RT-qPCR measurements for steady-state mRNA levels of (a) Cnr1 (CB1), (b) Cnr2 (CB2), (c) Napepld, (d) Faah, (e) Dagl (Daglα isoform), and (f) Mgll (MGL) in male hearts. RT-qPCR measurements for steady-state mRNA levels of (g) Cnr1 (CB1), (h) Cnr2 (CB2), (i) Napepld, (j) Faah, (k) Dagl (Daglα isoform), and (l) Mgll (MGL) mRNA expression in female hearts. Immunoblot measurement for the cardiac protein expression of (m) CB2 in males and (n) MGL in females with the respective representative immunoblots and total protein Ponceau S staining for normalization. Each immunoblot target shown is the representative for one out of two immunoblots performed, a pooled sample was loaded into the last lane on the right (cropped out) to normalize relative band intensity between the two blots. Full-length blots can be found in Supplementary Figures S2 and S3. Mean±SEM, n=8 males/group and n=7–8 females/group for RT-qPCR data. n=7–8 sex/group for immunoblot data. Each sample was taken from an animal in a different litter to account for litter bias. Significance; one-way ANOVA post hoc Dunnett's (*p<0.05, **p<0.01). Outliers were removed based on Grubb's test (alpha=0.05). CB1, cannabinoid receptor 1; CB2, cannabinoid receptor 2; MGL, monoacylglycerol lipase; mRNA, messenger RNA; RT-qPCR, real-time quantitative reverse transcription polymerase chain reaction.

Although CBD-exposed females did not demonstrate alterations in the expression of cannabinoid receptors, females exposed to both doses of CBD exhibited significant (p<0.01 for CBD3; p<0.05 for CBD30) reductions in cardiac Mgll (an enzyme that degrades primarily 2-AG) transcript abundance (Fig. 2l). However, immunoblotting revealed that there were no significant changes in the protein expression in MGL in female hearts exposed to CBD (Fig. 2n).

Alteration in the ECS mRNA expression was observed as early as PND1 in male offspring hearts exposed to CBD in gestation

Given that male PND21 hearts demonstrated decreases in CB2 expression, despite the cessation of CBD exposure at birth, we next sought to determine whether these changes occurred earlier in development. Interestingly, there was a significant (p<0.05) reduction in cardiac CB2 receptor transcript abundance in the CBD30-treated group at birth (PND1) (Fig. 3b), similar to PND21 offspring. In addition, there was a significant (p<0.05) transcript reduction in endocannabinoid synthesizing enzyme, Daglα (an enzyme that synthesizes 2-AG), in groups exposed to both doses (Fig. 3e), which may have effects on 2-AG synthesis.

FIG. 3.

Gestational exposure to CBD decreases transcript levels of cannabinoid receptor 2 and diacylglycerol lipase in male offspring hearts at birth. RT-qPCR measurements for steady-state mRNA levels of (a) Cnr1 (CB1), (b) Cnr2 (CB2), (c) Napepld, (d) Faah, (e) Dagl (Daglα isoform), and (f) Mgll (MGL). Mean±SEM, n=7 males/group. Each sample was taken from an animal from a different litter to account for litter bias. Significance; one-way ANOVA post hoc Dunnett's (*p<0.05). Outliers were removed based on Grubb's test (alpha=0.05).

Transcriptomic changes in PND21 male offspring hearts exposed to 3 and 30 mg/kg CBD during gestation

Given that an altered ECS (e.g., decreased CB2) can impact cellular and molecular pathways underlying cardiac function, we next sought to examine the postnatal transcriptome-wide changes using bulk RNA-seq in exposed male offspring hearts to further delineate the underlying mechanisms involved. Since changes in heart function and ECS were primarily observed in males, we focused on male hearts for bulk RNA-seq. Applying a p-value cutoff (p<0.05) and a fold change cutoff of two-fold, we identified 6 upregulated and 39 downregulated differentially expressed genes (DEGs) in offspring hearts exposed to 3 mg/kg CBD, as well as 7 upregulated and 73 downregulated DEGs in offspring hearts exposed to 30 mg/kg CBD (Supplementary Fig. S1b, c for volcano plots and Supplementary Tables S2 and S3 for gene lists). When an FDR cutoff (p<0.05) was applied to the DEG analysis, no DEG was identified.

This may be due to the variability we observed between treatment groups (Supplementary Fig. S1a) attributed to the heterogeneity of heart tissue. Given this, we performed GSEA (which accounts for all genes irrespective of meeting our cutoffs during our DEG analysis) using GO terms with an FDR cutoff of 0.01, to assess transcriptome wide pathways. We identified 54 downregulated and 30 upregulated GO terms for the CBD3 group as well as 42 downregulated and 34 upregulated GO terms for the CBD30 group (Supplementary Tables S4 and S5 for GSEA list). Interestingly, offspring hearts exposed to both doses of CBD demonstrated similar upregulated pathways related to mitochondria, its organization, and metabolic processes (i.e., “mitochondrial ATP synthesis coupled electron transport,” “mitochondrial membrane organization,” and “oxidative phosphorylation”) (Fig. 4a, c).

FIG. 4.

Bubble plot of the top GO terms from gene-set enrichment analysis in male offspring hearts exposed to 3 or 30 mg/kg CBD during gestation. The top 25 upregulated GO terms in offspring exposed to (a) 3 mg/kg (c) and 30 mg/kg CBD. The top 25 downregulated GO terms in offspring exposed to (b) 3 mg/kg and (d) and 30 mg/kg CBD. Functional enrichment analysis was carried out using g:Profiler with a g:SCS threshold of 0.01. n=5–7 males/group. GO, Gene Ontology.

For the downregulated pathways, offspring hearts exposed to both doses of CBD also exhibited similar changes in various developmental processes (i.e., “cell morphogenesis involved in differentiation,” “developmental growth,” and “animal organ morphogenesis”) (Fig. 4d and Supplementary Tables S4 and S5). Notably, both doses led to multiple downregulated pathways related to neuron development (Fig. 4b, d). The CBD 30 mg/kg-exposed male offspring specifically demonstrated downregulation in “heart development” (Supplementary Table S5).

Discussion

Despite the increasing prevalence of cannabis use in pregnancy¹ and rising popularity of CBD, the impact of CBD during pregnancy on fetal development and postnatal cardiac outcomes remains unknown. In this present study, we provide novel evidence that gestational exposure to CBD in rats leads to adverse cardiac outcomes in 3-week-old male but not female offspring.

It has been previously reported in both pre-clinical and clinical studies that either cannabis or THC alone leads to deficits in fetal growth.^7,8,11,12,57 We and others have previously established that maternal exposure to THC in rats does not alter maternal outcome measurements (i.e., food intake, weight gain, and gestation length) but leads to low birthweight as well as a significantly reduced heart-to-body weight ratio at birth.¹¹ In vivo studies also demonstrated that maternal THC exposure leads to decreased cardiac function and cardiac remodeling in offspring.^15,16 Such effects on the heart are thought to be, at least in part, due to fetal growth restriction¹⁵ given that low birthweight increases the risk of cardiovascular disease later in life.^9,58–60 Similar to THC, gestational CBD exposure does not alter maternal outcomes or litter size, which eliminates confounders such as altered maternal nutrition and fetal demise.

However, our current study differs from THC-exposed offspring, given that CBD-exposed animals did not exhibit changes in neonatal weight measurements (i.e., body weight and heart-to-body weight ratio) at birth. By PND21, males but not female CBD-exposed offspring demonstrated significant decreases in heart function with the higher dose demonstrating a reduction in additional parameters for contractile function (i.e., ejection fraction). The observed comprised heart function was not associated with mortality. We and others have similarly reported impairment of heart function in THC-exposed offspring at PND21.^15,16 These studies demonstrated a thicker left ventricular wall in THC-exposed hearts, which is not apparent in the CBD offspring. Despite this, these current results pose concerns that prenatal exposure to CBD leads to reduced systolic function at such an early age in life.

We anticipate that our observed cardiac deficits may progress with age similar to other models of perinatal insults (i.e., drug exposure, hypoxia, and maternal diet).^61–63 Furthermore, the reduced cardiac function could also suggest that these animals may have heightened susceptibility to future stressors (e.g., high-fat diet and ischemia/reperfusion).

Prior studies have associated a dysregulated ECS with various cardiovascular pathologies.^32,35,36,64 Given we postulated that prenatal CBD could impact the ECS, we examined whether there were any changes in the ECS associated with the observed adverse cardiac outcomes in males. Females exhibited a decrease in transcript abundance in Mgl, however, no changes were observed after protein analysis. Interestingly, specifically in males, we found a reduction in both the mRNA and protein levels of CB2 in PND21 offspring hearts. This prompted us to retroactively examine the hearts at birth, which revealed that there were indeed similar decreases in mRNA levels of CB2. Daglα transcript abundance was also decreased; however, it is unknown if this impacts 2-AG synthesis. Collectively, these data suggest that the changes in the ECS, in particular CB2, likely began in utero, supporting the notion that prenatal CBD may be able to directly “rewire” the ECS during development.⁴⁰

As previously mentioned, CB2 plays a cardioprotective role in the pathophysiology of cardiovascular disease. In fact, rodent studies with CB2-deficient mice demonstrated cardiac maladaptation and a decrease in left ventricular function upon insult (repetitive ischemia/reperfusion and pressure overload).^65,66 Moreover, these animals had an altered regulation of contractile proteins and a decreased antioxidative capacity (weaker upregulation of antioxidative enzymes).⁶⁵ Given this, we postulate that the downregulation of CB2 observed in our CBD30-exposed male hearts may underpin, at least in part, the more pronounced cardiac impairments relative to the control group. Moreover, since it has been shown that CB2 deficiency leads to exacerbated cardiac dysfunction in adults, this further supports the idea that the hearts of these animals may be more susceptible to a maladaptive response to future stressors and advancing age.

Based on the observed cardiac and endocannabinoid outcomes, we further examined transcriptome-wide changes in these CBD-exposed hearts. Specifically, we wanted to define alterations in various molecular processes associated with the functional cardiac deficits in these offspring. The most notable findings from our RNA-seq data were the upregulation of pathways involving mitochondrial metabolism (ETC, ATP synthesis, OXPHOS), which was consistent between males exposed to both doses of CBD in utero. Admittedly, the directionality we observed in these pathways was unexpected given that various models of different cardiovascular diseases often report decreases rather than increases in metabolic pathways involving oxidative phosphorylation and ATP synthesis. For example, in heart failure, there is typically a decrease in oxidative capacity, which leads to energy deficits (as reviewed in Lopaschuk et al.⁶⁷).

However, there are a few considerations worth noting. First, as the offspring are still young, these upregulated transcriptomic pathways could be early compensatory/adaptive mechanisms due to changes in energy demands in the etiology of a compromised heart.^67,68 Second, increases in mitochondrial respiration and ATP production are directly associated with reactive oxygen species production due to increased activity in the ETC,⁶⁸ which may negatively impact cardiac function. If there are indeed increases in reactive oxygen species, more studies will be required to determine whether cells are equipped with the proportionate antioxidative capacity (i.e., SOD1 and SOD2). Third, it is unknown whether upregulation of mitochondrial pathways is related to an abundance of mitochondrial mRNA due to increased mitochondrial fission. Previous studies with placental cells demonstrated that THC increases mitochondrial fission markers but also found more lower quality mitochondria.⁶⁹ This may be of great interest considering that abnormal mitochondrial fission contributes to disease development and ultimately heart failure.^70,71

With respect to downregulated GO terms, both doses of CBD in gestation led to a few pathways involved in development (i.e., “animal organ morphogenesis”). The higher dose-exposed offspring hearts also had a decrease in the “heart development” pathway. These transcriptome changes could suggest that prenatal exposure to CBD adversely impacts normal developmental trajectories. It is tempting to speculate that this, in part, culminates into the cardiac deficits observed. Furthermore, it is noteworthy that frequent hits on GO terms involving axon and dendrite growth and development (i.e., “cell morphogenesis involved in neuron differentiation,” “neuron migration,” “neuron projection morphogenesis”) were also observed. Although the effects of prenatal CBD on cardiac neural tissue are unknown, one study demonstrated that offspring exposed to maternal CBD (20 mg/kg/day) led to similar changes in GO terms from differential methylated loci in brain tissue.²³ One possibility for this observation in our current study may relate to the cardiac autonomic nervous system, which can influence atrioventricular node conduction as well as contractility, ultimately effecting hemodynamics (i.e., stroke volume, cardiac output, and heart rate),⁷² however, more studies are needed to explore this.

Our current study investigates the effects of CBD exposure during gestation and therefore may be limited in its scope with respect to other exposure windows such as prepregnancy and lactation. Although future studies should examine earlier windows of exposure to CBD, it is important to consider that exposure to other phytocannabinoids (e.g., THC) before E5.5 does adversely impact implantation in the rodents.⁴⁶ In addition, we acknowledge that i.p. injection is not a route of administration of cannabinoids in humans. The focus of the experimental design was to achieve a serum concentration similar to that of human users. Moreover, we have previously demonstrated that this prenatal cannabinoid model^42,43 reciprocates the metabolic outcomes observed in clinical studies.⁸

Another limitation of the study is that bulk RNA-seq is limited in its ability to account for different cell populations and may lead to variability between samples, which could hinder the detection of DEGs. Lastly, in our RNA-seq analysis, we only examined male hearts due to the observed changes in heart function and cardiac ECS specifically in males. As such, we were unable to tease out the potential transcriptome changes in females that may underlie the sex-specific effects.

Our study has a few future directions. First, future studies could examine whether a secondary insult (e.g., high-fat diet or ischemia/reperfusion) in adulthood leads to maladaptation and exacerbates cardiac deficits in exposed offspring. Second, while the current study does not elucidate why CBD-exposed females do not exhibit changes in cardiac function, future studies are warranted to address whether changes in sex hormone signaling (i.e., receptor mediated) or epigenetic mechanisms (i.e., imprinting) are involved. Long-term studies are warranted to address whether these cardiac deficits remain sex-specific after reproductive senescence in females. Third, further studies could address how different routes of cannabis exposure impact development and postnatal cardiac outcomes.

In summary, the current study has demonstrated that gestational exposure to 3 and 30 mg/kg CBD leads to cardiac deficits exclusively in 3-week-old male offspring. Furthermore, this may be attributed to early but persistent changes in the ECS during perinatal life resulting in decreased cardioprotection, and/or alterations in transcriptome pathways involved in mitochondrial function/metabolism. Considering that these offspring are both young and exhibit compromised cardiac function, there is great impetus to examine these animals later in life. Ultimately, these observed effects of maternal exposure to CBD, a constituent perceived and marketed as safe, may pose concern regarding the cardiovascular outcomes in offspring.

Data Availability

The raw and processed RNA-seq data used for the current study are accessible through NCBI Gene Expression Omnibus accession series GSE242079.

Footnotes

Acknowledgments

We thank Drs. Qingping Feng and Sharon Lu for their assistance with the Vevo2100 Ultrasound Imaging System.

Authors' Contributions

K.L., D.R.C.N., and D.B.H. were involved in the design, execution, and interpretation of experiments. K.L., M.N., and M.H.S. were involved with implementing the animal model. S.V. performed the bulk RNA-seq analysis and created the corresponding figures. S.R.L. contributed to the design of the animal experiments and in the preparation and dosing of vehicle and CBD in vivo. K.L. wrote the first draft of the article; all authors edited drafts of the article.

Author Disclosure Statement

The authors declare no competing interests.

Funding Information

This work was supported by the Canadian Institutes of Health Project Grant (R4228A28) to D.B.H. and D.R.C.N. and a Canadian Heart and Stroke Foundation Grant-in-Aid (G-19-0026343) to D.B.H. K.L. was the recipient of the Ontario Graduate Scholarship and Canada Graduate Scholarship (Doctoral) from the Canadian Institutes of Health Research.

Supplementary Material

Abbreviations Used

References

Volkow

, Han

, Compton

, et al. Self-reported medical and nonmedical cannabis use among pregnant women in the United States. JAMA, 2019; 322(2):167–169; doi: 10.1001/jama.2019.7982

Corsi

, Hsu

, Weiss

, et al. Trends and correlates of cannabis use in pregnancy: A population-based study in Ontario, Canada from 2012 to 2017. Can J Public Health, 2019; 110(1):76–84; doi: 10.17269/s41997-018-0148-0

Young-Wolff

, Tucker

L-Y

, Alexeeff

, et al. Trends in self-reported and biochemically tested marijuana use among pregnant females in california from 2009–2016. JAMA, 2017; 318(24):2490–2491; doi: 10.1001/jama.2017.17225

Mark

, Gryczynski

, Axenfeld

, et al. Pregnant women's current and intended cannabis use in relation to their views toward legalization and knowledge of potential harm. J Addict Med, 2017; 11(3):211–216; doi: 10.1097/ADM.0000000000000299

Vanstone

, Taneja

, Popoola

, et al. Reasons for cannabis use during pregnancy and lactation: A qualitative study. CMAJ, 2021; 193(50):E1906–E1914; doi: 10.1503/cmaj.211236

Bayrampour

, Zahradnik

, Lisonkova

, et al. Women's perspectives about cannabis use during pregnancy and the postpartum period: An integrative review. Prev Med, 2019; 119:17–23; doi: 10.1016/j.ypmed.2018.12.002

Campbell

, Gilliland

, Dworatzek

PDN

, et al. Socioeconomic status and adverse birth outcomes: A population-based Canadian sample. J Biosoc Sci, 2018; 50(1):102–113; doi: 10.1017/S0021932017000062

Moore

, Sauder

, Shapiro

ALB

, et al. Fetal exposure to cannabis and childhood metabolic outcomes: The Healthy Start Study. J Clin Endocrinol Metab, 2022; 107(7):e2862–e2869; doi: 10.1210/clinem/dgac101

Barker

, Osmond

, Law

. The intrauterine and early postnatal origins of cardiovascular disease and chronic bronchitis. J Epidemiol Community Health, 1989; 43(3):237–240; doi: 10.1136/jech.43.3.237

10.

Lee

, Hardy

. Metabolic consequences of gestational cannabinoid exposure. Int J Mol Sci, 2021; 22(17):9528; doi: 10.3390/ijms22179528

11.

Natale

, Gustin

, Lee

, et al. Δ⁹-Tetrahydrocannabinol exposure during rat pregnancy leads to symmetrical fetal growth restriction and labyrinth-specific vascular defects in the placenta. Sci Rep, 2020; 10(1):544; doi: 10.1038/s41598-019-57318-6

12.

Chang

, Bian

, He

, et al. Suppression of STAT3 signaling by Δ⁹-tetrahydrocannabinol (THC) induces trophoblast dysfunction. Cell Physiol Biochem, 2017; 42(2):537–550; doi: 10.1159/000477603

13.

Fried

. Short and long-term effects of pre-natal cannabis inhalation upon rat offspring. Psychopharmacology (Berl), 1976; 50(3):285–291; doi: 10.1007/BF00426846

14.

Hurd

, Wang

, Anderson

, et al. Marijuana impairs growth in mid-gestation fetuses. Neurotoxicol Teratol, 2005; 27(2):221–229; doi: 10.1016/j.ntt.2004.11.002

15.

Lee

, Laviolette

, Hardy

. Exposure to Δ⁹-tetrahydrocannabinol during rat pregnancy leads to impaired cardiac dysfunction in postnatal life. Pediatr Res, 2021; 90:532–539; doi: 10.1038/s41390-021-01511-9

16.

Robinson

, Ye

, Lu

, et al. Maternal delta-9-tetrahydrocannabinol exposure induces abnormalities of the developing heart in mice. Cannabis Cannabinoid Res, 2022; [Epub ahead of print]; doi: 10.1089/can.2022.0180

17.

Soleymanpour

, Saderholm

, Kavuluru

. Therapeutic claims in cannabidiol (CBD) marketing messages on Twitter. Proc IEEE Int Conf Bioinformatics Biomed, 2021; 2021:3083–3088; doi: 10.1109/bibm52615.2021.9669404

18.

Goodman

, Wadsworth

, Schauer

, et al. Use and perceptions of cannabidiol products in Canada and in the United States. Cannabis Cannabinoid Res, 2022; 7(3):355–364; doi: 10.1089/can.2020.0093

19.

Corroon

, Phillips

. A cross-sectional study of cannabidiol users. Cannabis Cannabinoid Res, 2018; 3(1):152–161; doi: 10.1089/can.2018.0006

20.

Selzer

, Morrison

, Bensadigh

, et al. Cannabidiol in Pregnancy: Attitudes of Obstetric-Related Healthcare Providers and Women 18–44 Years-Old in California, Orlando, Florida. Presented at the Anesthesiology Annual Meeting on October 19, 2019.

21.

Dalterio

, deRooij

. Maternal cannabinoid exposure. Effects on spermatogenesis in male offspring. Int J Androl, 1986; 9(4):250–258; doi: 10.1111/j.1365-2605.1986.tb00888.x

22.

Dalterio

, Steger

, Mayfield

, et al. Early cannabinoid exposure influences neuroendocrine and reproductive functions in male mice: I. Prenatal exposure. Pharmacol Biochem Behav, 1984; 20(1):107–113; doi: 10.1016/0091-3057(84)90110-2

23.

Wanner

, Colwell

, Drown

, et al. Developmental cannabidiol exposure increases anxiety and modifies genome-wide brain DNA methylation in adult female mice. Clin Epigenetics, 2021; 13(1):4; doi: 10.1186/s13148-020-00993-4

24.

Iezzi

, Caceres-Rodriguez

, Chavis

, et al. In utero exposure to cannabidiol disrupts select early-life behaviors in a sex-specific manner. Transl Psychiatry, 2022; 12(1):501; doi: 10.1038/s41398-022-02271-8

25.

Swenson

, Gomez Wulschner

, Hoelscher

, et al. Fetal cannabidiol (CBD) exposure alters thermal pain sensitivity, problem-solving, and prefrontal cortex excitability. Mol Psychiatry, 2023; 28(8):3397–3413; doi: 10.1038/s41380-023-02130-y

26.

Dalterio

, Thomford

, Michael

, et al. Perinatal cannabinoid exposure: Effects on hepatic cytochrome P-450 and plasma protein levels in male mice. Teratology, 1986; 33(2):195–201; doi: 10.1002/tera.1420330206

27.

Vanin

, Lee

, Nashed

, et al. Gestational exposure to cannabidiol leads to glucose intolerance in 3-month-old male offspring. J Endocrinol, 2024; 260(1):e230173; doi: 10.1530/JOE-23-0173

28.

Rokeby

ACE

, Natale

DRC

. Cannabinoids and the placenta: Receptors, signaling and outcomes. Placenta, 2023; 135:51–61; doi: 10.1016/j.placenta.2023.03.002

29.

Weis

, Beiras-Fernandez

, Sodian

, et al. Substantially altered expression pattern of cannabinoid receptor 2 and activated endocannabinoid system in patients with severe heart failure. J Mol Cell Cardiol, 2010; 48(6):1187–1193; doi: 10.1016/j.yjmcc.2009.10.025

30.

Lépicier

, Lagneux

, Sirois

, et al. Endothelial CB1-receptors limit infarct size through NO formation in rat isolated hearts. Life Sci, 2007; 81(17–18):1373–1380; doi: 10.1016/j.lfs.2007.08.042

31.

Mukhopadhyay

, Rajesh

, Bátkai

, et al. CB1 cannabinoid receptors promote oxidative stress and cell death in murine models of doxorubicin-induced cardiomyopathy and in human cardiomyocytes. Cardiovasc Res, 2010; 85(4):773–784; doi: 10.1093/cvr/cvp369

32.

Kaschina

Cannabinoid CB1/CB2 Receptors in the Heart: Expression, Regulation, and Function. In: Cannabinoids in Health and Disease. ( Meccariello

, Chianese

eds.) Intech Open Limited: London, UK; 2016.

33.

Hiley

. Endocannabinoids and the heart. J Cardiovasc Pharmacol, 2009; 53(4):267–276; doi: 10.1097/FJC.0b013e318192671d

34.

Alfulaij

, Meiners

, Michalek

, et al. Cannabinoids, the heart of the matter. J Am Heart Assoc, 2018; 7(14):e009099; doi: 10.1161/JAHA.118.009099

35.

Fulmer

, Thewke

. The endocannabinoid system and heart disease: The role of cannabinoid receptor type 2. Cardiovasc Hematol Disord Drug Targets, 2018; 18(1):34–51; doi: 10.2174/1871529X18666180206161457

36.

O'Sullivan

. Endocannabinoids and the Cardiovascular System in Health and Disease. In: Endocannabinoids. ( Pertwee

RG.

ed.) Handbook of Experimental Pharmacology Springer International Publishing: Cham, 2015; pp. 393–422; doi: 10.1007/978-3-319-20825-1_14

37.

Straiker

, Dvorakova

, Zimmowitch

, et al. Cannabidiol inhibits endocannabinoid signaling in autaptic hippocampal neurons. Mol Pharmacol, 2018; 94(1):743–748; doi: 10.1124/mol.118.111864

38.

Laprairie

, Bagher

, Kelly

MEM

, et al. Cannabidiol is a negative allosteric modulator of the cannabinoid CB1 receptor. Br J Pharmacol, 2015; 172(20):4790–4805; doi: 10.1111/bph.13250

39.

Watanabe

, Kayano

, Matsunaga

, et al. Inhibition of anandamide amidase activity in mouse brain microsomes by cannabinoids. Biol Pharm Bull, 1996; 19(8):1109–1111; doi: 10.1248/bpb.19.1109

40.

Richardson

, Hester

, McLemore

. Prenatal cannabis exposure—The “first hit” to the endocannabinoid system. Neurotoxicol Teratol, 2016; 58:5–14; doi: 10.1016/j.ntt.2016.08.003

41.

Grundy

. Principles and standards for reporting animal experiments in The Journal of Physiology and Experimental Physiology. Exp Physiol, 2015; 100(7):755–758; doi: 10.1113/EP085299

42.

Gillies

, Lee

, Vanin

, et al. Maternal exposure to Δ⁹-tetrahydrocannabinol impairs female offspring glucose homeostasis and endocrine pancreatic development in the rat. Reprod Toxicol, 2020; 94:84–91; doi: 10.1016/j.reprotox.2020.04.070

43.

Oke

, Lee

, Papp

, et al. In utero exposure to Δ⁹-tetrahydrocannabinol leads to postnatal catch-up growth and dysmetabolism in the adult rat liver. Int J Mol Sci, 2021; 22(14):7502; doi: 10.3390/ijms22147502

44.

Martínez-Peña

, Lee

, Petrik

, et al. Gestational exposure to Δ9-THC impacts ovarian follicular dynamics and angiogenesis in adulthood in Wistar rats. J Dev Orig Health Dis, 2021; 12(6):865–869; doi: 10.1017/S2040174420001282

45.

Sarikahya

, Cousineau

, Felice

, et al. Prenatal THC exposure induces sex-dependent neuropsychiatric endophenotypes in offspring and long-term disruptions in fatty-acid signaling pathways directly in the mesolimbic circuitry. eNeuro, 2022; 9(5); doi: 10.1523/ENEURO.0253-22.2022

46.

Dinieri

, Hurd

. Rat models of prenatal and adolescent cannabis exposure. Methods Mol Biol, 2012; 829:231–242; doi: 10.1007/978-1-61779-458-2_14

47.

Neradugomma

, Drafton

, Mor

, et al. Marijuana-derived cannabinoids inhibit uterine endometrial stromal cell decidualization and compromise trophoblast-endometrium cross-talk. Reprod Toxicol, 2019; 87:100–107; doi: 10.1016/j.reprotox.2019.05.064

48.

Klein

, Karanges

, Spiro

, et al. Cannabidiol potentiates Δ⁹-tetrahydrocannabinol (THC) behavioural effects and alters THC pharmacokinetics during acute and chronic treatment in adolescent rats. Psychopharmacology (Berl), 2011; 218(2):443–457; doi: 10.1007/s00213-011-2342-0

49.

Callejas

, Figueira

, Gonçalves

FLL

, et al. Maternal administration of cannabidiol promotes an anti-inflammatory effect on the intestinal wall in a gastroschisis rat model. Braz J Med Biol Res, 2018; 51:e7132; doi: 10.1590/1414-431X20177132

50.

Kim

, de Castro

, Lendoiro

, et al. Detection of in utero cannabis exposure by umbilical cord analysis. Drug Test Anal, 2018; 10(4):636–643; doi: 10.1002/dta.2307

51.

Ujváry

, Hanuš

. Human metabolites of cannabidiol: A review on their formation, biological activity, and relevance in therapy. Cannabis Cannabinoid Res, 2016; 1(1):90–101; doi: 10.1089/can.2015.0012

52.

Nair

, Jacob

. A simple practice guide for dose conversion between animals and human. J Basic Clin Pharm, 2016; 7(2):27–31; doi: 10.4103/0976-0105.177703

53.

Zacchigna

, Paldino

, Falcão-Pires

, et al. Towards standardization of echocardiography for the evaluation of left ventricular function in adult rodents: A position paper of the ESC Working Group on Myocardial Function. Cardiovasc Res, 2021; 117(1):43–59; doi: 10.1093/cvr/cvaa110

54.

Zhang

, Parmigiani

, Johnson

. ComBat-seq: Batch effect adjustment for RNA-seq count data. NAR Genom Bioinform, 2020; 2(3):lqaa078; doi: 10.1093/nargab/lqaa078

55.

Chen

, Lun

ATL

, Smyth

. From reads to genes to pathways: Differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. F1000Res, 2016; 5:1438; doi: 10.12688/f1000research.8987.2

56.

Tortoriello

, Morris

, Alpar

, et al. Miswiring the brain: Δ⁹-tetrahydrocannabinol disrupts cortical development by inducing an SCG10/stathmin-2 degradation pathway. EMBO J, 2014; 33(7):668–685; doi: 10.1002/embj.201386035

57.

Gunn

JKL

, Rosales

, Center

, et al. Prenatal exposure to cannabis and maternal and child health outcomes: A systematic review and meta-analysis. BMJ Open, 2016; 6(4):e009986; doi: 10.1136/bmjopen-2015-009986

58.

Hindmarsh

, Bryan

, Geary

MPP

, et al. Effects of current size, postnatal growth, and birth size on blood pressure in early childhood. Pediatrics, 2010; 126(6):e1507-13; doi: 10.1542/peds.2010-0358

59.

Barker

. The fetal and infant origins of adult disease. BMJ, 1990; 301(6761):1111; doi: 10.1136/bmj.301.6761.1111

60.

Zohdi

, Lim

, Pearson

, et al. Developmental programming of cardiovascular disease following intrauterine growth restriction: Findings utilising a rat model of maternal protein restriction. Nutrients, 2015; 7(1):119–152; doi: 10.3390/nu7010119

61.

, Williams

, O'Brien

, et al. Hypoxia or nutrient restriction during pregnancy in rats leads to progressive cardiac remodeling and impairs postischemic recovery in adult male offspring. FASEB J, 2006; 20(8):1251–1253; doi: 10.1096/fj.05-4917fje

62.

Lawrence

, Xiao

, Xue

, et al. Prenatal nicotine exposure increases heart susceptibility to ischemia/reperfusion injury in adult offspring. J Pharmacol Exp Ther, 2008; 324(1):331–341; doi: 10.1124/jpet.107.132175

63.

Loche

, Blackmore

, Carpenter

, et al. Maternal diet-induced obesity programmes cardiac dysfunction in male mice independently of post-weaning diet. Cardiovasc Res, 2018; 114(10):1372–1384; doi: 10.1093/cvr/cvy082

64.

Dewald

, Duerr

, Dewald

, et al. The Role for the Endocannabinoid System in Cardioprotection and Myocardial Adaptation. In: Cannabinoids in Health and Disease. ( Meccariello

, Chianese

, eds.) Intech Open Limited: London, UK; 2016.

65.

Duerr

, Heinemann

, Suchan

, et al. The endocannabinoid-CB2 receptor axis protects the ischemic heart at the early stage of cardiomyopathy. Basic Res Cardiol, 2014; 109(4):425; doi: 10.1007/s00395-014-0425-x

66.

Duerr

, Heinemann

, Kley

, et al. Myocardial maladaptation to pressure overload in CB2 receptor-deficient mice. J Mol Cell Cardiol, 2019; 133:86–98; doi: 10.1016/j.yjmcc.2019.06.003

67.

Lopaschuk

, Karwi

, Tian

, et al. Cardiac energy metabolism in heart failure. Circ Res, 2021; 128(10):1487–1513; doi: 10.1161/CIRCRESAHA.121.318241

68.

Zhou

, Tian

. Mitochondrial dysfunction in pathophysiology of heart failure. J Clin Invest, 2018; 128(9):3716–3726; doi: 10.1172/JCI120849

69.

Walker

, Ragos

, Gurm

, et al. Delta-9-tetrahydrocannabinol disrupts mitochondrial function and attenuates syncytialization in human placental BeWo cells. Physiol Rep, 2020; 8(13):e14476; doi: 10.14814/phy2.14476

70.

Chaanine

, Joyce

, Stulak

, et al. Mitochondrial morphology, dynamics, and function in human pressure overload or ischemic heart disease with preserved or reduced ejection fraction. Circ Heart Fail, 2019; 12(2):e005131; doi: 10.1161/CIRCHEARTFAILURE.118.005131

71.

Quiles

, Gustafsson ÅB. The role of mitochondrial fission in cardiovascular health and disease. Nat Rev Cardiol, 2022; 19(11):723–736; doi: 10.1038/s41569-022-00703-y

72.

Fedele

, Brand

. The intrinsic cardiac nervous system and its role in cardiac pacemaking and conduction. J Cardiovasc Dev Dis, 2020; 7(4):54; doi: 10.3390/jcdd7040054

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.25 MB

0.29 MB

0.36 MB

0.16 MB

0.17 MB

0.20 MB

0.16 MB

0.15 MB

Cannabidiol Exposure During Gestation Leads to Adverse Cardiac Outcomes Early in Postnatal Life in Male Rat Offspring

Abstract

Introduction:

Methods:

Results:

Conclusion:

Introduction

Methods

CBD animal model

Drug preparation and exposure

Echocardiographic assessment of cardiac function

RNA extractions and real-time quantitative reverse transcription polymerase chain reaction

Protein extraction and Western blot

RNA-sequencing and analysis

Statistical analysis

Results

CBD exposure in rats does not affect maternal weight gain and food intake

CBD exposure in rats does not affect neonatal and postnatal weight measurements

PND21 male but not female offspring exposed to a daily dose of 3 or 30 mg/kg CBD in gestation exhibit reduced cardiac function

The ECS was altered in PND21 male offspring hearts exposed to CBD in gestation

Alteration in the ECS mRNA expression was observed as early as PND1 in male offspring hearts exposed to CBD in gestation

Transcriptomic changes in PND21 male offspring hearts exposed to 3 and 30 mg/kg CBD during gestation

Discussion

Data Availability

Footnotes

Acknowledgments

Authors' Contributions

Author Disclosure Statement

Funding Information

Supplementary Material

Abbreviations Used

References

Supplementary Material